ID: 915225003

View in Genome Browser
Species Human (GRCh38)
Location 1:154405562-154405584
Sequence GCTAATGGGAACCGGGCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915225003_915225014 6 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225014 1:154405591-154405613 GCCTCTGCGGGACCATGGAGTGG 0: 1
1: 0
2: 1
3: 4
4: 147
915225003_915225019 29 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225019 1:154405614-154405636 TAGCCGAGGAGGAAGCATGCTGG 0: 1
1: 0
2: 2
3: 5
4: 122
915225003_915225009 -7 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225009 1:154405578-154405600 CATTAGCCTGTCCGCCTCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 66
915225003_915225012 1 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225012 1:154405586-154405608 TGTCCGCCTCTGCGGGACCATGG 0: 1
1: 0
2: 0
3: 8
4: 88
915225003_915225016 15 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225016 1:154405600-154405622 GGACCATGGAGTGGTAGCCGAGG 0: 1
1: 0
2: 0
3: 11
4: 120
915225003_915225010 -6 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225010 1:154405579-154405601 ATTAGCCTGTCCGCCTCTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 64
915225003_915225018 18 Left 915225003 1:154405562-154405584 CCTGCCGCCCGGTTCCCATTAGC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 915225018 1:154405603-154405625 CCATGGAGTGGTAGCCGAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915225003 Original CRISPR GCTAATGGGAACCGGGCGGC AGG (reversed) Exonic