ID: 915204228

View in Genome Browser
Species Human (GRCh38)
Location 1:154257525-154257547
Sequence GCTTGAGTATGTGCAAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915204228_915204230 -4 Left 915204228 1:154257525-154257547 CCAAAACTTGCACATACTCAAGC 0: 1
1: 0
2: 2
3: 27
4: 239
Right 915204230 1:154257544-154257566 AAGCCCTGCAGTTGGCTCTGTGG 0: 1
1: 1
2: 19
3: 67
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915204228 Original CRISPR GCTTGAGTATGTGCAAGTTT TGG (reversed) Intronic
902045790 1:13523371-13523393 GCATTAGTATGTGTAAGTTAGGG + Intergenic
904087562 1:27920405-27920427 ACTTGAGTATGGGCAGATTTTGG - Intergenic
905978303 1:42197529-42197551 ACTTGAGCATGTGCAGATTTTGG - Intronic
910219298 1:84874309-84874331 TCTTGTGTCAGTGCAAGTTTTGG + Intronic
911428336 1:97750843-97750865 ACTTGAGTATGTGCAAATTTTGG + Intronic
911457707 1:98147683-98147705 ACTTGAGTATGTGCAGATTTTGG - Intergenic
912685481 1:111759192-111759214 ACTTGAGCATCTGCCAGTTTTGG + Intronic
915204228 1:154257525-154257547 GCTTGAGTATGTGCAAGTTTTGG - Intronic
915834092 1:159160602-159160624 TCTTGAGTATGTGCAGATTTTGG - Intergenic
916213775 1:162379085-162379107 GCTTGGGTGTGTGCATGTTGGGG + Intronic
916930549 1:169574152-169574174 ACTTGAGCATCTGCAAATTTTGG + Intronic
917633750 1:176915972-176915994 GACTGAGAATGGGCAAGTTTCGG - Intronic
918578619 1:186097423-186097445 GCTTGAGCATCTGCAGATTTTGG + Intronic
918615446 1:186539323-186539345 GTTTCAGTTTGTGCCAGTTTGGG + Intergenic
919649123 1:200128135-200128157 ACTTGAGTGTGTGCAGATTTTGG - Intronic
920765009 1:208823871-208823893 ACTTGAGCATCTGCAAATTTGGG - Intergenic
922822870 1:228495928-228495950 ACTTGAGTATCTGCAGATTTTGG - Intergenic
923991544 1:239442731-239442753 GCTTGAGTATCTGCCACTTCTGG - Intronic
924129712 1:240894231-240894253 CCTTGAGTTTCTTCAAGTTTGGG + Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1064024803 10:11839323-11839345 GCTTGTGTTTTTGCAAATTTAGG - Intronic
1065668851 10:28091941-28091963 GCTTGAGCATCTGCAGATTTTGG + Intronic
1065796181 10:29310515-29310537 GCTTGAGTTTGTTCTAGATTTGG + Intronic
1066161779 10:32740536-32740558 ACTTGACTATGTGCAGATTTTGG + Intronic
1066161823 10:32741465-32741487 ACTTGACTATGTGCAGATTTTGG - Intronic
1066251849 10:33640947-33640969 TCTTGAGCATGTGCAGATTTTGG - Intergenic
1066747743 10:38618235-38618257 ACTTGAGTATGGGCAGATTTTGG - Intergenic
1067205750 10:44211224-44211246 ACTTGAGTATCTGCAGCTTTTGG + Intergenic
1067250305 10:44580973-44580995 GCTAGAGTTTTTGCTAGTTTGGG - Intergenic
1068100565 10:52547452-52547474 ACTTGAGTATCTGCAGATTTTGG + Intergenic
1068245542 10:54361133-54361155 ACCTGAGTATGTGCAGATTTTGG - Intronic
1068451402 10:57194264-57194286 ACTTGACTATGCACAAGTTTGGG + Intergenic
1068482083 10:57604295-57604317 GATTGAGTATGTGCTGATTTTGG - Intergenic
