ID: 915218702

View in Genome Browser
Species Human (GRCh38)
Location 1:154356827-154356849
Sequence GAACTTGGACTTGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915218702_915218714 26 Left 915218702 1:154356827-154356849 CCCCAGCACACAAGTCCAAGTTC No data
Right 915218714 1:154356876-154356898 CCTGGCCACTTACTGGAGCCAGG No data
915218702_915218712 19 Left 915218702 1:154356827-154356849 CCCCAGCACACAAGTCCAAGTTC No data
Right 915218712 1:154356869-154356891 AGCTGTTCCTGGCCACTTACTGG No data
915218702_915218709 8 Left 915218702 1:154356827-154356849 CCCCAGCACACAAGTCCAAGTTC No data
Right 915218709 1:154356858-154356880 CCCCTGCAAACAGCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915218702 Original CRISPR GAACTTGGACTTGTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr