ID: 915213823

View in Genome Browser
Species Human (GRCh38)
Location 1:154327589-154327611
Sequence ATGGAAGCCCTAGTAATGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915213816_915213823 -5 Left 915213816 1:154327571-154327593 CCCCTGGAGGAGGTGATAATGGA 0: 1
1: 0
2: 0
3: 22
4: 206
Right 915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG 0: 1
1: 1
2: 1
3: 3
4: 84
915213812_915213823 10 Left 915213812 1:154327556-154327578 CCTCTAATGTGAGCTCCCCTGGA 0: 1
1: 0
2: 1
3: 10
4: 151
Right 915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG 0: 1
1: 1
2: 1
3: 3
4: 84
915213810_915213823 15 Left 915213810 1:154327551-154327573 CCATGCCTCTAATGTGAGCTCCC 0: 1
1: 0
2: 2
3: 8
4: 166
Right 915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG 0: 1
1: 1
2: 1
3: 3
4: 84
915213817_915213823 -6 Left 915213817 1:154327572-154327594 CCCTGGAGGAGGTGATAATGGAA 0: 1
1: 0
2: 2
3: 30
4: 333
Right 915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG 0: 1
1: 1
2: 1
3: 3
4: 84
915213818_915213823 -7 Left 915213818 1:154327573-154327595 CCTGGAGGAGGTGATAATGGAAG 0: 1
1: 0
2: 4
3: 44
4: 364
Right 915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG 0: 1
1: 1
2: 1
3: 3
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915213823 Original CRISPR ATGGAAGCCCTAGTAATGGG GGG Intronic
907758804 1:57337749-57337771 AGGGAAGCCCCAGCAGTGGGAGG - Intronic
910587328 1:88893800-88893822 ATTGAAACCCTAGAAAAGGGAGG + Intergenic
913284844 1:117216905-117216927 ATGGAGGCCCTAGTAACTAGTGG - Intergenic
913533882 1:119753192-119753214 ATGGCAGCCTCAGTAATGGTGGG + Intronic
914965547 1:152254242-152254264 ATGGAAACTCTAGAAATGGCTGG - Intergenic
915213823 1:154327589-154327611 ATGGAAGCCCTAGTAATGGGGGG + Intronic
915859665 1:159430705-159430727 ATGGAACCCAGAGTTATGGGGGG + Intergenic
921208880 1:212875361-212875383 AGGGAAGCCCTAGGGATGGCCGG + Intronic
922639439 1:227212903-227212925 ATGGAAACCCTTGTAATGGGGGG - Intronic
923356067 1:233156998-233157020 ATGGCATCCTTAGTAAAGGGAGG + Intronic
924686916 1:246302267-246302289 AAGGAAAGCCTAGCAATGGGGGG + Intronic
924709873 1:246523056-246523078 ATGGTAGCCCAAGTGATGAGTGG - Intergenic
1069543515 10:69313156-69313178 ATCCCAGCCCTAATAATGGGAGG + Intronic
1073242870 10:102069521-102069543 CTGGAGGCCCTACTAGTGGGTGG - Intergenic
1077612921 11:3655542-3655564 ATGTGAGCCCTAGAAGTGGGAGG + Intronic
1079081604 11:17417068-17417090 TTGGAAACCCTGGGAATGGGTGG - Intronic
1079807527 11:24952915-24952937 ATTGAAACCCTAGAAATGTGAGG - Intronic
1083159236 11:60844410-60844432 GTGGAAGCTCTAGTGATGGAGGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083837255 11:65279057-65279079 ATGGAAGCCCTAGTAATGGAGGG + Intronic
1087439471 11:98164234-98164256 ATGTAAGCCCTCGCAATAGGTGG + Intergenic
1092443760 12:8534001-8534023 AAGGAAGCCCCAGGGATGGGTGG + Exonic
1102907343 12:116687173-116687195 GTGGAAACCCTTGAAATGGGAGG + Intergenic
1107446561 13:40474680-40474702 ATGGTAGCACTAGTAAAGGCTGG - Intergenic
1108524071 13:51270915-51270937 ATGTAAGCCATAGAAATGGGTGG + Intronic
1114632078 14:24165499-24165521 ATGGGTGCCCTAGCACTGGGAGG + Intronic
1122672607 14:103384217-103384239 AGGTAAGCCCTTGTAGTGGGGGG - Intergenic
1125071295 15:35557015-35557037 ATAGGAGCTCTAGTAATAGGGGG + Intergenic
1126309398 15:47298714-47298736 AAGGAAGCCCTTGCAATAGGAGG - Intronic
1129060097 15:72853882-72853904 ATGGAAGCCAAGGAAATGGGTGG - Intergenic
1133681634 16:8125449-8125471 ATGTTAGTCCTAGGAATGGGTGG + Intergenic
1137546851 16:49410754-49410776 AAGAACACCCTAGTAATGGGGGG + Intergenic
1138558695 16:57787520-57787542 ATGGAGGCCCCAGAAAGGGGAGG + Intronic
1140200241 16:72889038-72889060 ATGGAAGGCGGAGTCATGGGTGG + Intronic
1143203830 17:5129873-5129895 ATGGTAGCCCAAGTGATGAGCGG + Intronic