1068494585 10:57770948-57770970 GCTTGCTTATGTGTAAGATTAGG - Intergenic
1070180166 10:74005690-74005712 ACTTGAGTATCTGCAGATTTTGG - Intronic
1074739132 10:116467484-116467506 GCTTGAGTATTTGCTATTTTAGG - Intronic
1075476169 10:122735900-122735922 GCGTGTGTGTGTGTAAGTTTTGG + Intergenic
1077526837 11:3071642-3071664 GCATTAGTATGTGAAAGTGTAGG + Intergenic
1077929905 11:6720466-6720488 GCTTCAGTTGGTGCCAGTTTGGG - Intergenic
1079214354 11:18494722-18494744 GCTTGCTTGTGTGCAGGTTTGGG - Intronic
1079582662 11:22085616-22085638 GCTTATGTATCTGGAAGTTTAGG - Intergenic
1082027538 11:47583919-47583941 GGTTGTGTATCTGCCAGTTTAGG + Intronic
1082183474 11:49148856-49148878 ACTTGAGTATGCACAAATTTTGG - Intronic
1084643442 11:70439877-70439899 ACTTGAGTATGTGCAGATTTGGG - Intergenic
1086338337 11:85822335-85822357 GCTTGAGCATGGCCAAGGTTGGG - Intergenic
1086682889 11:89696488-89696510 ACTTGAGTATGCACAAATTTTGG + Intergenic
1087241184 11:95782428-95782450 ACTGGAGTATATGCAAATTTTGG + Intronic
1087785909 11:102353956-102353978 ACTTCAGTATGTGCGAATTTTGG - Intronic
1088846037 11:113668937-113668959 ACTTGAGTATGCACAAATTTTGG + Intergenic
1090232871 11:125121516-125121538 GCTTGAGCATGTTCAAGGCTGGG + Intergenic
1093724623 12:22489604-22489626 ACTTGAGCATCTGCAGGTTTTGG + Intronic
1094249156 12:28339680-28339702 ACTTGAGCATCTGCAGGTTTTGG + Intronic
1094678490 12:32646427-32646449 ACTTGAGTATGAGCAGATTTGGG - Intergenic
1095235681 12:39792634-39792656 ACTTGAGTATGTGTGGGTTTTGG - Intronic
1095592669 12:43921265-43921287 GTTTGAGTATATGCATGTTCTGG - Intronic
1096202635 12:49696319-49696341 GTTTGAGTATGCTCAGGTTTTGG - Intronic
1097037463 12:56133246-56133268 GCGTGAGTATGTGCATGGTAGGG - Intronic
1097908917 12:64948501-64948523 GCTTGAGTCAGTGCCAGATTTGG + Intergenic
1100723051 12:97378941-97378963 GCCTTAGTATAGGCAAGTTTTGG + Intergenic
1100837563 12:98581184-98581206 TCTTGAGCATATGCAAATTTTGG + Intergenic
1101076777 12:101138251-101138273 ACTTGAGTATATGCAAATTTTGG + Intergenic
1103566932 12:121821021-121821043 CTTTGAGTATGTGCAGATTTAGG + Intronic
1109820703 13:67649598-67649620 ACTTGAACATTTGCAAGTTTTGG - Intergenic
1110442506 13:75541032-75541054 ACTTGAGTATATGCAGATTTTGG - Intronic
1111099745 13:83568132-83568154 TCTTGAATATGTGCAGATTTGGG + Intergenic
1111257701 13:85694165-85694187 GCTTGTGTATCTGCCAGTTTTGG - Intergenic
1112721645 13:102252474-102252496 ACTTGAGTATTTGCAGATTTGGG - Intronic
1114915582 14:27260492-27260514 ACTTGAGCATGTGCCAATTTTGG - Intergenic
1116439281 14:44932992-44933014 ACTTGAGCATCTGCAAATTTTGG - Intronic
1118302805 14:64630390-64630412 ACTTGAGTATCTGCAGATTTTGG + Intergenic
1120805169 14:88739370-88739392 ACTTGAGTATGTGTAGATTTTGG + Intronic
