ID: 915225003

View in Genome Browser
Species Human (GRCh38)
Location 1:154405562-154405584
Sequence GCTAATGGGAACCGGGCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915225003_915225014 6 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225014 1:154405591-154405613 GCCTCTGCGGGACCATGGAGTGG 0: 1
1: 0
2: 1
3: 4
4: 147
915225003_915225010 -6 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225010 1:154405579-154405601 ATTAGCCTGTCCGCCTCTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 64
915225003_915225012 1 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225012 1:154405586-154405608 TGTCCGCCTCTGCGGGACCATGG 0: 1
1: 0
2: 0
3: 8
4: 88
915225003_915225009 -7 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225009 1:154405578-154405600 CATTAGCCTGTCCGCCTCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
915225003_915225019 29 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225019 1:154405614-154405636 TAGCCGAGGAGGAAGCATGCTGG 0: 1
1: 0
2: 2
3: 5
4: 122
915225003_915225018 18 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225018 1:154405603-154405625 CCATGGAGTGGTAGCCGAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 107
915225003_915225016 15 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225016 1:154405600-154405622 GGACCATGGAGTGGTAGCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915225003 Original CRISPR GCTAATGGGAACCGGGCGGC AGG (reversed) Exonic
900298714 1:1965832-1965854 GCTTACAGAAACCGGGCGGCGGG + Intronic
905637565 1:39565061-39565083 GCTCTTGGGAACCTGCCGGCTGG - Intronic
910500768 1:87887793-87887815 GCTAAGGGGAACTAGGAGGCTGG + Intergenic
912381911 1:109252240-109252262 GTTAATGAGGACCGGCCGGCAGG + Exonic
915225003 1:154405562-154405584 GCTAATGGGAACCGGGCGGCAGG - Exonic
922103035 1:222489796-222489818 GCTAATGGGATATGGGAGGCTGG - Intergenic
1063753191 10:8975795-8975817 GCTTATGGGAAACTGGCTGCAGG - Intergenic
1075845779 10:125544210-125544232 GGCAATGGGAACCAGGAGGCTGG - Intergenic
1076850347 10:133089301-133089323 TCTAATGGGAAGGGGCCGGCAGG - Intronic
1077261472 11:1623720-1623742 GCTAATGGGAGCTGTGGGGCAGG + Intergenic
1081484725 11:43518825-43518847 GCTGATGGGAAGCCGGCAGCTGG - Intergenic
1083369472 11:62166832-62166854 GCCAATGGGAAACAGGAGGCAGG + Intergenic
1090828362 11:130403776-130403798 GCTAAGGGGAACAGTGGGGCTGG + Intergenic
1105240822 13:18608963-18608985 GCTGCTGGGAACTGGCCGGCGGG - Intergenic
1112756634 13:102642065-102642087 GCTAATGGTTACCTGGGGGCAGG + Intronic
1117676911 14:58164751-58164773 GTTAATGGGAACCTGGTGGATGG - Intronic
1121106216 14:91281598-91281620 GCTACTGGGATCCGGGTGCCAGG - Intronic
1123490534 15:20776177-20776199 GCTGCTGGGAACTGGCCGGCGGG + Intergenic
1123547036 15:21345264-21345286 GCTGCTGGGAACTGGCCGGCGGG + Intergenic
1123833676 15:24167091-24167113 GCTACTGTGACCTGGGCGGCGGG - Intergenic
1123840416 15:24242127-24242149 GCTACTGTGACCTGGGCGGCGGG - Intergenic
1123853363 15:24382654-24382676 GCTACTGTGACCTGGGCGGCGGG - Intergenic
1126299995 15:47184594-47184616 GCGCACGGGAACCGGGCGGCGGG - Intronic
1126363419 15:47869736-47869758 GCTAATGGTGACCTGGTGGCTGG - Intergenic
1131091352 15:89627056-89627078 GCTCATGGGAACCTGGCTGGAGG + Exonic
1131264252 15:90906370-90906392 GCTGGTGGGAAACGGGCAGCTGG + Exonic
1132314256 15:100879262-100879284 GCTAGCGGGGATCGGGCGGCTGG + Intronic
