ID: 915206240

View in Genome Browser
Species Human (GRCh38)
Location 1:154272541-154272563
Sequence TGAAATGGAGGCGGGACCGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915206240_915206248 11 Left 915206240 1:154272541-154272563 CCTTCGGTCCCGCCTCCATTTCA 0: 1
1: 0
2: 0
3: 2
4: 102
Right 915206248 1:154272575-154272597 CCGTCGTTTACGACAGTGTCAGG 0: 1
1: 0
2: 0
3: 0
4: 13
915206240_915206250 19 Left 915206240 1:154272541-154272563 CCTTCGGTCCCGCCTCCATTTCA 0: 1
1: 0
2: 0
3: 2
4: 102
Right 915206250 1:154272583-154272605 TACGACAGTGTCAGGATCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 53
915206240_915206249 18 Left 915206240 1:154272541-154272563 CCTTCGGTCCCGCCTCCATTTCA 0: 1
1: 0
2: 0
3: 2
4: 102
Right 915206249 1:154272582-154272604 TTACGACAGTGTCAGGATCGCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915206240 Original CRISPR TGAAATGGAGGCGGGACCGA AGG (reversed) Exonic