1124704203 15:31948062-31948084 AGTTGAGTATGTGCAGATTTGGG + Intergenic
1127065865 15:55237518-55237540 GCTTGGATATTTGCAAGTATAGG + Intronic
1127975399 15:63993271-63993293 GCTTGAATAGTGGCAAGTTTAGG + Intronic
1129289258 15:74551004-74551026 ACTTGAGTATGCTCAAATTTTGG - Intronic
1130293521 15:82625547-82625569 ACTTGAGTATGTGCGGATTTTGG - Intronic
1131281238 15:91022972-91022994 GCTTGATTAGGTTCAATTTTTGG - Intergenic
1133900194 16:9966836-9966858 GCCTGAGAATGTGCATATTTTGG + Intronic
1135126041 16:19810138-19810160 GCTACAGTATGCACAAGTTTAGG + Intronic
1136159071 16:28406115-28406137 ACTTGAGTATGTACAGGTTTTGG + Intergenic
1136204016 16:28709168-28709190 ACTTGAGTATGTACAGGTTTTGG - Intronic
1136735013 16:32459061-32459083 ACTTGAGTATGGGCAGATTTTGG + Intergenic
1137492515 16:48944762-48944784 GCTTGCTTAAGTTCAAGTTTGGG + Intergenic
1139673319 16:68506404-68506426 TCTTTAGTTTGTGCTAGTTTGGG + Intergenic
1140788102 16:78363247-78363269 TTTAGAGTATGTGCAAGTTTGGG + Intronic
1140945866 16:79767974-79767996 GCTGGGGTTTGTGAAAGTTTGGG + Intergenic
1141310463 16:82908740-82908762 ACTTGAGTATCTGCAGATTTTGG - Intronic
1203018067 16_KI270728v1_random:370531-370553 ACTTGAGTATGGGCAGATTTTGG - Intergenic
1203036402 16_KI270728v1_random:643689-643711 ACTTGAGTATGGGCAGATTTTGG - Intergenic
1143497163 17:7318837-7318859 CATTGAGAATGTGCCAGTTTTGG - Intronic
1148214184 17:45825435-45825457 GATAGAGTGTGTGCAAGTGTTGG - Intronic
1149304376 17:55334265-55334287 ACTTGAGTATGTGCAAATTTGGG - Intergenic
1149602388 17:57901605-57901627 GACAGAGTAGGTGCAAGTTTGGG - Intronic
1151864982 17:76795567-76795589 ACTTGAGCATCTGCAGGTTTTGG + Intergenic
1151991957 17:77581027-77581049 GCCTGAGGATGAGCAAGTTGAGG - Intergenic
1153499377 18:5732558-5732580 GCTTGTGTATGTGAATGTGTGGG + Intergenic
1156792658 18:40995464-40995486 GCTTGAGTATCCACAGGTTTTGG + Intergenic
1157455035 18:47818965-47818987 GTTTGTGTATGTGTATGTTTAGG + Exonic
1158820828 18:61157186-61157208 GCTTGTTTATGTCCAAATTTTGG + Intergenic
1159151250 18:64526361-64526383 GCTTGAGCATCTTCCAGTTTGGG - Intergenic
1160224551 18:77002028-77002050 TATTGATTATGTGCCAGTTTTGG + Intronic
1162130055 19:8520923-8520945 GCTTGAATTTGTCCCAGTTTGGG - Exonic
1167076623 19:47254046-47254068 GCTTTATTATGTCTAAGTTTTGG + Intergenic
1167242373 19:48351918-48351940 GCTTGAGCATCTGTAGGTTTGGG - Intronic
1167290683 19:48623812-48623834 GATTGAGAATGTGCAAGGTAAGG - Intronic
1167849246 19:52189623-52189645 GCTGGAGGGTGTGCAGGTTTTGG - Intergenic
1168125849 19:54282311-54282333 GCTGGAGTACGAGCAAGTGTTGG - Intergenic
1168190806 19:54737542-54737564 GCTTGAGCATCTGCAGATTTTGG + Intronic
1168203131 19:54831361-54831383 GCTTGAGCATCTGCAGATTTTGG + Intronic
1168205733 19:54849472-54849494 GCTTGAGCATCTGCAGATTTTGG + Intronic
