ID: 915231390

View in Genome Browser
Species Human (GRCh38)
Location 1:154448180-154448202
Sequence CTGTTCTTGTAAAAGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915231385_915231390 -7 Left 915231385 1:154448164-154448186 CCATGCAGGTGAGCTCCTGTTCT 0: 1
1: 0
2: 0
3: 20
4: 184
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196
915231381_915231390 -1 Left 915231381 1:154448158-154448180 CCACCCCCATGCAGGTGAGCTCC 0: 1
1: 0
2: 3
3: 21
4: 257
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196
915231378_915231390 21 Left 915231378 1:154448136-154448158 CCTCCAGCTGAGAACGAGGTGTC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196
915231382_915231390 -4 Left 915231382 1:154448161-154448183 CCCCCATGCAGGTGAGCTCCTGT 0: 1
1: 0
2: 1
3: 22
4: 195
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196
915231376_915231390 29 Left 915231376 1:154448128-154448150 CCAGGAGTCCTCCAGCTGAGAAC 0: 1
1: 1
2: 0
3: 16
4: 179
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196
915231384_915231390 -6 Left 915231384 1:154448163-154448185 CCCATGCAGGTGAGCTCCTGTTC 0: 1
1: 0
2: 1
3: 9
4: 107
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196
915231379_915231390 18 Left 915231379 1:154448139-154448161 CCAGCTGAGAACGAGGTGTCCAC 0: 1
1: 0
2: 0
3: 11
4: 66
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196
915231383_915231390 -5 Left 915231383 1:154448162-154448184 CCCCATGCAGGTGAGCTCCTGTT 0: 1
1: 0
2: 1
3: 39
4: 505
Right 915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG 0: 1
1: 1
2: 0
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915231390 Original CRISPR CTGTTCTTGTAAAAGGGTCA GGG Intronic
900968833 1:5978024-5978046 CTGCTCTGGTTGAAGGGTCAGGG - Intronic
902102906 1:14008094-14008116 CACTTCTTGTAAAAAGGTCAAGG + Intergenic
906926208 1:50119694-50119716 CTGTTCTTGGGAAATGGACATGG - Intronic
907389501 1:54148728-54148750 CTGTTGTACTAAAAGAGTCAAGG + Intronic
908608651 1:65829984-65830006 CAGTTCTTCTAAAAGGAACAAGG + Intronic
908728506 1:67202035-67202057 ATGTAGTTGTAAAAGGCTCAAGG - Intronic
911846419 1:102757564-102757586 CTGTTCTTGTAAAAGGCTCACGG - Intergenic
912014819 1:105019426-105019448 CTGTTCTTGTACCAGTATCAAGG + Intergenic
912108273 1:106307547-106307569 GTGTTCTTTTAAAGGTGTCATGG - Intergenic
915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG + Intronic
918693081 1:187507078-187507100 CTGTTCTTCTGAAAGGGTCTTGG + Intergenic
921200850 1:212804628-212804650 TTGCTCTTGTAAAAGGTTGATGG - Exonic
921813798 1:219544365-219544387 CTTGTCCTATAAAAGGGTCATGG - Intergenic
923598374 1:235378926-235378948 TTGTGCTTGCAAAAGGGGCACGG + Intronic
1063047095 10:2403434-2403456 CTGTTCTTCTTAAAGATTCAAGG - Intergenic
1063742894 10:8844202-8844224 GTGTTCTTCTAGAAGGGTCTAGG + Intergenic
1063761888 10:9088238-9088260 CTGATCTTGTAAGAGTGTCTGGG - Intergenic
1064561078 10:16596028-16596050 CTACACTTTTAAAAGGGTCACGG + Intronic
1065666757 10:28071384-28071406 GTGTTTTTATACAAGGGTCAGGG - Intronic
1068419787 10:56776190-56776212 CTGTTCTTCTAATTGGGTTAGGG + Intergenic
1071148638 10:82606395-82606417 CTGTTCTTTTAAATGTGTTAAGG + Intronic
1072789973 10:98310978-98311000 CTGTTCTAATAGAAGGGTCGAGG - Intergenic
1075620047 10:123920044-123920066 CTGCTGTTGGAAAAGGGGCATGG - Intronic
1077075866 11:701838-701860 ATGTTCTTGTACAAGATTCAAGG + Intronic
1078633747 11:13030073-13030095 CTGTAGTTGTAAAAGGATGAAGG + Intergenic
1081026412 11:38019963-38019985 CTGTTCTTGAAGAGGGGGCAAGG - Intergenic
1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG + Intronic
1081967415 11:47178093-47178115 CTGTTCCTGCAACTGGGTCAAGG + Intronic
1083094896 11:60240739-60240761 CTATTCTTGTAAGGTGGTCATGG - Intronic
1087966672 11:104423242-104423264 CTGTGTTTGTAAAAGGAACAGGG + Intergenic
1089714285 11:120341715-120341737 CTATTCTTGAAAATGTGTCATGG - Intronic
1090392449 11:126397870-126397892 CTGTTCTCATGAATGGGTCAAGG - Intronic
1090632595 11:128663106-128663128 ATGTGCTTGTAAAAAGGTCTGGG - Intergenic
1091263128 11:134249693-134249715 CTATTCCTGTAAAAGGGGGATGG + Intronic
