ID: 915225527

View in Genome Browser
Species Human (GRCh38)
Location 1:154408411-154408433
Sequence AAGGAGCCTGAAAATGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915225520_915225527 21 Left 915225520 1:154408367-154408389 CCTGTGAGGCCTGTGTAGGATCA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 915225527 1:154408411-154408433 AAGGAGCCTGAAAATGGTCATGG 0: 1
1: 0
2: 3
3: 18
4: 261
915225521_915225527 12 Left 915225521 1:154408376-154408398 CCTGTGTAGGATCAGCTATGCAG 0: 1
1: 0
2: 0
3: 2
4: 71
Right 915225527 1:154408411-154408433 AAGGAGCCTGAAAATGGTCATGG 0: 1
1: 0
2: 3
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915225527 Original CRISPR AAGGAGCCTGAAAATGGTCA TGG Intronic
900125207 1:1065966-1065988 AAGGAGCATGAAAGTGGACAAGG + Intergenic
901367132 1:8762202-8762224 TAGGAGGCTGAAATTGGTAAGGG - Intronic
901954027 1:12771087-12771109 GAGGCGCCTGGAAAGGGTCAGGG - Intergenic
903134808 1:21302590-21302612 CTGGAGCCTGAAAAGGGGCATGG - Intronic
904209940 1:28880420-28880442 AAGGAGTCTTAAAATGTTTAGGG - Intergenic
904895731 1:33816432-33816454 AAGGCTACTGAAAATGGTGATGG + Intronic
904946243 1:34200789-34200811 AAGGAGCCAAAAAAGGGTCAAGG + Exonic
906747120 1:48229892-48229914 AAGGAGCCTGGACTGGGTCATGG - Intronic
907490457 1:54805954-54805976 AAGGACCCTGAAAATGTGCACGG + Intergenic
909038240 1:70620079-70620101 ACGGAGCATGTCAATGGTCAGGG - Intergenic
909111876 1:71489363-71489385 AAGCAGCCTAAGAATGGGCAGGG - Intronic
910775269 1:90868440-90868462 AAGGAGCATGAAGGTGGTAAGGG - Intergenic
912442345 1:109709001-109709023 AGGGAGCCTATAAATGGACATGG + Intronic
912563389 1:110566340-110566362 AAGATGCCTGTAAGTGGTCAGGG + Intergenic
915135523 1:153728603-153728625 CAGGAGCCGGGAAAAGGTCAGGG - Exonic
915225527 1:154408411-154408433 AAGGAGCCTGAAAATGGTCATGG + Intronic
915233168 1:154461221-154461243 GAGGAGCATGAAAGTGGACAAGG + Intronic
915379861 1:155430744-155430766 AATGAGCCTGAAAATGATATTGG - Intronic
915653173 1:157334567-157334589 AAGGAGCCTGAGAACGGTGGAGG - Intergenic
915901743 1:159851731-159851753 AAGGATGCTAAGAATGGTCAGGG + Intronic
918176286 1:182048513-182048535 AAGGGGCCTGAAAGTGATAAAGG + Intergenic
918278833 1:182982449-182982471 AAGGAAACTGAAAATGAGCAGGG - Intergenic
919618101 1:199832513-199832535 AAGAAGGCTGAAAATGGTTCAGG - Intergenic
920086405 1:203421014-203421036 GAAGAGGGTGAAAATGGTCAGGG - Intergenic
921338296 1:214109797-214109819 TGGTAGCCTGAAATTGGTCATGG - Intergenic
922307779 1:224358915-224358937 TAGGAGGTGGAAAATGGTCACGG + Intronic
922588815 1:226756922-226756944 ACGGAGCCTGAAGATGGGCCTGG + Intergenic
923028920 1:230231231-230231253 AAGGACTCTGAAAACTGTCAAGG - Intronic
923548200 1:234940170-234940192 AAGAAGCATGAAAATGGCCCGGG - Intergenic
1063034094 10:2268125-2268147 AAGGAGCCTGAAAGACGGCATGG - Intergenic
1064706922 10:18082611-18082633 AAGGAGCCAGAAAATGGGGGAGG - Intergenic
1064944856 10:20775880-20775902 AAGGAGCCTGAAAATCTTGCAGG - Intergenic