1168208156 19:54867793-54867815 GCTTGAGCATCTGCAGATTTTGG + Intergenic
925074829 2:1007136-1007158 ACTTGAGTATGTGTGGGTTTGGG + Intronic
925080683 2:1062230-1062252 GCTTGATCATGTTCAAATTTAGG - Intronic
925507580 2:4585141-4585163 GCTTGAGCATAAGCAAATTTTGG + Intergenic
929496509 2:42449061-42449083 ACTTGAGTATGTTCAGATTTTGG + Intronic
929868924 2:45741632-45741654 TTTTGGGCATGTGCAAGTTTTGG + Intronic
929898083 2:45978757-45978779 GCTTGGGGAGGTGCAAGGTTTGG - Intronic
931333077 2:61308637-61308659 GCTTCAGTATTTACATGTTTAGG - Intronic
931712011 2:64996195-64996217 GTTTGAGTATGTGGGAGTTGGGG - Intronic
931963140 2:67503788-67503810 ACTTGAGTATTTGCAGATTTTGG - Intergenic
932056926 2:68454966-68454988 ACTTGAGCATCTGCAAATTTTGG - Intergenic
932216696 2:69970724-69970746 GCTGGAGGATGTGCAGGTTGTGG - Intergenic
932837718 2:75052771-75052793 GCGTGTGTGTGTGCAAGCTTGGG + Intronic
933542373 2:83663499-83663521 ACTTGAGCATCTGCAAATTTTGG + Intergenic
934310707 2:91860375-91860397 ACTTGAGTATGGGCAGATTTTGG - Intergenic
938257260 2:129868919-129868941 GCTTGGGAATGTACAAGTGTTGG - Intergenic
938509460 2:131925649-131925671 GCTAGAGTGTGATCAAGTTTTGG - Intergenic
939061369 2:137425589-137425611 ACTTGAGTACCTGCAGGTTTTGG + Intronic
940477406 2:154181073-154181095 ACTTGAATATGTGCAGATTTTGG + Intronic
941583058 2:167324083-167324105 GCTTGAGCAGGTGCAAGATTTGG + Intergenic
941718058 2:168784552-168784574 GAATGAGTACGTGTAAGTTTTGG - Intergenic
943040498 2:182798778-182798800 GCTTGAACATCTGCAAATTTTGG - Intergenic
944824465 2:203467678-203467700 ACTTGTGTACGTGCAGGTTTTGG + Intronic
945128526 2:206540404-206540426 ACTTGAGTATGTGCAGATTTGGG + Intronic
945322634 2:208443193-208443215 ACTTGAGTATCTGCAGATTTTGG + Intronic
947328713 2:229005390-229005412 GCTTAAGCCTGTGCAATTTTAGG + Intronic
1175270396 20:57729955-57729977 GCCTGAGAGTCTGCAAGTTTGGG - Intergenic
1175289070 20:57861466-57861488 ACTTGAGTATGTGCACATTTTGG - Intergenic
1176784021 21:13232913-13232935 GCTAGAGTGTGATCAAGTTTTGG + Intergenic
1177982072 21:27926744-27926766 GCTAGAGTGTGATCAAGTTTTGG + Intergenic
1179264490 21:39791011-39791033 ACTTGAGCATTTGCAAATTTTGG + Intronic
1179352661 21:40627667-40627689 GTTTAAGTAAGTGCAAGTGTTGG - Intronic
1182224263 22:28783634-28783656 GATTGAGTCTATGTAAGTTTTGG + Exonic
1183711506 22:39506580-39506602 GCTTGAGTATGTACGAGACTAGG - Intronic
949103564 3:176371-176393 ACTTGAGTATCTGCAGATTTTGG - Intergenic
950777554 3:15363671-15363693 GCTTGAGTATGCCCAGATTTAGG - Intergenic
951104457 3:18726770-18726792 ACTTGAGTAAGTGCAGATTTTGG - Intergenic
951693299 3:25419442-25419464 GCTTGAGGAGGCCCAAGTTTGGG - Intronic
953052873 3:39361888-39361910 GCTAGAGTATGTAAAAGTCTTGG - Intergenic
953251376 3:41248082-41248104 GCATGAGGATGTGCTATTTTTGG + Intronic
