ID: 915214139

View in Genome Browser
Species Human (GRCh38)
Location 1:154328894-154328916
Sequence GCGGCTCCTGCACCTCCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915214134_915214139 -8 Left 915214134 1:154328879-154328901 CCCCTCTGAGCGGCTGCGGCTCC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG 0: 1
1: 0
2: 3
3: 24
4: 248
915214130_915214139 8 Left 915214130 1:154328863-154328885 CCCGACGGCTGGGGCTCCCCTCT 0: 1
1: 0
2: 0
3: 16
4: 169
Right 915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG 0: 1
1: 0
2: 3
3: 24
4: 248
915214135_915214139 -9 Left 915214135 1:154328880-154328902 CCCTCTGAGCGGCTGCGGCTCCT 0: 1
1: 0
2: 3
3: 16
4: 176
Right 915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG 0: 1
1: 0
2: 3
3: 24
4: 248
915214136_915214139 -10 Left 915214136 1:154328881-154328903 CCTCTGAGCGGCTGCGGCTCCTG 0: 1
1: 0
2: 0
3: 20
4: 225
Right 915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG 0: 1
1: 0
2: 3
3: 24
4: 248
915214131_915214139 7 Left 915214131 1:154328864-154328886 CCGACGGCTGGGGCTCCCCTCTG 0: 1
1: 0
2: 0
3: 29
4: 243
Right 915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG 0: 1
1: 0
2: 3
3: 24
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915214139 Original CRISPR GCGGCTCCTGCACCTCCCCG GGG Intronic
900369920 1:2327701-2327723 GCCGCGCCTGCCCCTCCTCGTGG - Intronic
900490509 1:2946506-2946528 CCGGCTGCTGCACCTCCACGCGG + Intergenic
901004645 1:6165905-6165927 GCGGCTCTTGCATCTTCCCCGGG - Intronic
902337022 1:15759467-15759489 GCGGCCCCAGCCTCTCCCCGGGG - Intronic
902744129 1:18461842-18461864 CCGGCTTCAGCACCTCCACGAGG - Intergenic
903460345 1:23516449-23516471 CCGGCTCCTGCACCTCCTCTGGG + Exonic
904043947 1:27599390-27599412 GCGGCGCCTCCCCCTCCCCTGGG + Intronic
904477212 1:30773058-30773080 GCAGCTCCTGCACTTCTCCATGG - Intergenic
904494626 1:30879653-30879675 CCGGCTCCTGCCCCTGCCCAGGG + Intronic
905168452 1:36097135-36097157 GGGGCTCCTCCAGCTCCCCCTGG - Exonic
905442764 1:38005521-38005543 GCGGCCCCAACCCCTCCCCGAGG + Intronic
905990626 1:42334774-42334796 GCGTCTCCCGCCCCTCCCCCAGG - Intronic
906035678 1:42748975-42748997 CCACCTCCTGCACCTTCCCGGGG + Intronic
911188615 1:94927006-94927028 CCGTCTCCTGCGCCTCCCAGAGG - Exonic
912455136 1:109792103-109792125 TCGCCTCCTGTACCTCCCTGGGG + Intergenic
914050224 1:144125189-144125211 GCAACCCCTGGACCTCCCCGTGG - Intergenic
914128958 1:144840256-144840278 GCAACCCCTGGACCTCCCCGTGG + Intergenic
914345378 1:146794426-146794448 GCGGCCCCTGCGCCCACCCGAGG - Intergenic