1065771015 10:29078561-29078583 AGGGAGCCTGCAGATGGTTAGGG + Intergenic
1067661287 10:48237902-48237924 ACGGTGGCTGAAAATGGGCAGGG - Intronic
1068890881 10:62147321-62147343 AAGAGGCTTGAAAATGGCCAAGG + Intergenic
1069262347 10:66414574-66414596 AGGAAGCTTGAATATGGTCATGG + Intronic
1070170750 10:73931107-73931129 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1070586899 10:77773239-77773261 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1071312241 10:84353738-84353760 TAGGAGACTGAAAATGCTAAAGG - Intronic
1072468669 10:95691880-95691902 AACGAGCCTGGAAATGCTAAGGG + Intronic
1073114657 10:101084894-101084916 GATGAGCCTGTAAAGGGTCAGGG - Intergenic
1073342872 10:102758996-102759018 GAGGAGCATGAAAGTGGACAAGG + Intronic
1074300319 10:112227339-112227361 AAGGAGCATGAAAGAGCTCAGGG + Intergenic
1075634616 10:124022087-124022109 GAGGAGCCTGAAGTGGGTCAAGG - Intronic
1075655068 10:124155945-124155967 AAAGAGCCAGACACTGGTCATGG - Intergenic
1076597026 10:131630112-131630134 CAGGTCCCTGAAAATGGGCAGGG + Intergenic
1076897780 10:133322314-133322336 GAGGAGCATGAAAGTGGACAAGG - Intronic
1076907011 10:133367707-133367729 GAGGAGCATGAAAGTGGACAAGG - Intronic
1077005637 11:354597-354619 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1077013345 11:389415-389437 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1077425173 11:2472722-2472744 AAGGAGCCTGACAATGGGCAGGG - Intronic
1077662995 11:4085672-4085694 AAGGCACCTGAAACAGGTCATGG - Intronic
1079010644 11:16825422-16825444 TAGAAGCCTGAAAATAGTGAGGG + Intronic
1079100430 11:17538299-17538321 AAGGGGCCTGAAGATTGTGAGGG - Intronic
1080659836 11:34286703-34286725 AAACAGCATGAAAATGGTGATGG - Intronic
1080776793 11:35394046-35394068 AGGGAGCTTGAAAATTGCCAAGG - Intronic
1081189495 11:40085724-40085746 AAGGAGGCTGAAAAGGGGCCAGG - Intergenic
1084073604 11:66754816-66754838 AAGATACTTGAAAATGGTCAAGG - Intronic
1084345772 11:68547468-68547490 AAGGAACGTGAGAATGGCCACGG - Intronic
1086255743 11:84874375-84874397 AAGGAGCTTGATAATATTCAAGG + Intronic
1086795370 11:91094787-91094809 AAGGAGGCTGAGAATCATCAAGG + Intergenic
1087323475 11:96692530-96692552 AAGGCGCCTCAAAACTGTCAAGG - Intergenic
1088692772 11:112342031-112342053 AAGAAGCCTGATAATGGACTTGG - Intergenic
1090001094 11:122959461-122959483 AAGGAGACCAAAAATGGTCCAGG + Exonic
1090498915 11:127242567-127242589 AAATAGCATGGAAATGGTCATGG + Intergenic
1091126624 11:133105536-133105558 AAGTAGGCTGAAAATGGAGATGG + Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1094148515 12:27256278-27256300 AAGGAGCCTGGAAGAGGCCATGG - Intronic
1095254875 12:40022930-40022952 AAGGAACTTAAAAATGGTCATGG - Intronic
1096028048 12:48385365-48385387 TATGTGCCTGCAAATGGTCAAGG - Intergenic
1096243466 12:49971838-49971860 AAGGAGGGAGAAAAGGGTCAAGG + Intronic
1096982599 12:55737040-55737062 TGGGAGCCTGAAATTGGTGAGGG - Intergenic
1102384289 12:112494305-112494327 AAGTAACATGACAATGGTCATGG - Intronic
