ID: 915212312

View in Genome Browser
Species Human (GRCh38)
Location 1:154319498-154319520
Sequence CTCCCAAGGGGGAATCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915212304_915212312 4 Left 915212304 1:154319471-154319493 CCTACATGTAGCGAATGGGCATA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 915212312 1:154319498-154319520 CTCCCAAGGGGGAATCTGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915212312 Original CRISPR CTCCCAAGGGGGAATCTGGG TGG Intergenic
901233155 1:7652362-7652384 CTCCCACGGGAGGAACTGGGAGG - Intronic
901441090 1:9278919-9278941 CTCCCCATGGGGATTCTGGTAGG + Intergenic
901529260 1:9843283-9843305 CTCCCAAGGGACAAGCTGGCAGG + Intergenic
901927119 1:12573290-12573312 CTCCCAAAGGAGGAGCTGGGAGG - Intronic
905632256 1:39525276-39525298 TCCCCAAGGGGGAACCTGGAAGG - Intronic
905801596 1:40847595-40847617 CTCTGAAGGGTGGATCTGGGTGG + Intergenic
906062837 1:42959439-42959461 CTCACAAACGGGAATGTGGGGGG - Intergenic
915212312 1:154319498-154319520 CTCCCAAGGGGGAATCTGGGTGG + Intergenic
915323689 1:155069915-155069937 CTCCCCAAGGGCACTCTGGGCGG + Intergenic
915404667 1:155650636-155650658 CTCTCAAGGGGGAATGAGGCAGG - Intergenic
915529837 1:156497063-156497085 TTCCCAGTGGGGAAGCTGGGGGG - Intronic
915832075 1:159140529-159140551 CTCCCATGCGGGACTCTGGACGG - Intronic
917696781 1:177533685-177533707 GTCCCAGTGGGGACTCTGGGTGG + Intergenic
919262026 1:195208574-195208596 GCCCCAATGGGGAATCTGTGTGG - Intergenic
919394104 1:197023140-197023162 CTCCCAGTGGGGACTCTGTGTGG - Intergenic
920706029 1:208251183-208251205 CGGCCCAGGGGGGATCTGGGAGG + Intergenic
922173471 1:223176897-223176919 CTCCCATGGAGGAAGCAGGGAGG - Intergenic
924582213 1:245332330-245332352 CTCCCAAGGGGGCAGGTGAGAGG + Intronic
1067840246 10:49670076-49670098 CTCAGAAGGGGGAGTGTGGGGGG - Intergenic
1069110012 10:64435646-64435668 CTCAGAAGGGAGAAACTGGGAGG + Intergenic
1071465749 10:85938148-85938170 CTTGCCAGGGGGAATCTGGATGG + Intronic
1071478105 10:86042095-86042117 CATGCAAGGGGGAAACTGGGAGG + Intronic
1072451893 10:95545266-95545288 TTGCCAGTGGGGAATCTGGGTGG - Intronic
1072909664 10:99488550-99488572 CTCCCAAGGGGAACTGAGGGAGG + Intergenic
1073730633 10:106283189-106283211 ATCTCAAGGGGGAAGATGGGAGG + Intergenic
1073928702 10:108547936-108547958 CTTCCAAGGGGGAACTTGAGAGG + Intergenic
1074711091 10:116178169-116178191 TTCCCAACTGGGAAACTGGGAGG + Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1077517567 11:3010961-3010983 CTCCCCAGGGGGCCTCTGTGTGG - Intronic
1078637654 11:13066649-13066671 CTCCCAAGGGGTAATAGGGGAGG + Intergenic
1079297726 11:19248596-19248618 CTCCCAAGGTTGAATCAGGAAGG + Intergenic
1080281989 11:30567905-30567927 CTCCCAAGGGAGACACAGGGAGG - Intronic
1080834509 11:35927889-35927911 CTCCCAAGGGAGGGGCTGGGAGG - Intergenic
1083246994 11:61436354-61436376 CTCCCTAGGGAGAAGCTGGGAGG + Intronic
1084445812 11:69202869-69202891 CTCCCAAGAGGGGCTCTGGTGGG + Intergenic