955691698 3:61597333-61597355 ACTTGAGCATCTGCAAATTTTGG - Intronic
955897326 3:63714341-63714363 ACTTGAGTATGTGCACACTTTGG + Intergenic
957258584 3:77870913-77870935 ACTTGAGTATCTGCAAATTTTGG - Intergenic
958602724 3:96318537-96318559 GCTTGAGCATGTATAAATTTTGG - Intergenic
961126888 3:124427033-124427055 TCTTGATTATATGCAAATTTTGG - Intronic
961808342 3:129505463-129505485 GCTGAAGTATCTGCATGTTTGGG + Intronic
962513121 3:136122402-136122424 ACTTGACTATATGCAAATTTGGG - Intronic
963739157 3:149057534-149057556 ACTTGAGTATGCGCACATTTTGG + Intronic
963870056 3:150407215-150407237 GCTTTAGTATGTCAAAGTTTAGG + Intergenic
964960623 3:162419238-162419260 CCTTGAATATGTACAAATTTAGG - Intergenic
966316650 3:178654848-178654870 GCCTGAATAGGTTCAAGTTTTGG + Intronic
971105588 4:23520958-23520980 ACTTGAATATGTGCAGATTTGGG - Intergenic
971238421 4:24864923-24864945 ACTTGAGTATGTGAGAATTTTGG + Intronic
972006626 4:34117484-34117506 GTTTGAGTATATGCCAGTTGAGG - Intergenic
972091132 4:35285470-35285492 TGTTGAGTATCTGCAGGTTTAGG - Intergenic
972250698 4:37297180-37297202 ACTTGAGCATGTGCAAATTTTGG - Intronic
972337969 4:38125144-38125166 GCTTAAGCATTTGCAAGGTTTGG - Intronic
972807402 4:42544107-42544129 GTTTGTGTATGTGGAAGGTTAGG - Intronic
972879078 4:43401287-43401309 GCTACACTATGTACAAGTTTGGG - Intergenic
972917827 4:43903139-43903161 GCTTGAGTGTGTGCATGCTAGGG - Intergenic
973535404 4:51876752-51876774 ACTTGAGTATGTGTAGATTTGGG + Intronic
973630385 4:52814888-52814910 ACTTGAGTATATGCAGATTTTGG - Intergenic
975224069 4:71849169-71849191 ACTTGAGTATGTGCAGATTTTGG + Intergenic
976352082 4:84071102-84071124 GCTTGCTTATGTGCTTGTTTTGG - Intergenic
977943867 4:102888323-102888345 ACTTGAGTATGGGCAGATTTTGG - Exonic
978475318 4:109121853-109121875 TCTTGATTATTTACAAGTTTTGG - Intronic
979987349 4:127331434-127331456 ACTTGAGTATCTGTAAGTCTGGG + Intergenic
980243396 4:130204602-130204624 ATTTGAGTATGTGCAGATTTTGG + Intergenic
980569153 4:134588076-134588098 GCTTGATTATGTACAGATTTTGG - Intergenic
980696994 4:136370721-136370743 GCTTGAGTATACTCAAATTTTGG + Intergenic
981557717 4:146013538-146013560 GTTTGTGTATGTGCATGTGTGGG - Intergenic
983443254 4:167814785-167814807 GCCTGAGTAGGTGAAAGTCTAGG + Intergenic
984527734 4:180876636-180876658 ATTTGTGTGTGTGCAAGTTTAGG - Intergenic
986724794 5:10586194-10586216 ACTTGAGTATATGCAGATTTGGG - Intronic
987628286 5:20432137-20432159 CCTTGAGCATGTATAAGTTTAGG + Intronic
992307589 5:75459249-75459271 GAATGAGTATGTTCATGTTTTGG - Intronic
992412179 5:76516601-76516623 GTTTGAGTATGTGCGTGTGTTGG + Intronic
992427722 5:76675289-76675311 ACTTGAGTATGCACAAATTTTGG + Intronic
993322191 5:86485522-86485544 GCTTGGGTGTGAGCAACTTTTGG - Intergenic
993596327 5:89860819-89860841 ACTTGAGTATATGCAAATTTTGG - Intergenic