1202955367 15_KI270727v1_random:72480-72502 GCTGCTGGGAACTGGCCGGCGGG + Intergenic
1133203448 16:4218648-4218670 GCTAATGGGGACAGAGCTGCTGG - Intronic
1134514918 16:14879328-14879350 GCTACTGGAGACCGGGCAGCGGG + Intronic
1142810125 17:2392102-2392124 CATAATAGGGACCGGGCGGCGGG - Intronic
1152533937 17:80939712-80939734 GCCAAAGGGAACCAGGCAGCTGG - Intronic
1152543259 17:80987748-80987770 GCCAATGGGAAACGGGGTGCTGG + Intergenic
1154448147 18:14450944-14450966 GCTGCTGGGAACTGGCCGGCGGG + Intergenic
1159900952 18:74045114-74045136 GCTAATGGGAGGAAGGCGGCTGG - Intergenic
1161262523 19:3345650-3345672 GCCATGGGGAGCCGGGCGGCGGG - Intergenic
1161980713 19:7628814-7628836 GCTAGTGGGATCCTGGGGGCGGG - Intronic
1164693164 19:30225844-30225866 GCGAGAAGGAACCGGGCGGCAGG - Intergenic
1166891296 19:45995384-45995406 GCTAATGGAAACTTGGCTGCTGG + Intergenic
1167052960 19:47090871-47090893 GGTAATGGGAAACTGGAGGCAGG + Intronic
926746173 2:16160152-16160174 GCAAATGGCAGCCGGGCAGCAGG + Intergenic
935137740 2:100322154-100322176 GCTGCTGGGAACTGGCCGGCGGG + Exonic
945042752 2:205755690-205755712 GCTAATGGGTTCAGAGCGGCTGG + Intronic
947263522 2:228251680-228251702 GCTAAAGGGAAGAGGGCTGCTGG + Intergenic
1173803987 20:45912126-45912148 GCTCAGGGGATCCGGGCGACGGG + Intronic
1176301419 21:5100783-5100805 GCCCATGAGAAGCGGGCGGCGGG + Intergenic
1176448084 21:6839748-6839770 GCTGCTGGGAACTGGCCGGCGGG - Intergenic
1176826254 21:13704770-13704792 GCTGCTGGGAACTGGCCGGCGGG - Intergenic
1179855612 21:44161116-44161138 GCCCATGAGAAGCGGGCGGCGGG - Intergenic
1180089382 21:45526023-45526045 GCTGGTGGGAGCCGGGCTGCAGG - Intronic
1182254290 22:29027176-29027198 ACTAATGGGAACCGGGCTGGAGG - Intronic
1184391762 22:44207205-44207227 GCTGATGGGAACCGGGGAGGAGG + Exonic
1184437210 22:44486534-44486556 GCTTATGGGTGCCGGGAGGCTGG - Intergenic
950133024 3:10560562-10560584 GCTGATGGGAGCCAGGCAGCAGG - Intronic
951166053 3:19486251-19486273 GATAATGGGAACAGGGTGGTGGG + Intronic
968756600 4:2419142-2419164 GCGAGAGGGAACCGGCCGGCAGG - Intronic
984463065 4:180059453-180059475 GCTGATGGGAACCGAGAGGAGGG + Intergenic
988143700 5:27276278-27276300 GCTAATGAGTACCGGGGAGCAGG - Intergenic
989130294 5:38100443-38100465 GCTGATGGGAAAGGGGAGGCTGG + Intergenic
998467526 5:142357396-142357418 GCGAATGGGAACCGCGCGCGGGG + Intergenic
1008030163 6:46686779-46686801 GCCAAAGGGAACCTGTCGGCTGG + Intergenic
1018860934 6:167710113-167710135 TCTAATGGGAACGGGTGGGCAGG + Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1023399502 7:39781656-39781678 GCTAATGGGATATGGGAGGCTGG + Intergenic
1028892946 7:96009319-96009341 GCTAATGGGGACAGGGCAGAGGG - Intronic
1031458477 7:122013778-122013800 GCTGATGGGATCCTGGCAGCAGG + Exonic
1035672097 8:1425946-1425968 GCTTATGGAAACCAGGTGGCTGG + Intergenic
1038828667 8:31033512-31033534 GGGAATGAGGACCGGGCGGCGGG + Exonic
1043873812 8:85463744-85463766 GCCGAGGGGAGCCGGGCGGCGGG + Intergenic
1049820231 8:144629003-144629025 ACTAATGGGAAGCGCGTGGCAGG - Intergenic
1056135840 9:83628756-83628778 GTTGATGGGAACCAGGCGGGTGG + Intronic
1057271132 9:93652069-93652091 GCTAGTGGGATTGGGGCGGCAGG + Intronic
1060570706 9:124637046-124637068 GCTAATGGGAACCCGGAGGCAGG + Intronic
1061395784 9:130342715-130342737 GCTGATGGGCACAGGGGGGCAGG - Intronic
1203521106 Un_GL000213v1:44770-44792 GCTGCTGGGAACTGGCCGGCGGG + Intergenic
1200059332 X:153477241-153477263 GCTAATGGGAACCAGATGGCAGG + Intronic