1084484574 11:69440289-69440311 CTCCCAAGGGCTTATCTGGATGG + Intergenic
1085777204 11:79377731-79377753 TTCCCAAGAGGGAAGCTGGATGG + Intronic
1087887048 11:103493622-103493644 ATCCCCAGGAGCAATCTGGGGGG - Intergenic
1088986621 11:114914761-114914783 TTCCCAAGGGAGGCTCTGGGGGG + Intergenic
1090511134 11:127376519-127376541 TCCCTAAAGGGGAATCTGGGTGG + Intergenic
1090997422 11:131879234-131879256 ATCCCAGGGGTGCATCTGGGTGG + Intronic
1091410300 12:234860-234882 CTCACAAGAAGGAATTTGGGGGG - Intronic
1092203957 12:6604472-6604494 TTCCCAAGGGGGAATGGGAGGGG - Intronic
1093596542 12:20969048-20969070 CTCCCAAAAAGGAGTCTGGGAGG + Intergenic
1098506019 12:71251484-71251506 CTCCCCAGAGGGAAGCTGAGAGG - Intronic
1102213451 12:111143858-111143880 CTCCCAAGAGGAATCCTGGGAGG - Intronic
1102990364 12:117311390-117311412 CTCCCAGGTGGGAAGCTGAGGGG - Intronic
1103008450 12:117439657-117439679 CTCCCCAGGGGCAGGCTGGGAGG + Intronic
1103680637 12:122690817-122690839 CTCTCAGGTGAGAATCTGGGAGG + Intergenic
1104131799 12:125901042-125901064 CTCCCAGAGGGGAATGTGGATGG - Intergenic
1105451143 13:20501516-20501538 CTCCCAAGGGGATTTCTGGCAGG + Intronic
1105769477 13:23594799-23594821 CTCCCAATCGGGAGGCTGGGGGG - Intronic
1109456851 13:62604063-62604085 CTCCCCAGGGAGAAACTGGGAGG + Intergenic
1109876061 13:68405732-68405754 GTCCCAAAGGGGACTCTGTGTGG + Intergenic
1111904502 13:94239833-94239855 CTTCCAAGAGGGAAGCTGAGTGG - Intronic
1117735029 14:58760260-58760282 TTCCCAAGGGGAGTTCTGGGAGG + Intergenic
1118475177 14:66109705-66109727 GTCCCAAGGGGGAACATGGTTGG + Intergenic
1118764967 14:68903696-68903718 CTCCCAAGGGGCAAGCGCGGAGG + Intronic
1122227909 14:100290490-100290512 CTGACAAGGGGGAGTCGGGGAGG - Intergenic
1122879070 14:104681954-104681976 CTCCCAAGGCGGGAAGTGGGAGG + Intergenic
1126205299 15:46038500-46038522 CTCCCTATGGGGAAAATGGGTGG - Intergenic
1126558431 15:50016814-50016836 GTCCTAAGGGGGGATGTGGGTGG + Intronic
1133020334 16:2964269-2964291 CTCTCCGGGGGGAATCTGGCCGG - Exonic
1133831301 16:9325919-9325941 ATCCCAAGAGAGAATCTTGGAGG - Intergenic
1134514213 16:14873779-14873801 ATCCCCAGGGGGAATCCGAGTGG - Intronic
1134755208 16:16660848-16660870 CTCTCAATGGGGCTTCTGGGTGG - Intergenic
1134990858 16:18698323-18698345 CTCTCAATGGGGCTTCTGGGTGG + Intergenic
1137063645 16:35814555-35814577 GTCCCAAGGGGCCATTTGGGTGG - Intergenic
1137320695 16:47378955-47378977 TTCCCAAAAGGGCATCTGGGTGG - Intronic
1137391537 16:48085368-48085390 CTCCCCAGGGGAAGCCTGGGAGG + Intronic
1137668103 16:50263408-50263430 CTTCCAAGGAGAAAGCTGGGCGG + Intronic
1137710731 16:50564898-50564920 CTCCAAAGGGGGAAGCTGGGAGG - Intronic
1137952565 16:52797612-52797634 GTACCAATGGGGAATCTGGTGGG - Intergenic
1139429608 16:66904118-66904140 CTCAGCAGGGGGAATCTGGAGGG + Intergenic
1139834056 16:69824150-69824172 CTCCCCTGGGAGAACCTGGGAGG - Intronic
1140454541 16:75097335-75097357 CAGCCCAGGGAGAATCTGGGGGG + Intronic