915121893 1:153634464-153634486 GGGGCTCCGCCTCCTCCCCGGGG - Intronic
915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG + Intronic
915472669 1:156135240-156135262 GCGACTGCTGCAGCTCCTCGTGG - Exonic
916663827 1:166947729-166947751 GCTGCTCCGGCTCCTGCCCGGGG + Intronic
916785745 1:168085866-168085888 GCTGCTGCTCCACCACCCCGGGG + Intronic
918275779 1:182952908-182952930 GCGGCTCCAGCGCCTGCCCGCGG - Exonic
919767369 1:201136044-201136066 GGGGCCCCTGCCCCTCCCTGGGG + Intronic
919979151 1:202631604-202631626 GCGGCTCCTTCACAGCACCGAGG + Intronic
921949574 1:220915431-220915453 GCCTCTCCTGCACCTCTCAGAGG - Intergenic
922178157 1:223213262-223213284 GCTGTCCCTGCCCCTCCCCGAGG + Intergenic
924527161 1:244863337-244863359 GCGGCAGCTGCAGCTCCCCCCGG + Intronic
1073110994 10:101062943-101062965 GAGGTTCCGGCACCTCTCCGCGG - Exonic
1073578155 10:104641819-104641841 GCGGCGCCTTCACCTCCTCCCGG - Exonic
1076615381 10:131751201-131751223 CCGGCTGCAGCCCCTCCCCGAGG + Intergenic
1076724877 10:132408603-132408625 GCCGCTCCTGCAGCTGCCCGAGG + Intronic
1077182285 11:1222216-1222238 GGGGGTCCTGGACCTGCCCGGGG - Intergenic
1077273475 11:1692626-1692648 CCAGCCCCTGCCCCTCCCCGGGG - Intergenic
1077297426 11:1832640-1832662 GCTGCACCTGCACCTCCCTGGGG + Intronic
1077488530 11:2850056-2850078 GCTGCTCCCGCTCCTCCCGGAGG - Intergenic
1077495578 11:2885084-2885106 GCTGCTCCGGCGCCTCCTCGAGG + Exonic
1078076714 11:8168881-8168903 GCGGCTCCTGCCGCTTCCCGCGG + Exonic
1078190396 11:9089344-9089366 GCTGATCCTGCACCTCCCTGGGG - Intronic
1078840520 11:15072934-15072956 TCGGCTCCTGCCCGTCCCAGAGG + Intronic
1079128431 11:17734587-17734609 GCGGCTCCTGCTGCTCCCGGGGG - Intergenic
1081967684 11:47179347-47179369 GGGTCTCCTCCATCTCCCCGAGG - Intronic
1082009663 11:47441655-47441677 GCAGCGCCTGCACCTGCCCCAGG + Exonic
1083254892 11:61489920-61489942 GCGGCACCTGCATCCCCACGTGG + Exonic
1083367190 11:62148470-62148492 CCCGCTCCTGCAGCTCCCTGAGG - Exonic
1084509284 11:69593204-69593226 GCGGCTCTGGCAGCTCCCCGGGG + Intergenic
1084802201 11:71552355-71552377 GCGGCCCCTGCTTCTCCCCCAGG + Intronic
1085037100 11:73307440-73307462 GCGGCTCTTGCGCCCCCTCGCGG - Intergenic
1085524795 11:77157937-77157959 TAGGCTCCTGCAGCCCCCCGGGG - Intronic
1085666139 11:78417413-78417435 GCGGCTCCTGCTCCGCCAGGCGG - Intronic
1087713715 11:101583439-101583461 GCGGCTCCGGCAGCGCCCCGGGG + Exonic
1088939508 11:114439428-114439450 TCAGCTCGTGCGCCTCCCCGTGG + Exonic
1090943480 11:131409409-131409431 GGGACTCCTGCACCTCTCTGTGG - Intronic
1091994053 12:4978922-4978944 GGGCCTCCTGCCCCTCCCCTCGG - Intergenic