1102441112 12:112964529-112964551 AAAGAGCTGGAAAGTGGTCATGG + Intronic
1103026594 12:117579210-117579232 AAAGAGACAGAAAATGTTCAAGG + Intronic
1104885162 12:132103060-132103082 GAGGAGCATGAAAGTGGACAAGG - Intronic
1104913744 12:132253189-132253211 GAGGAGCATGAAAGTGGACAAGG + Intronic
1105725274 13:23157154-23157176 CAGAAGCCAGAAAATGGGCAAGG + Intergenic
1105732064 13:23227777-23227799 AAGGAGCCTGCAGAGGGGCACGG + Intronic
1106533638 13:30618280-30618302 AAGGAGCGTGGAGATGGGCAGGG + Intronic
1106565213 13:30878711-30878733 AAGGATCTTGAGAATGGTTAGGG + Intergenic
1106714123 13:32369962-32369984 AAGCAGCCTGAGAATGATTATGG - Intronic
1108734104 13:53264477-53264499 AAGGATCCTTCAAATGGCCATGG + Intergenic
1110570447 13:76997055-76997077 AAGAAACATGAAAATGCTCAGGG - Intronic
1112251978 13:97790397-97790419 AAGGAGACAGAAAATCTTCAAGG - Intergenic
1112788508 13:102978293-102978315 AAGGAGAGTGGAAATGGTCTAGG + Intergenic
1113294394 13:108941725-108941747 AAGGGGCCAGAAAATGGCTATGG + Intronic
1113507684 13:110828374-110828396 GAGGAGCCTGAAATTTATCAGGG - Intergenic
1113583623 13:111447966-111447988 AAGGAGACTGAAAGTCGTCCAGG + Intergenic
1114692205 14:24594699-24594721 AAGGAGCCAGAGAAAGGTGAAGG - Intergenic
1115194291 14:30779228-30779250 TAGAAACCTGAAAATGGACAAGG - Intergenic
1115777283 14:36729831-36729853 GGGGAAACTGAAAATGGTCATGG - Intronic
1119640889 14:76314153-76314175 CAGAAGCCTGAAAATGCTGATGG - Intronic
1121131960 14:91455452-91455474 CAGGAGACTGAAAAGGGTCAAGG + Intergenic
1121613669 14:95298427-95298449 AAGGAACCAGAAACTGTTCAAGG + Intronic
1122698381 14:103569769-103569791 AAGGACTCAGAAAATGTTCATGG - Intronic
1123192054 14:106580867-106580889 AAGGGGCCTGAGGATGGTCTTGG - Intergenic
1124108940 15:26769448-26769470 AAGGAGCCTATAAATGGTAAAGG - Intronic
1126749422 15:51861475-51861497 AAGGAGCCTTAAAATGTTACTGG + Intronic
1127417083 15:58768717-58768739 GAGGAGCATGAAAGTGGACAAGG - Intergenic
1127426102 15:58859454-58859476 AAAGTGACTGAAAATGGTAAAGG + Exonic
1128240786 15:66099787-66099809 AATGAGCCTGAGCATGCTCAGGG - Intronic
1129808927 15:78490343-78490365 GAGGCGCATGAAAATGATCAAGG - Intronic
1132771609 16:1566806-1566828 CAGGAGCCTCAAAAAGGTCGAGG - Intronic
1133630536 16:7616113-7616135 ATGGAGCCTGAGAGTGGTCTTGG - Intronic
1138763223 16:59568675-59568697 AAGACGTCTGAAAATGCTCAGGG - Intergenic
1141931064 16:87203173-87203195 AGGGAGCCTGAAAAATGCCAGGG + Intronic
1144936966 17:18907488-18907510 AAGGAGACTGAAAATCATTAAGG + Intronic
1147806276 17:43134119-43134141 AAGGTACCTGCAAAGGGTCAAGG - Intergenic
1148751893 17:49950075-49950097 GAGGAGCCAGAGAATGGGCAAGG - Intergenic
1150235176 17:63587114-63587136 CAGGAGCCTTATAATGGACAAGG + Intronic
1151010871 17:70494543-70494565 AAGAAACCTGAAAATGGGCCAGG + Intergenic
1151314808 17:73315230-73315252 AAGGAGCCTGAATTTGGGTAAGG - Intergenic
1154122367 18:11662311-11662333 AAGCAGCCTGATAACGGTGATGG + Intergenic