1141054468 16:80803590-80803612 CTGCGAAGGGGGAGGCTGGGTGG - Intronic
1141118223 16:81329982-81330004 CTCCCCAGGAGAAATCTAGGAGG + Intronic
1141381070 16:83577537-83577559 TTCCCATAGGGGCATCTGGGAGG - Intronic
1141426249 16:83946488-83946510 AACCCAAGGGAGAATCTCGGCGG - Intronic
1144739925 17:17576138-17576160 CTCCCAAGGCTGTCTCTGGGGGG - Intronic
1146719926 17:35117003-35117025 CACTCAAGTGGGAACCTGGGAGG - Exonic
1146919128 17:36698204-36698226 CTCCCGAGGGGAGAGCTGGGGGG + Intergenic
1148070723 17:44907092-44907114 CCCCCAAGGGGCAGTCTGGAGGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1152512852 17:80802101-80802123 CAGCCAAGGGGGAATGTGAGAGG + Intronic
1152785710 17:82246914-82246936 ATCCCAAGGGGGAATACAGGAGG - Intronic
1153774225 18:8438675-8438697 CTCACAAGGGGGAGGCTGGAAGG - Intergenic
1156755323 18:40516660-40516682 CTCCTCAGAGGGAATCTGTGAGG - Intergenic
1158861625 18:61598199-61598221 CTCCCCAGTGGGAAACTGAGGGG - Intergenic
1159000620 18:62971636-62971658 TTCCCCAGGAGGAAGCTGGGCGG + Intronic
1160298724 18:77659596-77659618 CTCCTAAGGGAGAATCTGAGTGG + Intergenic
1160550433 18:79691485-79691507 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550447 18:79691522-79691544 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550462 18:79691560-79691582 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550477 18:79691598-79691620 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550491 18:79691635-79691657 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550505 18:79691672-79691694 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550520 18:79691710-79691732 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550535 18:79691748-79691770 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550549 18:79691785-79691807 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550561 18:79691823-79691845 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550575 18:79691860-79691882 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550605 18:79691936-79691958 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550620 18:79691974-79691996 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550635 18:79692012-79692034 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550649 18:79692049-79692071 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550663 18:79692086-79692108 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550675 18:79692124-79692146 CTCCCAGGGTGGACTCGGGGTGG + Intronic
1160550688 18:79692161-79692183 CTCCCAGGGTGGACTCCGGGTGG + Intronic
1165104577 19:33461465-33461487 CTCCCAAGGTGGCTACTGGGAGG - Intronic
1165794165 19:38509052-38509074 CTCTCAAGGGGAATGCTGGGGGG - Intronic
925002626 2:418028-418050 CAGCCTAGGGAGAATCTGGGTGG - Intergenic
926174249 2:10574970-10574992 CTCCCAAGGCGGCATCTGGAAGG + Intronic
926216174 2:10906902-10906924 CCTCCAAGGGGACATCTGGGAGG - Intergenic
