ID: 915221615

View in Genome Browser
Species Human (GRCh38)
Location 1:154379543-154379565
Sequence TCCCAGATGGGGCAGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8588
Summary {0: 6, 1: 34, 2: 291, 3: 1900, 4: 6357}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915221610_915221615 -1 Left 915221610 1:154379521-154379543 CCAAGCGGAGGCGCTCCTCACTT No data
Right 915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG 0: 6
1: 34
2: 291
3: 1900
4: 6357
915221604_915221615 23 Left 915221604 1:154379497-154379519 CCTCACTTCCCGGACGGTTGGCG No data
Right 915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG 0: 6
1: 34
2: 291
3: 1900
4: 6357
915221606_915221615 15 Left 915221606 1:154379505-154379527 CCCGGACGGTTGGCGGCCAAGCG No data
Right 915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG 0: 6
1: 34
2: 291
3: 1900
4: 6357
915221607_915221615 14 Left 915221607 1:154379506-154379528 CCGGACGGTTGGCGGCCAAGCGG No data
Right 915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG 0: 6
1: 34
2: 291
3: 1900
4: 6357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915221615 Original CRISPR TCCCAGATGGGGCAGCAGCC AGG Intergenic
Too many off-targets to display for this crispr