1092451333 12:8605242-8605264 GCGGCGGCTGCACCGCGCCGGGG - Exonic
1092843319 12:12562883-12562905 GCAGCTCCGGCTCCTCCCAGCGG - Intergenic
1096417188 12:51424716-51424738 CCGGCTCCTCCCCCTCCCCGCGG + Intronic
1096417279 12:51425053-51425075 GCGCCTCCCGCTCCTCCCCGGGG + Intronic
1096716158 12:53492884-53492906 ACGGCCCCGGCTCCTCCCCGAGG - Intronic
1097187294 12:57202638-57202660 GCGGCTCCTGCCCCCACCCTGGG - Intronic
1101372036 12:104138558-104138580 GCGGCTGAGGCACCTCCACGTGG - Intergenic
1101675557 12:106913624-106913646 GCAGCTCCTCCACCTCCACCAGG - Intergenic
1102346833 12:112166156-112166178 GCGTCTCCTGCACTCCTCCGAGG - Intronic
1103960954 12:124609163-124609185 GCGGCCTCTGCCCCTCCCCTCGG + Intergenic
1104107770 12:125680316-125680338 GCTCCTCCTTCACCTCCCAGAGG + Intergenic
1106956267 13:34942453-34942475 GCGGCTGCAGCATCTCCGCGGGG + Exonic
1108313954 13:49220367-49220389 GCGGCTCCCGCGCCCCCTCGGGG - Exonic
1118737045 14:68708585-68708607 GCGGCTCCTGAACCTCAGCATGG + Intronic
1119211577 14:72836033-72836055 GTGTCTCCAGCATCTCCCCGAGG - Intronic
1119467854 14:74873468-74873490 GGGGCTCCTGAACCCCCCCTAGG - Intergenic
1121281719 14:92703757-92703779 GATGCTCCTGCACCTCCTAGCGG - Intergenic
1121439431 14:93939563-93939585 GCGCCTCCAGCACCTCGTCGTGG + Exonic
1122813012 14:104298221-104298243 GCAGCCCCTGCAGCCCCCCGTGG - Intergenic
1124429666 15:29595540-29595562 GCGTCTCCTACAGCTCCTCGTGG + Intergenic
1126915101 15:53457629-53457651 CCTGCTCCTGCACATCCCCAGGG - Intergenic
1128143477 15:65318464-65318486 GGGGCTCCTTCCCTTCCCCGAGG + Intergenic
1128390544 15:67179828-67179850 GCGTCTCCTGTTCCTCCCTGAGG + Intronic
1128742923 15:70096085-70096107 GCGGCTCCTGCCATCCCCCGCGG - Intronic
1129704805 15:77788054-77788076 AAGGCTCCTGCCTCTCCCCGTGG + Intronic
1129908845 15:79209397-79209419 GCAGGTCCTGCTCCTCCCCAGGG - Intergenic
1130303856 15:82699848-82699870 GCGATTCCTGCAGCTCCCGGGGG - Intronic
1131098972 15:89673372-89673394 GCGGGTCCTGCAGCTGCCGGTGG - Exonic
1131113239 15:89778153-89778175 GTGGCTCCAGCACCTCCCGGGGG - Exonic
1131257952 15:90873778-90873800 ACAGCTCCTGCACATCCCTGCGG - Intronic
1132381688 15:101370641-101370663 GAGGCTGCTGCGGCTCCCCGGGG - Intronic
1132869779 16:2110771-2110793 CGGGCTCCTGCACCTCCACCAGG + Exonic
1132913005 16:2325352-2325374 GCTGCACCTGCTGCTCCCCGGGG + Intronic
1133066193 16:3209042-3209064 GGGGGTCCAGCACCTCCCTGTGG + Intergenic
1133303323 16:4795987-4796009 GCTGCTGCTGCAGCTCCCCCGGG + Exonic
1134717642 16:16364830-16364852 CGGGCTCCTGCACCTCCACCAGG - Intergenic
1134957110 16:18387329-18387351 CGGGCTCCTGCACCTCCACCAGG + Intergenic