1144875010 17:18392985-18393007 ATGGTAGCCCAAGTGATGAGCGG + Intergenic
1145157214 17:20551436-20551458 ATGGTAGCCCAAGTGATGAGCGG - Intergenic
1147503657 17:40991636-40991658 ATGGCAGCCATCCTAATGGGTGG + Intergenic
1154095841 18:11414207-11414229 ACGGCAGGCCTAGAAATGGGTGG - Intergenic
1155169231 18:23254931-23254953 ATGGAAGCCCTGGAATTGGTCGG + Intronic
1157074329 18:44448603-44448625 TTGGAAGCCCTGGAAATGGATGG - Intergenic
1160646279 19:195021-195043 AGGAAAGCCTTAGTATTGGGAGG - Intergenic
1162911682 19:13851180-13851202 CTGGAACCCCTAGAAGTGGGTGG + Intergenic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1166046355 19:40233106-40233128 AAGGAAGCCCTAGTAAGGCACGG + Exonic
1168493634 19:56832522-56832544 ATGGAAGCTTTAGTAATGAGGGG - Intronic
925932198 2:8717450-8717472 ATGGAATCCATCGCAATGGGAGG - Intergenic
927039034 2:19209670-19209692 ATGAGTGCCCTATTAATGGGGGG - Intergenic
928178364 2:29050405-29050427 ATGGAATCCCTAGAAATTTGGGG + Intronic
928380531 2:30814047-30814069 GTGGAAACCTTAGCAATGGGCGG + Intronic
931509231 2:62971818-62971840 ATAGAAGCCGTAGTTTTGGGAGG - Intronic
943710989 2:191094584-191094606 AAGGAAGCACTAAAAATGGGAGG + Intronic
946823956 2:223657298-223657320 ATCCAAGCCCTAGAAAGGGGAGG - Intergenic
1179591282 21:42410372-42410394 ATGGAATTCCTTGAAATGGGTGG - Intronic
1184043689 22:41958873-41958895 ATGGAAGCCCCAGCGAAGGGGGG - Intergenic
952829356 3:37551609-37551631 ATGGATGCCGTGGGAATGGGTGG - Intronic
968371402 3:198224505-198224527 AGGAAAGCCTTAGTATTGGGAGG + Intergenic
968880591 4:3296841-3296863 ATGCAAGCCCCAGTCATGAGAGG + Intronic
969198645 4:5584048-5584070 ATTGAAACCCTAGTATGGGGAGG - Intronic
972355990 4:38279897-38279919 ATGGAAGCCTTAATAGAGGGTGG - Intergenic
976753232 4:88471665-88471687 ATGGAAGACCTTCTAATGGAAGG - Intronic
982419745 4:155181287-155181309 TTGGAAGCCACAGTGATGGGTGG - Intergenic
996995447 5:129691004-129691026 ATGCAAGTTCTAGTAATGTGAGG + Intronic
1005882548 6:30072133-30072155 CTGGAACCTCAAGTAATGGGAGG + Intronic
1006193664 6:32224095-32224117 CTGGACACCCTAGTAATGGGGGG + Intergenic
1010769507 6:79812329-79812351 ATGGAAGCTTTTGAAATGGGAGG - Intergenic
1012018785 6:93889279-93889301 ATAGAAGCCATAGGAAAGGGAGG + Intergenic
1019880680 7:3858069-3858091 ATGGAAGCCTTAATAATGAATGG + Intronic
1020087899 7:5321282-5321304 ATGGAGGCCCTGGTACCGGGTGG + Intronic
1021097633 7:16551506-16551528 CTGGAAGCCCTACTTCTGGGAGG + Intronic
1023675507 7:42625308-42625330 ATGGAAGCCCAAGTGATGTCAGG - Intergenic
1024110862 7:46145195-46145217 AGAGAAGCCCTAGAAATGTGGGG + Intergenic
1025206411 7:56995840-56995862 ATGGAGGCCCTGGTGCTGGGTGG - Intergenic
1025665528 7:63581087-63581109 ATGGAGGCCCTGGTGCTGGGTGG + Intergenic
1028596960 7:92555825-92555847 ATGGAAGCCCGAGAAAAGAGAGG + Intergenic
1030946880 7:115734589-115734611 AAGGAAACCCTTGTAATGGATGG - Intergenic
1037605698 8:20435533-20435555 ACGGAAGGCCTGGTGATGGGGGG + Intergenic
1040545537 8:48395939-48395961 GAGGAAGCCCCAGTAATGGCAGG - Intergenic
1045078705 8:98600569-98600591 ATGGAAGCAGTGGTAATGTGAGG - Intronic
1046194338 8:110839146-110839168 ATGGAAGCCCCAGGAAATGGAGG + Intergenic
1046610851 8:116423888-116423910 ATGGAGGCCCAAGTTAAGGGAGG + Intergenic
1046731466 8:117730757-117730779 ATGAAAGTCCTAGTGATGGTGGG + Intergenic
1049862587 8:144910151-144910173 ATGGAAGCCATACCACTGGGTGG + Intergenic
1056480100 9:86994431-86994453 TTTGAAACCCTAGTAATGGCAGG - Intergenic
1061630548 9:131869616-131869638 ATGCAAGCCCAAGGAAAGGGAGG + Intronic
1062755049 9:138282561-138282583 AGGAAAGCCTTAGTATTGGGAGG + Intergenic
1190274902 X:48893356-48893378 TTGGAAGCCCTAGGACTTGGAGG - Intergenic
1190497419 X:51040118-51040140 AAGGAAGCCCTAGGATTGTGGGG - Intergenic
1190508564 X:51154190-51154212 AAGGAAGCCCTAGGATTGTGGGG + Intergenic
1193393375 X:80955987-80956009 ATGGTAGCCCTTATAATCGGAGG - Intergenic