993978260 5:94509556-94509578 GATTAAATATATGCAAGTTTTGG - Intronic
994112455 5:96022155-96022177 GCTTGAGCATCTCCAGGTTTTGG + Intergenic
994701297 5:103139007-103139029 ACTTGAGTATGTGAAGATTTTGG + Intronic
994992730 5:107017685-107017707 GGTTGTCTATGTGCATGTTTGGG + Intergenic
995810240 5:116098647-116098669 ACTTGAGTATCTGCAGTTTTGGG + Intronic
996933500 5:128920029-128920051 ACTTGAGTATGTGTGAATTTTGG - Intronic
997916073 5:137926878-137926900 ACTTGAGTATATGCAGATTTTGG + Intronic
998852065 5:146360597-146360619 GCTTGAAGATATTCAAGTTTAGG + Intergenic
1001327071 5:170736767-170736789 ACTTGAGTATCTGCAGATTTTGG - Intergenic
1001790554 5:174454144-174454166 GCTTGTGTATGTGTAGGTATAGG + Intergenic
1002766295 6:241706-241728 GCTTGAGTGTGTGCAACAGTGGG - Intergenic
1002779572 6:356073-356095 GTTTGAACATCTGCAAGTTTGGG + Intergenic
1002819656 6:712893-712915 GCTTGAGATTTTGTAAGTTTAGG + Intergenic
1003046075 6:2733965-2733987 CCTTGACTTTGAGCAAGTTTTGG - Intronic
1003363346 6:5449946-5449968 ACTTGAGTATGTGCAGATTTTGG - Intronic
1005750861 6:28881208-28881230 GTATTAGTATTTGCAAGTTTTGG + Intergenic
1006015164 6:31075035-31075057 ACTTGAATATGTGTAGGTTTTGG + Intergenic
1006133464 6:31882380-31882402 GCTGGAGAAAGTGCCAGTTTGGG - Intronic
1008286047 6:49652088-49652110 ACTTGAGCATCTGCAAATTTTGG + Intergenic
1008766710 6:54925778-54925800 ACTTGAGTATGTGCAGATTTTGG + Intronic
1011909551 6:92419423-92419445 ACTTGAGTGTATGCAAATTTTGG - Intergenic
1012538588 6:100330978-100331000 ACTTGAGCATCTGCAGGTTTTGG + Intergenic
1012551251 6:100466320-100466342 GCTGGAGGAGGTGAAAGTTTTGG + Intergenic
1015556341 6:134465248-134465270 GCTTTTGTATGTGCTATTTTAGG + Intergenic
1018476548 6:164148107-164148129 ACTTGAGCATCTGCAAATTTTGG + Intergenic
1020159237 7:5755708-5755730 ATTTGAGTATGTGGCAGTTTAGG + Intronic
1020663659 7:11012347-11012369 ACTTGAATATGTGCTAATTTTGG - Intronic
1021147960 7:17112140-17112162 ACTTGAGCATTTGCAATTTTCGG - Intergenic
1021655604 7:22870672-22870694 GCTTGACTATGTTTTAGTTTGGG - Intergenic
1021759658 7:23891225-23891247 ACTTGAGTATGTGAGAATTTTGG + Intergenic
1023026277 7:36053240-36053262 ACTTGAGTGTCTGCAAATTTTGG + Intergenic
1024028306 7:45433117-45433139 GCTTGCCTATTTCCAAGTTTTGG + Intergenic
1025194485 7:56922269-56922291 CCTGGAGTATGTGCAGATTTTGG + Intergenic
1025677467 7:63654680-63654702 CCTGGAGTATGTGCAGATTTTGG - Intergenic
1026016600 7:66676369-66676391 GCTTGAGTATGTGAGGATTTTGG - Intronic
1026818783 7:73532652-73532674 ACTTGAGCATCTGCAGGTTTTGG + Intergenic
1028232266 7:88319668-88319690 GCTAGAATATGTGGGAGTTTAGG + Intergenic
1028722062 7:94044660-94044682 GCATGCATATGTGCATGTTTGGG + Intergenic
1029672512 7:102043517-102043539 CCTTGAGTATGTGCAGATTTTGG + Intronic
1030322351 7:108182433-108182455 ACTTGAGTATTTGCAGATTTGGG + Intronic