1135712511 16:24729751-24729773 GCGGCTCGGGCCTCTCCCCGCGG + Exonic
1136450450 16:30351725-30351747 GTGGCTCCTGGACCCCACCGTGG - Exonic
1136666829 16:31819655-31819677 GCGTCCCCTGCGCGTCCCCGCGG - Intergenic
1137300287 16:47143083-47143105 GCGGCGCCTGCACCTCGCGGCGG - Intronic
1137463977 16:48691367-48691389 GTGGCCCCAGCACCTCCCCCGGG - Intergenic
1138431154 16:56969972-56969994 GCTGCTCCTGCATCTCCAAGGGG + Exonic
1138651538 16:58463975-58463997 GCGGCGCCCCCTCCTCCCCGCGG + Intronic
1139488201 16:67271218-67271240 CCACCTCCTGCTCCTCCCCGAGG - Exonic
1139839720 16:69868500-69868522 GCAGGTCCTGCAGCTCCCTGAGG + Intronic
1139908468 16:70381958-70381980 GGGGCTCCTGCATCTCCCCGGGG - Intronic
1140205183 16:72927686-72927708 GAGGCTGCTGCAGCTCCCCCGGG - Intronic
1141733039 16:85834976-85834998 CTGGCTCCTGCACCTGCCCTGGG - Intergenic
1141831082 16:86510331-86510353 GCGGATCCAGCAGCTCCTCGGGG + Intergenic
1142217481 16:88836990-88837012 GCGACTCCCACACCTCCACGGGG + Intronic
1142381335 16:89733938-89733960 GCCGCTCCCGGACCTCCTCGTGG - Exonic
1146469806 17:33115121-33115143 GCAGCTCCTGCAGCTGCCCTTGG + Intronic
1146884460 17:36461910-36461932 CAGGCTCCTGCCCCTCCCCACGG + Intergenic
1147704998 17:42420337-42420359 GCTGCTCCTGCTCCTCCCAGAGG - Intronic
1148760061 17:49995003-49995025 GCGGGCGCTGCACCTCCCCAGGG + Exonic
1148930134 17:51120901-51120923 GCGGCGCCGGCCCCGCCCCGCGG - Intergenic
1150216935 17:63476486-63476508 GCCCCTCCAGCACCTCCCGGAGG + Intergenic
1152923922 17:83079231-83079253 GCGGCCCCGGCACCGCCTCGCGG + Intergenic
1153382639 18:4455495-4455517 GAGGCGCCGGCGCCTCCCCGCGG - Intergenic
1157444630 18:47735332-47735354 GCCCCTCCTGCCCCTCCCTGTGG - Intergenic
1158326933 18:56322609-56322631 GAGGCCCCTGCCCCTCCCCTGGG - Intergenic
1158589636 18:58768640-58768662 GCGCCGTCTGCACCTGCCCGGGG + Intergenic
1160703587 19:519018-519040 GCGGCGCCACCACCTCCTCGGGG - Exonic
1161338237 19:3726131-3726153 GTGACTCCTCCTCCTCCCCGGGG - Intronic
1161426648 19:4207437-4207459 TAGGCTTCTGCACCTCCCGGGGG + Intronic
1161469440 19:4448976-4448998 CCAGCCCCTGCCCCTCCCCGAGG + Intronic
1161977018 19:7612668-7612690 GCGGCTCCTGGCCCCGCCCGAGG + Exonic
1162130846 19:8525478-8525500 GCGGCCCCTGCGCCCCCCAGAGG - Exonic
1164061328 19:21678018-21678040 GCGGCTCCTGCACCTCTGGCGGG + Intergenic
1164840681 19:31390167-31390189 GGGGCTCCTCCAGCTCCCTGAGG + Intergenic
1165010244 19:32840757-32840779 CCTGCTCCTCCACCTCCCCTGGG + Intronic
1165068456 19:33241869-33241891 GGGGCTCCGACCCCTCCCCGGGG - Intergenic
1165070938 19:33254489-33254511 ACGGCTCCTGCTGCTCCCCACGG - Intergenic