1155100553 18:22606464-22606486 AAGGATCTTGAAAAAGGTTAGGG - Intergenic
1155560017 18:27065619-27065641 AATGACCCTGAAAATAGTAAGGG + Intronic
1157887197 18:51380281-51380303 CATGAGCCTCAAAATGATCAGGG - Intergenic
1157938199 18:51896172-51896194 AATGAGGCTGAAAGAGGTCAAGG - Intergenic
1158223968 18:55181321-55181343 AAGGAGATTGAAAATGTTCAGGG + Intergenic
1158345230 18:56509516-56509538 AAGAAGCCTGAAAATTTTCCAGG - Intergenic
1161334319 19:3704226-3704248 CTGGAGCCTTAAAATGGTCAAGG - Intergenic
1161870954 19:6869484-6869506 GAGGAGCATGAAAGTGGACAAGG - Intergenic
1166514644 19:43437311-43437333 GAGGAGCATGAAAGTGGACAAGG - Intergenic
1167718444 19:51159796-51159818 ATGAAGCCAGCAAATGGTCAAGG + Intergenic
1167927736 19:52835156-52835178 GAGGAGCATGAAAGTGGACAAGG + Intronic
1167939127 19:52932149-52932171 GAGGAGCATGAAAGTGGACAAGG - Intronic
1168084743 19:54037281-54037303 GAGGAGCATGAAAGTGGACAAGG - Intergenic
1168726395 19:58584730-58584752 GAGGAGCATGAAAGTGGACAAGG - Intergenic
926115447 2:10210201-10210223 AGGGAGCCGGAACATGGCCAAGG - Intronic
927179256 2:20432794-20432816 GAGGAGTCTGAAAATAGCCATGG + Intergenic
928235072 2:29532110-29532132 AAGGAGCCTGGAAAGAGACAGGG + Exonic
929301106 2:40304581-40304603 AAGGAGGCTGACAATGGGAAAGG - Intronic
929336053 2:40746923-40746945 ACGTAACCTGAAAATGCTCATGG - Intergenic
930132512 2:47866877-47866899 AAGTAGTCTGAAGATGATCAAGG - Intronic
930415965 2:51092070-51092092 AAGGAACCTGACGATGTTCATGG - Intergenic
931085250 2:58822987-58823009 GAGGAGCATGAAAGTGGACAAGG - Intergenic
933100391 2:78248251-78248273 CAGTGGCCTGACAATGGTCATGG + Intergenic
935060467 2:99602761-99602783 AAGCAGCCTGGACATGGTAAAGG + Intronic
935330872 2:101976873-101976895 AAGAAGCCTGAAGATGGCGAGGG - Intergenic
935379763 2:102439717-102439739 AAGGAGACTGAAAAAGCTGAAGG + Intronic
935473717 2:103491680-103491702 AAGTAAACAGAAAATGGTCAGGG - Intergenic
935728388 2:106044009-106044031 AAGGAGTCTATCAATGGTCAAGG - Intergenic
937071297 2:119065793-119065815 AAGGAGGCTGGAAATGGACCTGG - Intergenic
938305009 2:130247280-130247302 AAGGAGCCTGTAGAAGGTCAGGG + Intergenic
938408170 2:131044236-131044258 GAGCAGCCAGGAAATGGTCAGGG + Intronic
939183018 2:138825999-138826021 AAGGGGTCTGAAGATGGTCCAGG - Intergenic
941854695 2:170219165-170219187 AAGGAGCCTCAATGTGGGCAAGG - Intronic
942047163 2:172106466-172106488 AAGGAGAGTGAAAATGGGCCTGG - Intergenic
943556536 2:189412931-189412953 AAGGTGCCTGAGAATGTTCGTGG + Intergenic
946787539 2:223263472-223263494 AAGGAGCCTGGCGATGGACATGG - Intergenic
948211908 2:236200433-236200455 AAGGAAACTGACAAGGGTCAGGG + Intronic
1171333009 20:24357868-24357890 AAGGAGCCTGGAGGAGGTCATGG - Intergenic
1172546884 20:35769107-35769129 AAGGAGACTGACACTGATCAGGG - Intergenic
1174550056 20:51355708-51355730 TAGGAGCCATAAAAAGGTCATGG + Intergenic
1174667774 20:52276109-52276131 AAGCAGCATGAAAAATGTCAGGG + Intergenic
1174841513 20:53905547-53905569 AAGGAGCTAGAGAGTGGTCAGGG + Intergenic