1030405522 7:109107232-109107254 GTTTGAGTGTGTACAAATTTTGG + Intergenic
1031074962 7:117202920-117202942 ACTTGAGTATGTGCAGATTTTGG - Intronic
1032774071 7:135091341-135091363 ACTTGAGTATGTGTAGATTTTGG - Intronic
1037056757 8:14452059-14452081 TCTTGATTATTTCCAAGTTTTGG - Intronic
1037147970 8:15596492-15596514 GCTTGAGTATATGCGGATTTTGG + Intronic
1037594607 8:20344441-20344463 GCTGGAGGATGTGCAAGATGTGG + Intergenic
1037614787 8:20508941-20508963 GCTTGAGTATGCTCAGATTTTGG - Intergenic
1038514862 8:28179146-28179168 ACTTGAGTGTGTGCAGATTTTGG + Intronic
1038734130 8:30154066-30154088 GCTTGAGCATCTGCAGATTTTGG - Intronic
1039787270 8:40844992-40845014 GCATGAGTATGTGCAGTTTATGG - Intronic
1041121755 8:54593039-54593061 GCTTGAGAATGTGCCAAATTAGG + Intergenic
1041284451 8:56245819-56245841 ACTTGAGTATGTGCATATTTTGG + Intergenic
1041922606 8:63199322-63199344 ACTTGAGTATGTGCAGATTTTGG - Intronic
1042333306 8:67605354-67605376 ACTTGAGCATCTGCAAATTTTGG - Intronic
1042570721 8:70161854-70161876 GCTTTAGTATGTGCTAATTTGGG - Intronic
1045885618 8:107094311-107094333 ACTTGGTTATTTGCAAGTTTTGG + Intergenic
1048156514 8:131960381-131960403 ACTTGAATATGTGCAGATTTTGG + Intronic
1050363832 9:4855853-4855875 GCCTGTGTATTTGCAAGTTTGGG - Intronic
1051897166 9:21998820-21998842 GTTTGAGCATGTGCAATGTTAGG - Intronic
1052917024 9:33931238-33931260 ACTTGAGAATGTGCAGATTTTGG + Intronic
1053668903 9:40340209-40340231 GCCAGAGTTTGTGCAAGTATTGG + Intergenic
1053918698 9:42966481-42966503 GCCAGAGTTTGTGCAAGTATTGG + Intergenic
1054380038 9:64480245-64480267 GCCAGAGTTTGTGCAAGTATTGG + Intergenic
1054515708 9:66036085-66036107 GCCAGAGTTTGTGCAAGTATTGG - Intergenic
1055222737 9:73957010-73957032 ACTTGACTATGTGCAGATTTTGG - Intergenic
1059024649 9:110612932-110612954 ACTTGAGTATACGCAAATTTTGG - Intergenic
1059631437 9:116127774-116127796 ACTTGAGTATCTTCAAATTTTGG + Intergenic
1062104262 9:134744492-134744514 GCATGAGTGTGTGCAGGTGTGGG - Intronic
1186255473 X:7713658-7713680 CCTTGAGTATTCTCAAGTTTTGG - Intergenic
1187617624 X:21014970-21014992 GCTTAAGAATCTGCAATTTTGGG + Intergenic
1193052826 X:77119270-77119292 ACTTGCGTATGAACAAGTTTTGG + Intergenic
1193693949 X:84683009-84683031 GCTTGAATATTGTCAAGTTTTGG - Intergenic
1194709598 X:97218677-97218699 ACTTGAGCATCTGCAAATTTTGG - Intronic
1195687499 X:107600167-107600189 ACTTGAGCATCTGCAAGTTTTGG + Intronic
1195999960 X:110772021-110772043 ACTTCAGTATTTTCAAGTTTTGG - Intronic
1198014613 X:132596201-132596223 GCTTGAGCATCTGCAGGTTTTGG + Intergenic
1198772822 X:140149000-140149022 GTTTGAGTATATGTCAGTTTGGG + Intergenic
1200052217 X:153440196-153440218 GCATGTGTGTGTGCAAGTGTGGG + Intergenic
1201051188 Y:9937237-9937259 TCTTGAGTATCTGCAAGTACGGG + Intergenic