1165149505 19:33752573-33752595 GCGACTTCTGCGACTCCCCGGGG - Intronic
1165183786 19:33998497-33998519 CCTGCTCCCGGACCTCCCCGTGG - Intergenic
1165487350 19:36103746-36103768 TGGGCTCCTGCAGCCCCCCGTGG + Exonic
1165941444 19:39416593-39416615 GGGGCTCCTGCCCCTCACCTCGG - Exonic
1166944451 19:46388360-46388382 GGGACTCGTCCACCTCCCCGGGG - Intronic
1167109060 19:47448110-47448132 GCGGCTGCTGAACCTGCGCGTGG - Exonic
1167272157 19:48511685-48511707 GCGTCTCCTGCCCCTCTCCTGGG - Intronic
1168146480 19:54422243-54422265 GCGGCTCGAGCACCTCCTCCAGG - Exonic
1168468296 19:56621429-56621451 TCTGCACCTGCATCTCCCCGCGG - Exonic
1202689631 1_KI270712v1_random:77827-77849 GCAACCCCTGGACCTCCCCGTGG - Intergenic
927257523 2:21053171-21053193 GAGGCACCTGAACCTCCCTGGGG + Intergenic
928176139 2:29035515-29035537 GCTGCTCCACCATCTCCCCGCGG - Exonic
928729143 2:34210539-34210561 TGGTCTCCTGCAGCTCCCCGAGG - Intergenic
933956788 2:87378195-87378217 GCAACCCCTGGACCTCCCCGTGG + Intergenic
934272262 2:91546537-91546559 GCAACCCCTGGACCTCCCCGTGG - Intergenic
934843482 2:97646263-97646285 GCGGCTCGTGCAGCTTCTCGAGG + Intronic
943751692 2:191515853-191515875 GAGGCTCCTGCAGCTTCCCCAGG - Intergenic
946195716 2:218032242-218032264 TTGGCTCCTGCTCCTCCCCTTGG - Intergenic
946622467 2:221573633-221573655 GAGGCTCCTCCACCTCCCAGCGG - Intronic
948605063 2:239129664-239129686 CCGGCTCCTGCTCCTCCTGGAGG + Intronic
948646255 2:239406940-239406962 GCGGCTCCTCCACTTCCCGCAGG + Intergenic
949019968 2:241735325-241735347 GAGGCTGCTGCTCCGCCCCGGGG + Exonic
1170601698 20:17846310-17846332 GCGGCTCCAGCTCCTGCCAGAGG - Intergenic
1170629655 20:18056506-18056528 GCCGCTCCTGCACCTGCCCCTGG - Intronic
1172972432 20:38883244-38883266 GTGGCTCCTGCTCCTCCTCTGGG - Intronic
1173800447 20:45891489-45891511 GCGCCGCCAGCAACTCCCCGGGG + Intronic
1173810771 20:45953818-45953840 TCGGCTGCTGCACCGCCCCCTGG + Exonic
1174094557 20:48077975-48077997 GCGGCTCCTGCTCTTTCCCTGGG - Intergenic
1174100185 20:48121365-48121387 GCAGCACCGGCACCTCCCCAAGG + Intergenic
1175056586 20:56204383-56204405 GCAGCACCTGGACCTCCCCCTGG + Intergenic
1175961082 20:62636655-62636677 GCGCGTGCTGCACCTCCCTGGGG - Intergenic
1175961294 20:62637877-62637899 CTGGCTCCTGAGCCTCCCCGCGG - Intergenic
1178534178 21:33398949-33398971 CAGGCTCCTCCAGCTCCCCGTGG - Intergenic
1180037366 21:45256722-45256744 GTGGCTCCTGCATCACCCAGCGG - Intergenic
1180116006 21:45705455-45705477 AGGGCTCCTGCAGCTCCCTGGGG + Intronic
1180870553 22:19144389-19144411 CCGGCTCCTCCACTTCCACGAGG + Intronic