1174864961 20:54126891-54126913 AAGCAGCCTGGAAATGGTCATGG + Intergenic
1175964179 20:62652141-62652163 AAGGAGCCTCAACAGGGCCAAGG - Intronic
1176035208 20:63032872-63032894 AAGGAAGCTGGAGATGGTCAGGG + Intergenic
1176245997 20:64097275-64097297 ATGGAGACCGAAAATGGTGACGG - Intronic
1177028497 21:15952732-15952754 AAGGAGACAGAAAATTGACAAGG - Intergenic
1179045874 21:37844630-37844652 AAGGAGGTAGAAAATGGTCACGG - Intronic
1179275967 21:39891907-39891929 GAGGAGCATGAAAGTGGACAAGG + Intronic
1179970254 21:44832878-44832900 GAGGAGCATGAAAGTGGACAAGG - Intergenic
1181286494 22:21756206-21756228 GAGGAGCCAAAAAATGGTGATGG - Exonic
1181416405 22:22762502-22762524 CAGGACCCTGCTAATGGTCAGGG - Intronic
1181913756 22:26262548-26262570 AAGAAGCCTGAGAATGGGAATGG - Intronic
1184695265 22:46135400-46135422 AAGGGGCCTGGAGAAGGTCAGGG + Intergenic
1185112430 22:48908083-48908105 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1185386548 22:50534377-50534399 GAGGAGCATGAAAGTGGACAAGG - Intergenic
949561548 3:5207351-5207373 AAGGAGACAGAGAATGCTCAGGG - Intronic
949941089 3:9155203-9155225 AAGAATCCTGAAAATGCTGAGGG - Intronic
950016820 3:9760352-9760374 AAGGAGGATGAAAATGTTTATGG + Intronic
950361180 3:12450515-12450537 CAGGAGCCTGACCATGGTCCAGG + Intergenic
953174331 3:40535726-40535748 AAGAAGTCTGAAAATGGGGAAGG + Exonic
954432571 3:50478800-50478822 GAGGAGCTTGAAATAGGTCATGG + Intronic
955678916 3:61479952-61479974 ACGGAGACTGAAAATTGCCATGG - Intergenic
956727594 3:72169188-72169210 AAGGAGCTTGAAATTGGCCATGG + Intergenic
963027333 3:140933034-140933056 AAGGATCTTGAAAAGGTTCACGG + Intergenic
964540635 3:157775438-157775460 AAGGAGCCTGACAGGAGTCAGGG + Intergenic
964955066 3:162344681-162344703 TGGGAGCTTGAAATTGGTCACGG + Intergenic
969237534 4:5876533-5876555 AATGAGCCTCAAAAAGATCAAGG + Intronic
971049922 4:22850055-22850077 AAGGAGTCTGAAAATCTACAGGG - Intergenic
972448259 4:39168199-39168221 AATGAGCATGAACATTGTCATGG - Intergenic
973266823 4:48219467-48219489 GAGGAGCATGAAAGTGGACAAGG - Intronic
974153273 4:58038076-58038098 AAGGAGGCAGAAAAGGGTGATGG - Intergenic
974397452 4:61356894-61356916 AAACAGCCTGAAAGTGTTCAGGG - Intronic
974509098 4:62814084-62814106 TAGGAGCCTGCAAATTTTCAAGG + Intergenic
974767784 4:66370443-66370465 AAGCAGCCTTGAGATGGTCAAGG + Intergenic
975557163 4:75676127-75676149 AAGGGGCCTGAACCTGGGCAGGG - Intronic
976009212 4:80467186-80467208 TAGCAGCTTGAAATTGGTCAAGG + Intronic
976254439 4:83085261-83085283 GAGGAGCATGAAAGTGGACAAGG - Intergenic
976361915 4:84189662-84189684 AAAGAGCCTGAAAATATTCAAGG + Intergenic
976579586 4:86720273-86720295 AAGGAACCTCAAAAATGTCAAGG + Intronic
977353908 4:95921498-95921520 AAGGAACATGAATATTGTCATGG - Intergenic
978378449 4:108100707-108100729 TGGTAGCCTGAAATTGGTCATGG + Intronic
980793938 4:137656651-137656673 AAGGAAACTGAAATTGGTTAAGG + Intergenic
982025793 4:151253034-151253056 AAGTAGATTGATAATGGTCAGGG - Intronic
