ID: 915206240 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:154272541-154272563 |
Sequence | TGAAATGGAGGCGGGACCGA AGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 105 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 102} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
915206240_915206248 | 11 | Left | 915206240 | 1:154272541-154272563 | CCTTCGGTCCCGCCTCCATTTCA | 0: 1 1: 0 2: 0 3: 2 4: 102 |
||
Right | 915206248 | 1:154272575-154272597 | CCGTCGTTTACGACAGTGTCAGG | 0: 1 1: 0 2: 0 3: 0 4: 13 |
||||
915206240_915206250 | 19 | Left | 915206240 | 1:154272541-154272563 | CCTTCGGTCCCGCCTCCATTTCA | 0: 1 1: 0 2: 0 3: 2 4: 102 |
||
Right | 915206250 | 1:154272583-154272605 | TACGACAGTGTCAGGATCGCGGG | 0: 1 1: 0 2: 0 3: 4 4: 53 |
||||
915206240_915206249 | 18 | Left | 915206240 | 1:154272541-154272563 | CCTTCGGTCCCGCCTCCATTTCA | 0: 1 1: 0 2: 0 3: 2 4: 102 |
||
Right | 915206249 | 1:154272582-154272604 | TTACGACAGTGTCAGGATCGCGG | 0: 1 1: 0 2: 0 3: 1 4: 33 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
915206240 | Original CRISPR | TGAAATGGAGGCGGGACCGA AGG (reversed) | Exonic | ||