926303043 2:11617912-11617934 CTCCATCGGGGGCATCTGGGAGG - Intronic
926806465 2:16716241-16716263 GCCCCATGGGGGTATCTGGGTGG + Intergenic
927099864 2:19779854-19779876 CAACCAAGGGGGAAGCAGGGAGG + Intergenic
927942570 2:27114326-27114348 CTCCAAAGGATGACTCTGGGGGG + Intronic
929586054 2:43115140-43115162 CTACCAAGGAGGAAGCTGGTGGG - Intergenic
933775416 2:85768599-85768621 CTCCCAAGTGGGCATCTTGAAGG - Intronic
937276516 2:120687911-120687933 CTCCCAGGGTTGAATCAGGGAGG - Intergenic
939888064 2:147702904-147702926 TTCCCAAGTTGGAATCTGGATGG + Intergenic
940792378 2:158042746-158042768 CTCCCAAGGAGGACACTGGGTGG + Intronic
941430569 2:165409148-165409170 GCCCCAATGGGGAATCTGTGTGG - Intergenic
943491126 2:188557717-188557739 CCCCCAATGGGGAGTCTGTGTGG + Intronic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
1169830375 20:9818513-9818535 CTCGCAAGGATGAATCTTGGTGG + Intronic
1171388866 20:24788181-24788203 CTCAGAAGGGGGAGGCTGGGGGG - Intergenic
1172787396 20:37478264-37478286 ATCCCAAGGGGGAATATGATGGG + Intergenic
1173199519 20:40944283-40944305 CTCCCCAGGGAGACTCTGTGAGG - Intergenic
1180764178 22:18234098-18234120 CTGGGAAGGTGGAATCTGGGAGG + Intergenic
1180771464 22:18390443-18390465 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1180802846 22:18640058-18640080 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1180833090 22:18915963-18915985 CTGGGAAGGCGGAATCTGGGAGG + Intronic
1181066735 22:20310291-20310313 CTGGGAAGGCGGAATCTGGGAGG - Intergenic
1181218872 22:21355203-21355225 CTGGGAAGGTGGAATCTGGGAGG + Intergenic
1181343316 22:22199754-22199776 CTCCCAAAGAGGCATCTGAGTGG + Intergenic
1181402889 22:22662003-22662025 CTCATAAGAGGGGATCTGGGAGG - Intergenic
1181415562 22:22756279-22756301 CTCAGAAGAGGGAATATGGGTGG - Intronic
1182882719 22:33747376-33747398 ATGCCAAGGAGGAGTCTGGGTGG - Intronic
1183629328 22:39023809-39023831 TTGCCAAGGAGGAATCCGGGCGG - Intronic
1183981632 22:41544051-41544073 CTGCCAAGGGGGGATCCGGACGG + Exonic
1184223724 22:43116963-43116985 CTCTCACAGGGGAATCTTGGGGG + Intronic
1184510218 22:44928987-44929009 CTTCCATGGGGGCTTCTGGGAGG - Intronic
1185067410 22:48639164-48639186 CTCCCTACGGGAACTCTGGGCGG + Intronic
1185373568 22:50471746-50471768 CTCCCAGGGTGGAGGCTGGGAGG + Intronic
1203233303 22_KI270731v1_random:131434-131456 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1203283174 22_KI270734v1_random:141267-141289 CTGGGAAGGCGGAATCTGGGAGG + Intergenic
950169869 3:10830946-10830968 CTCCGGAGGTGGAAGCTGGGTGG + Intronic
952543341 3:34391730-34391752 CTCCAAATGGGGAATGTGGGAGG + Intergenic
952899308 3:38099120-38099142 CTAACAAGGGGGTCTCTGGGTGG - Intronic
952905757 3:38138309-38138331 CTTCCACGGAGGAATCTGAGGGG - Intergenic
957911379 3:86623627-86623649 CTTCTAATGGTGAATCTGGGAGG + Intergenic
958869211 3:99537521-99537543 CTCGCAAGTGGGGCTCTGGGAGG - Intergenic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