1182439873 22:30356964-30356986 GCGCTTCCCGCCCCTCCCCGCGG + Exonic
1182664213 22:31945129-31945151 GCGGCTCCTTCGCGTCCCCTAGG - Intronic
1183481281 22:38066936-38066958 GCTGCCCCTGCCCCTCCCCTTGG + Intronic
1183581771 22:38730694-38730716 GCGGCTGCTGAACCTTCCCCTGG + Exonic
1184089238 22:42283698-42283720 GCGGCCCCTGCCCGCCCCCGGGG + Intronic
1184229527 22:43151334-43151356 TCGGCTCCTCCTCCTCCCCATGG - Intergenic
1184404701 22:44293222-44293244 GCAGCTCCTTCTCCTCCCCCAGG - Intronic
1184426753 22:44413379-44413401 TCTGCTGCTGCACCTGCCCGTGG + Intergenic
1185070072 22:48651338-48651360 GCCTGTCCTGCACCTCCCAGTGG - Intronic
1185218995 22:49619527-49619549 GCGGCCCCTGGACCTGCCCTGGG - Intronic
1185336205 22:50271869-50271891 CCCGCCCCTGCGCCTCCCCGTGG + Intergenic
1185404748 22:50641460-50641482 CCAGGTCCTGCTCCTCCCCGAGG - Intergenic
950504936 3:13388840-13388862 GCAGCACCCTCACCTCCCCGAGG + Intronic
953350261 3:42210053-42210075 GCGGCTCCTGCATCTCCTCTGGG - Intronic
956659221 3:71582682-71582704 CCGGCTCCCGCACCCACCCGTGG + Intronic
960281311 3:115784249-115784271 GCGGCGCCTGCAGCTGCCTGGGG + Intergenic
961361839 3:126373061-126373083 GCGGCACCTGCGCCCTCCCGTGG - Intergenic
962201263 3:133403066-133403088 GGGCCTCCTGCAGCTCCACGAGG - Intronic
968049441 3:195644092-195644114 GCAGCACCTGCTCCTCCCCAAGG - Intergenic
968097962 3:195945534-195945556 GCAGCACCTGCTCCTCCCCAAGG + Intergenic
968106427 3:196004917-196004939 GCAGCACCTGCTCCTCCCCAAGG + Intergenic
968305177 3:197645840-197645862 GCAGCACCTGCTCCTCCCCAAGG + Intergenic
968471736 4:785758-785780 GCGGCTGCTGCTTCTCCCTGGGG - Exonic
968905319 4:3448134-3448156 GCGGCTACTCCAGCTCCCTGCGG + Exonic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969256843 4:6008124-6008146 GCAGCTCCTCCAGCTGCCCGCGG + Intergenic
972245772 4:37244518-37244540 GAGGCTCCTGCGCACCCCCGAGG + Exonic
978327875 4:107579468-107579490 ATGGCTGCTGCACCTCCCCCAGG - Intergenic
978886563 4:113772538-113772560 GGGCCTCGGGCACCTCCCCGCGG + Intergenic
984638603 4:182140873-182140895 GCTGCTCCACCGCCTCCCCGCGG - Intergenic
985130931 4:186737930-186737952 GCAGCTCCTCCAGCTCCCCAGGG + Intergenic
986641995 5:9880985-9881007 GTGGCTCCTCCTCCTCCCCAGGG - Intergenic
986735351 5:10663731-10663753 GCAGCTCCTGCTCATCCCCCAGG - Intergenic
987088172 5:14488118-14488140 CCGGCTCCTTCACCTTCCCGGGG + Exonic
989276829 5:39599080-39599102 GTGGCACCCGCCCCTCCCCGCGG + Intergenic
991657836 5:68921167-68921189 GCGCGGCCTGAACCTCCCCGAGG + Intergenic
993427891 5:87792628-87792650 CAGGCTCTTGCACCTCTCCGTGG + Intergenic
995224658 5:109689644-109689666 CCGCCCCCTGCGCCTCCCCGCGG + Exonic