983862485 4:172724894-172724916 AAGGAGCTTGAACATCATCAGGG + Intronic
984392009 4:179148168-179148190 AAGCTCCCTGAAAATGGCCAAGG + Intergenic
984580305 4:181502980-181503002 AGGGAAGCTGTAAATGGTCACGG - Intergenic
986292914 5:6414737-6414759 GGAGAGCCTGTAAATGGTCATGG - Intergenic
986811279 5:11362035-11362057 TACCAGCCTGAAAATGTTCATGG - Intronic
987308437 5:16660226-16660248 CTGGAGCCTGAAATTGGCCATGG + Intergenic
987603119 5:20098928-20098950 AAGGAGACTGAATATGTTGATGG - Intronic
989646696 5:43641963-43641985 AGGGAGCCTAAAAATGGTTTTGG + Intronic
989714724 5:44448811-44448833 AATAAGACTTAAAATGGTCATGG + Intergenic
990371180 5:55119866-55119888 AAGGAGATTGCAACTGGTCAAGG - Exonic
994188500 5:96841466-96841488 CAGCAGCTTGAAATTGGTCATGG - Intronic
995415155 5:111902751-111902773 AAGGAGCAGGAACATTGTCATGG - Intronic
995505533 5:112856331-112856353 AAGGAGGATGAAAATGGACATGG - Intronic
996893371 5:128450125-128450147 AAGTAGACTGAAAATCATCAGGG + Intronic
997406969 5:133656854-133656876 AAGGAGACTGACAATAGTCTAGG + Intergenic
998640061 5:143999685-143999707 AAGGAACTTCAAAAAGGTCATGG + Intergenic
999799110 5:155017016-155017038 AATGAGCATGAAGATGGTGATGG + Exonic
1002135877 5:177107273-177107295 AAGGAGCTTGGCAGTGGTCAGGG - Intergenic
1002635812 5:180608120-180608142 GAGGAGCATGAAAGTGGACAAGG - Intronic
1003408924 6:5846438-5846460 AAGGGGCATGAAAATGGGAAAGG - Intergenic
1004036839 6:11932525-11932547 AATAAGCATGAAAGTGGTCATGG + Intergenic
1005864963 6:29930368-29930390 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1006368711 6:33631579-33631601 GAGGAGCATGAAAGTGGACAAGG + Intronic
1006734235 6:36261127-36261149 AATGATCATGAAAATGGTCGTGG - Intronic
1007551623 6:42734205-42734227 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1008818945 6:55608042-55608064 AAGGAGAGAGAAAATGGTCTTGG - Intergenic
1012519113 6:100098985-100099007 AAGGACCCTGAAAGAGTTCATGG - Intergenic
1012593283 6:101009714-101009736 AAGGAGCATGAAAATGATCAAGG + Intergenic
1013254020 6:108365761-108365783 AAGGTGACTTTAAATGGTCATGG - Intronic
1013420668 6:109963812-109963834 AAAGAGGCTGTAAATTGTCATGG - Intergenic
1013918930 6:115376536-115376558 CAGGAGCCTGAATCTGATCAAGG - Intergenic
1015049631 6:128824066-128824088 AAGGAGCCAGAAAAAGATCTAGG - Intergenic
1015897377 6:138030434-138030456 AGGGACCCTAAAAATTGTCAAGG + Intergenic
1017055568 6:150432750-150432772 AAGGAGCCTGTGAATGCTCAGGG - Intergenic
1017155651 6:151320522-151320544 AAGGACCCTGGGAATGGACAGGG - Intronic
1017235459 6:152113291-152113313 ATGGTGCCTGACAAAGGTCAGGG - Intronic
1020263017 7:6541621-6541643 AAGGAGCATGCAAATAGACATGG + Intronic
1023480787 7:40631753-40631775 CAGGAGCCTGTCCATGGTCAAGG - Intronic
1024456556 7:49614986-49615008 GAGGAGCATGAAAGTGGACAAGG - Intergenic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1034140583 7:148811753-148811775 AAGGAGGGTGAAAATGGACTGGG + Intronic