962825532 3:139096849-139096871 CTCCAAAGGAGGAGTGTGGGTGG - Intronic
963260797 3:143189084-143189106 CTCCCAAGGGAAAATGTGGGAGG - Intergenic
964030345 3:152131250-152131272 CTCAAAAGGGGGAAATTGGGAGG + Intergenic
964201123 3:154120842-154120864 CTCTGAAGAGGGAAACTGGGTGG - Intergenic
965188428 3:165497341-165497363 TTCCCCAAGTGGAATCTGGGAGG - Intergenic
966399616 3:179535011-179535033 CTGCCAAAGGGGAGTCTGTGTGG + Intergenic
968905588 4:3449229-3449251 CTGCCCAGGGGGACTCAGGGGGG + Exonic
974638240 4:64592961-64592983 CTTCCAAAGGGTAATCTGTGAGG - Intergenic
975115040 4:70670892-70670914 CTCCCAAGGGTGAAGCGAGGTGG - Intronic
978061028 4:104338713-104338735 CTCCCAAGAGTGAATCAGGAAGG - Intergenic
981210080 4:142092944-142092966 CTCCTCAGGTTGAATCTGGGTGG + Intronic
982582449 4:157196080-157196102 GTCCCAAGGTGGAAAATGGGAGG - Intergenic
983646180 4:169993682-169993704 CTGGCCAGGGGGAATCTGGCGGG + Intronic
984292595 4:177814107-177814129 CTCTGAAAGGGGAATCTGGCAGG - Intronic
985838205 5:2285978-2286000 CTACCATGGGGGAAGCTGGGTGG - Intergenic
988941510 5:36152186-36152208 CGCCAAAGCGGGAATCTGGGAGG + Exonic
989607266 5:43256570-43256592 GGCCCAAGGGGGAATGGGGGAGG - Intronic
993500384 5:88660403-88660425 CTCCCTGCGGGGAAGCTGGGTGG - Intergenic
994180958 5:96765527-96765549 CTCCCTGAGGGGATTCTGGGAGG + Intronic
998403176 5:141858639-141858661 GTCCCAAGTGGGTATTTGGGTGG - Intronic
999397564 5:151239766-151239788 CTCCCAAGGAGGGATCGGGTTGG - Intronic
1001790560 5:174454203-174454225 CTCCAAAGTGGGAAGCTGGAGGG + Intergenic
1001798803 5:174525868-174525890 TTCCCAAAGGGACATCTGGGTGG - Intergenic
1006725752 6:36197644-36197666 GTGCCGAGGGGAAATCTGGGGGG + Intronic
1006987856 6:38188677-38188699 CTTCCAAAGAGGAATTTGGGAGG - Intronic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1008370862 6:50728848-50728870 CTCCCAAGGTGGCACCTGTGTGG + Exonic
1008383789 6:50863603-50863625 CTCCAAAGGGGGAATGAGGAAGG + Intergenic
1011599735 6:89048807-89048829 CTCCCATGTGGTCATCTGGGTGG + Intergenic
1011634341 6:89356640-89356662 ATCCCAAGGGGAAATCCTGGGGG - Intergenic
1011993360 6:93552306-93552328 ATCCCAAGAGGGAAGCAGGGAGG - Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1017382737 6:153848826-153848848 CTCTGAAGGGAGAAACTGGGTGG + Intergenic
1017642749 6:156510184-156510206 CTCCAAAGGGGTAAGGTGGGTGG - Intergenic
1019337210 7:491140-491162 CTCCCTCAGGGGACTCTGGGAGG - Intergenic
1019343888 7:520459-520481 CTCCCAAGTGGAAATGTGGGTGG - Intergenic
1019523236 7:1469774-1469796 CTCCCAGGGGAGGGTCTGGGAGG - Intergenic
1020226567 7:6285075-6285097 CACCCAGCGGGGAAACTGGGTGG + Intergenic
1021124601 7:16836734-16836756 ATCCCGAGGAGAAATCTGGGAGG + Intergenic
1021985358 7:26093027-26093049 CTCCCCAGGTGTAATCTAGGTGG + Intergenic
1022452255 7:30525941-30525963 CTCCCCAGGGTGACTTTGGGTGG - Intronic
1022522589 7:31017646-31017668 TCTCCAAGGGGGAATCTGCGGGG + Intergenic
1023202328 7:37712168-37712190 GTCCCAAGGGGGAGAGTGGGTGG + Intronic