998130356 5:139648620-139648642 GCCCCTCCTCCCCCTCCCCGCGG - Exonic
999133826 5:149304478-149304500 GGGGTTCCTTCACCTCCCCAGGG + Intronic
999194570 5:149773433-149773455 GCGGCTCCTGCTCTGCCCCGTGG + Intronic
1000052556 5:157575489-157575511 GCGCCTCCCGCAACTCCGCGGGG - Intronic
1000614987 5:163416563-163416585 CCGGCTCCAGCAGCTTCCCGGGG - Intergenic
1001318498 5:170661553-170661575 GCGAGTTCTGCACCTCCCCTGGG + Intronic
1001950477 5:175813073-175813095 GCGGCTCTGGTACCTCCCAGAGG + Intronic
1002058109 5:176610168-176610190 GCGGCTACTGCGCATGCCCGGGG - Intergenic
1002559393 5:180071471-180071493 GCGGCGCCAGCACCTGGCCGCGG + Exonic
1002643137 5:180640107-180640129 GAGGGTCCTGCACCTCCCCTGGG + Intronic
1002860500 6:1075481-1075503 CCAGCTCCTGCACCTGCCCCTGG + Intergenic
1003177315 6:3761655-3761677 GCGCCTCCCGAGCCTCCCCGAGG + Intergenic
1003868185 6:10381982-10382004 GGGGCTCCAGCGCGTCCCCGGGG - Intergenic
1003874779 6:10425923-10425945 GGGGCTGCTGCAGCTCCCCGAGG - Intergenic
1004438886 6:15627397-15627419 GCTGCTCTTGCAGCTCCACGAGG + Exonic
1006977398 6:38115903-38115925 GCTGCTGCTGCACCACCCCATGG + Intronic
1008648999 6:53544735-53544757 GCGGCTGCCGCTCCACCCCGCGG + Exonic
1015910089 6:138161571-138161593 GCGGCGCCTGCACCACGCTGGGG + Intergenic
1017532845 6:155314214-155314236 GGGGGTCTTGCACGTCCCCGCGG - Intronic
1017891586 6:158644220-158644242 GCGTCACCCGCACCTCCGCGGGG + Intronic
1018420244 6:163634802-163634824 GCGGCTCTGGCAGGTCCCCGAGG + Intergenic
1018769280 6:166957221-166957243 GCCTCACCTGCCCCTCCCCGCGG + Intergenic
1018998049 6:168725075-168725097 GCAGCTCCTGAGCCTCCCTGGGG + Intergenic
1019351231 7:554946-554968 GAGGACCTTGCACCTCCCCGAGG - Intronic
1019395784 7:816907-816929 AGGGGTCCTGCTCCTCCCCGGGG + Intronic
1019499281 7:1356245-1356267 GCGGCACCTGCAGATCCCGGAGG - Intergenic
1019525431 7:1478477-1478499 GGGGCTCCTGCGCCTGGCCGAGG - Exonic
1024993491 7:55254395-55254417 GCAGATCCTGCACCTGCCCAAGG + Intronic
1025094631 7:56087658-56087680 GCAGCTCCCGCACCTCCTCCGGG + Exonic
1025188251 7:56877432-56877454 GCAGCTCCTGCACCTCCTCGGGG + Intergenic
1025233481 7:57218381-57218403 GCGGCACCGGCAACTCCCCAAGG - Intergenic
1025233955 7:57221063-57221085 GCAGCACCGGCACCTCCCCAAGG - Intergenic
1025683675 7:63699488-63699510 GCAGCTCCTGCACCTCCTCGGGG - Intergenic
1026858526 7:73770219-73770241 GCTGCGCCTGCACCTGCCTGTGG + Exonic
1026973367 7:74481001-74481023 GCGGCTCCCTCACTTCCCCTTGG + Intronic
1032071985 7:128813578-128813600 TGGGCTCCTGCACCTCACCCTGG - Intronic
1032469037 7:132164746-132164768 GCGGCTTCTGCACCGGCCGGGGG + Intronic