1035092558 7:156326353-156326375 AAGAGGCCTTAAAAAGGTCAAGG - Intergenic
1036400227 8:8401275-8401297 AAAGAGGCAGAAAATGGGCAAGG + Intergenic
1039695930 8:39911396-39911418 AAGGAGAATGAAAAAAGTCATGG - Intronic
1042218827 8:66453405-66453427 AAGAAGCCTGAAGACTGTCAAGG - Intronic
1042411794 8:68474753-68474775 AAAGAGCCTGTAAAAGATCATGG + Intronic
1046621115 8:116530674-116530696 AAGGAGACAGATAATGGACACGG + Intergenic
1049768270 8:144365855-144365877 GAGGAGCATGAAAGTGGACAAGG - Intergenic
1050668988 9:7974986-7975008 GAGGTGTCTGAAAATGGGCATGG - Intergenic
1051972666 9:22909649-22909671 AAGTTGCTTGAAAATGGCCAAGG + Intergenic
1052337044 9:27330677-27330699 AAGGATCCTGAAAATGCTCTTGG + Intronic
1053087263 9:35236311-35236333 TTGGAGCCTAAAAATGGTCGTGG + Intronic
1054845185 9:69787598-69787620 TAGGAGGCTAAAAATGGTAAAGG - Intergenic
1055192408 9:73541373-73541395 AAGTAGCCTGAGATTGGCCAAGG - Intergenic
1055438894 9:76319775-76319797 GAGGAGCATGAAAGTGGACAAGG - Intronic
1056689546 9:88795162-88795184 GAGTAGACTGAATATGGTCATGG + Intergenic
1058052259 9:100418826-100418848 AAGGAAACTGAATATGGACAAGG + Intergenic
1060116938 9:120949168-120949190 AAGGAGACTGGTAATGGTCAGGG - Intergenic
1062173855 9:135149989-135150011 GAGGAGCATGAAAGTGGACAAGG + Intergenic
1062714613 9:138001940-138001962 AGGAAGCCTTAAAATGGTGAAGG + Intronic
1187590690 X:20714002-20714024 AAGGAGCATGAACTTGGGCAAGG + Intergenic
1187921567 X:24207735-24207757 AGTGAGCCTGAGAATGATCATGG + Exonic
1188261796 X:28032412-28032434 AAGGAGAGTGATTATGGTCAGGG - Intergenic
1188488360 X:30708275-30708297 AAGGAACCTGAAACTGATCTGGG + Intronic
1188939081 X:36215407-36215429 AAGGAGCCTGAAACTGAGCATGG + Intergenic
1193333189 X:80258288-80258310 AAGTAGCTTGAAAATGGCTATGG - Intergenic
1194203797 X:90986098-90986120 AAGGAGCCGGAAAATTAACAAGG + Intergenic
1194524774 X:94966083-94966105 AATAAGCCTGATAAAGGTCAGGG - Intergenic
1196327436 X:114423878-114423900 ATGGAGCCAGAAAAAGGTGAAGG + Intergenic
1196480134 X:116138847-116138869 AAGAAACCTGAGAATGGACAAGG - Intergenic
1196726166 X:118897569-118897591 AATGAGCCAGAAAATGTTCAAGG + Intergenic
1198297100 X:135297804-135297826 AAGGAATCTGAAAATGATGAAGG + Intronic
1199388952 X:147256740-147256762 AACGAGACAGAAAATGGTCTTGG + Intergenic
1200421586 Y:2975534-2975556 AGTGAACCTGAAAATGATCATGG + Exonic
1200549631 Y:4561547-4561569 AAGGAGCCGGAAAATTAACAAGG + Intergenic
1201620239 Y:15948817-15948839 TAGGAGCCTTAAAAAGTTCAAGG + Intergenic
1201794596 Y:17881470-17881492 ATGGAGTCTGAAAAGGGGCAAGG - Intergenic
1201800850 Y:17953615-17953637 AAGGAGACTGAAAATATCCAAGG + Intergenic
1201806959 Y:18024515-18024537 ATGGAGTCTGAAAAGGGGCAAGG + Intergenic
1202355970 Y:24049250-24049272 ATGGAGTCTGAAAAGGGGCAAGG - Intergenic
1202360632 Y:24106129-24106151 AAGGAGACTGAAAATATCCAAGG + Intergenic
1202510146 Y:25563989-25564011 AAGGAGACTGAAAATATCCAAGG - Intergenic
1202514808 Y:25620859-25620881 ATGGAGTCTGAAAAGGGGCAAGG + Intergenic