1024255459 7:47537167-47537189 CTCCCCAGCGGCTATCTGGGGGG + Intronic
1024443315 7:49446874-49446896 CTCCCCAGAGAGAAGCTGGGAGG - Intergenic
1024673913 7:51621185-51621207 CTTCCCAGGGGGAAGCCGGGAGG - Intergenic
1026283597 7:68943848-68943870 CTCATAAGGGGACATCTGGGTGG - Intergenic
1026916151 7:74121349-74121371 CTCCCGCGGAGGAATCTGGTGGG - Exonic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1029378829 7:100199405-100199427 CCCCCTAGGGTGAAACTGGGAGG + Intronic
1032078439 7:128846965-128846987 CCCACAAGGGGGAAACTGGAAGG + Intronic
1034697837 7:153069716-153069738 TTCCCAAAGAGGAATCTGGGTGG + Intergenic
1035228277 7:157445476-157445498 CTCCCGAGGGAGAAGCTGAGCGG + Intergenic
1038126173 8:24675254-24675276 CTCCCAAGGGGAAAGAGGGGAGG + Intergenic
1039109823 8:34029385-34029407 CTCAAAATGGGGAACCTGGGAGG - Intergenic
1039860473 8:41453050-41453072 TTCCCAAGAGGGAATGTGGTGGG + Intergenic
1040825210 8:51612669-51612691 CTCCCATGGTGGAATTGGGGAGG - Intronic
1040850221 8:51892899-51892921 ATCCCAGGGGGGAAAATGGGAGG + Intronic
1043370355 8:79583978-79584000 GCCCCAATGGGGAATCTGTGTGG - Intergenic
1044533701 8:93336856-93336878 CTCACAAGGGTGGATCTGGGTGG - Intergenic
1045421770 8:102023518-102023540 TTCCCAAGGGGGAATCTAGCAGG + Intronic
1045803950 8:106135016-106135038 CTCCCCAGTGGGGTTCTGGGTGG + Intergenic
1049081260 8:140445143-140445165 TTACCATGGGGGAAACTGGGAGG - Intronic
1049424006 8:142529411-142529433 CACCCAAGGGGGTATGGGGGCGG - Intronic
1049503757 8:142983580-142983602 CAAGCAAAGGGGAATCTGGGGGG - Intergenic
1049643027 8:143723847-143723869 GTCCACAGGGGAAATCTGGGAGG + Intergenic
1053478687 9:38400367-38400389 CTCCCAAGTGTGAGTCTGGTGGG - Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1056160780 9:83890316-83890338 CTCCCAATGGGGTATGAGGGAGG + Intronic
1056359357 9:85839006-85839028 CTCCCAATGGGGTATGAGGGAGG - Intergenic
1056500484 9:87203877-87203899 CTCCCAAGGTGGGGTCTGTGTGG - Intergenic
1057303219 9:93898365-93898387 GTACCATGGGAGAATCTGGGAGG + Intergenic
1057667858 9:97060821-97060843 CTCCAAATGGGGAATTTGGTGGG - Intergenic
1058205420 9:102100054-102100076 CTCCCAAGTGGGATTTGGGGTGG + Intergenic
1060106911 9:120878349-120878371 CCCCCAAGAGTGAGTCTGGGTGG - Intronic
1060686000 9:125613270-125613292 CTGAAAAGAGGGAATCTGGGTGG - Intronic
1060736846 9:126071460-126071482 TTACCAAGCTGGAATCTGGGAGG + Intergenic
1061162304 9:128902395-128902417 CTCAGAAGGAGGAGTCTGGGTGG + Intronic
1061520124 9:131112850-131112872 CTCCCAGGGGTGGCTCTGGGAGG + Intronic
1187247060 X:17562282-17562304 ATCCCAAGGGAGACTCTGGGAGG + Intronic
1188802514 X:34549522-34549544 CCCCAAAGGGGGAAACTTGGGGG + Intergenic
1190737744 X:53266870-53266892 GTCCCATGGGGGAATCTGCGGGG + Intronic
1196372906 X:114998821-114998843 GTCCCAAGGGGGACTTTGGTGGG - Intergenic
1196937987 X:120748685-120748707 CTCTGAAGGGGGAGGCTGGGAGG + Intergenic
1199465981 X:148137704-148137726 CTTCCAATGTGGAATATGGGAGG - Intergenic