1034162405 7:149003000-149003022 CCAGCTCCTGCCCCACCCCGAGG + Intergenic
1034427827 7:151023901-151023923 GGGGTTGCTGCTCCTCCCCGTGG + Exonic
1035403920 7:158586752-158586774 GCGTCCCCCGCACCCCCCCGCGG - Intronic
1035447253 7:158951536-158951558 GGGGCTCCAGCACCTTCCTGTGG - Intronic
1043502906 8:80874147-80874169 GCGGCTCCTGCAGCCCCTTGCGG - Intronic
1045111933 8:98944695-98944717 GCGACTCCTGCGACTCCGCGCGG + Exonic
1048067112 8:130981553-130981575 GTGGCTCCTGCAGCTCCTCCAGG + Intronic
1048987872 8:139744998-139745020 TCACCTCCTGCACATCCCCGGGG - Intronic
1049003150 8:139838697-139838719 GCTGCTCCTCCTCCTCCCAGAGG - Intronic
1049414257 8:142488166-142488188 TCTGCTCCTGGACCTCACCGAGG + Intronic
1049532109 8:143159971-143159993 GACGCACCTGCAGCTCCCCGGGG - Intronic
1049570880 8:143369771-143369793 GCTGCTCCTGCTCCTCGCCCCGG + Intronic
1059313077 9:113401508-113401530 GCGGTTCCTGCGCCCCCTCGTGG - Intergenic
1059430826 9:114249378-114249400 GTGGATCCTGCACCTGCCCCTGG - Intronic
1060112814 9:120918931-120918953 TCGGCTTCTCCACCTACCCGAGG - Intronic
1060524724 9:124314019-124314041 GCGGCCCCAGAACCTCCCCGAGG - Intronic
1060811374 9:126613072-126613094 ACTGCTCCTGCCCCTGCCCGGGG + Intergenic
1061497224 9:130981918-130981940 GCGGCTTCTCCACCTCCCTGCGG + Intergenic
1061764931 9:132875668-132875690 GATGCTCCTGCACCTGCCTGCGG + Intronic
1062000530 9:134213681-134213703 GCCCCTCCTGGACCTCCCCTGGG - Intergenic
1062183183 9:135202189-135202211 GGGTCACCTGCACCTGCCCGAGG + Intergenic
1062271873 9:135713613-135713635 GAGCCTCCTGCCCCTGCCCGTGG + Intronic
1062461610 9:136664740-136664762 GCAGCTCCTGCCCCTGTCCGGGG + Exonic
1062612913 9:137383045-137383067 GTGGCCCCTGCGCCTCCCAGAGG + Intronic
1185479720 X:437438-437460 GAGGTTCCCGCAGCTCCCCGGGG + Intergenic
1186890550 X:13955425-13955447 AGGGCTTCTGCACCTCCCCTGGG + Intergenic
1187176055 X:16897474-16897496 GTGGCTCCTGCCCCTCCCTTTGG - Intergenic
1187226269 X:17377011-17377033 GGGTCTCCTCCATCTCCCCGGGG - Intronic
1192951911 X:76026309-76026331 TTGGCTCCTGCCCCTCCCCAAGG - Intergenic
1193655062 X:84188278-84188300 GCGGCGCCTGGACCCCCCCACGG + Intergenic
1199599654 X:149534400-149534422 GCTGATCCTGCAGCTCCTCGAGG - Intergenic
1199650979 X:149945810-149945832 GCTGATCCTGCAGCTCCTCGAGG + Intergenic
1200073868 X:153541865-153541887 GCAGCTCCTCCAGGTCCCCGTGG + Exonic
1200078041 X:153561559-153561581 GCCTCACCTGCTCCTCCCCGAGG - Intronic
1200108003 X:153725093-153725115 GGGGCCCCAGCACCACCCCGGGG + Exonic
1200240711 X:154491730-154491752 GCGTCTTGTGCACCTACCCGGGG - Intergenic