1093015390 12:14149753-14149775 TTGTTGCTTTAAAAGGGTCAAGG - Intergenic
1095403387 12:41840593-41840615 CTCTCCTTGTAAAAGTGCCAAGG + Intergenic
1095502446 12:42855324-42855346 CTGTTCTTTGAAAGGGGCCAGGG + Intergenic
1098399287 12:70056078-70056100 CTGCTGTTGTAAAAGTCTCATGG + Intergenic
1098534050 12:71574789-71574811 TTGTTCTTGTGAAATGGGCAGGG - Intronic
1107719234 13:43230393-43230415 CTGTTGCTGGAAAGGGGTCATGG + Intronic
1107740890 13:43449263-43449285 GGTTTCTTGGAAAAGGGTCAAGG + Intronic
1108271797 13:48769014-48769036 TTGTTCCTTTAAAAGTGTCATGG + Intergenic
1113177790 13:107585706-107585728 CTGTTCTTGGATAATAGTCAAGG + Intronic
1115418681 14:33167076-33167098 CTATTCTTCTAAGAGGCTCAAGG - Intronic
1117450215 14:55842717-55842739 TTGTTCTTTTAAAAGCTTCAGGG - Intergenic
1118329922 14:64807309-64807331 CTGTGCTTGGCAAAGGGTAAGGG + Intronic
1120077003 14:80170082-80170104 GTGTTCTTGTGAAAGGGACATGG + Intergenic
1120522914 14:85545802-85545824 CAGTGCTGGTAAAAGGGTAAGGG - Intronic
1121799419 14:96761289-96761311 CTATTTTTCGAAAAGGGTCAGGG + Intergenic
1123570930 15:21608127-21608149 TTTGTCCTGTAAAAGGGTCATGG + Intergenic
1123607043 15:22043479-22043501 TTTGTCCTGTAAAAGGGTCATGG + Intergenic
1125271482 15:37943496-37943518 CTGTTCTTGGAAAATGCGCATGG - Intronic
1127270360 15:57395524-57395546 CTGTTCTTATTAACGAGTCAAGG - Intronic
1129575168 15:76735364-76735386 CTGTTCTTTTAAATGAGACAGGG - Intronic
1129917248 15:79284435-79284457 CTTTCCTTGCAAAAGTGTCAGGG + Intergenic
1130275438 15:82473749-82473771 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1130467798 15:84201144-84201166 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1130485885 15:84398324-84398346 ATGTTCTTGGAAGAGGGTCACGG + Intergenic
1130496467 15:84472398-84472420 ATGTTCTTGAAAGAGGGTCACGG + Intergenic
1130590090 15:85205742-85205764 ATGTTCTTGAAAGAGGGTCACGG - Intergenic
1202979282 15_KI270727v1_random:335246-335268 TTTGTCCTGTAAAAGGGTCATGG + Intergenic
1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG + Exonic
1134014290 16:10877879-10877901 GTGTTGTTTAAAAAGGGTCAGGG + Intronic
1136449252 16:30343380-30343402 CTGTTCTGGGAGCAGGGTCAGGG + Intergenic
1141455751 16:84140755-84140777 CTGTTTTGTTAAAAGAGTCAGGG - Intronic
1149585467 17:57783247-57783269 CTGCTCTGGTGAAAGGGTCGTGG - Intergenic
1149929678 17:60738766-60738788 TTTTTCTTGTGAAAGGGTCTTGG + Intronic
1150074241 17:62179170-62179192 CTGCTCATGGAAAAGGATCAGGG - Intergenic
1150565285 17:66333610-66333632 CTGTGCTTGTGAAGGGGTCTGGG + Intronic
1150874748 17:68957672-68957694 CTGTTCTTGATTAAGTGTCATGG - Intergenic
1155018317 18:21869635-21869657 CTTTTCTGGTAACAGTGTCACGG - Exonic
1156258914 18:35426468-35426490 CTGTTAGTGTAAGAGGATCATGG - Intergenic
1157183178 18:45515844-45515866 CTGTTCTTGTAAATGAAGCAGGG + Intronic
1157525544 18:48377601-48377623 CTGTTGTTCTAAAAGGGTTTGGG - Intronic
1158419091 18:57276922-57276944 CTGTTCTGGTAACTGGGTCTGGG + Intergenic
1159035795 18:63276007-63276029 CTGTTATTGTAAAGGGTTTAGGG + Intronic
1164078814 19:21845103-21845125 CTCTTCTTGTAAGATGGGCACGG + Intronic
1165595008 19:37005797-37005819 CTGTTCAAGGAAAAGTGTCAGGG + Intergenic
1168010390 19:53526273-53526295 CTGTTCTTATAAAATGGGCTTGG + Intronic
1202646615 1_KI270706v1_random:147766-147788 CTTTTCTTGTGCAAGGATCATGG - Intergenic
926636659 2:15187404-15187426 TTGTTATTGTAATGGGGTCAGGG + Intronic
928248530 2:29653536-29653558 CTTTGTCTGTAAAAGGGTCATGG + Intronic
929042726 2:37761173-37761195 TGGTTCTTATAAAAGGGTCTGGG - Intergenic
929422046 2:41801642-41801664 CTATTCTTTTAAATTGGTCAAGG + Intergenic
933558964 2:83867977-83867999 TAGTTCTTGGAAAGGGGTCAAGG - Intergenic
934509768 2:94928185-94928207 CTTTTCTTGTGCAAGGATCATGG - Intergenic
936280238 2:111132983-111133005 CAGTTCTTTTAAATGTGTCAAGG + Intronic
936961289 2:118077575-118077597 CTGTTCTTGTGATACTGTCATGG + Intergenic
937447038 2:121967185-121967207 CTGTTCTTGCAATAGAGTTATGG - Intergenic
937620729 2:123981907-123981929 CTGTTCTTATATAAGGATCATGG + Intergenic
938765678 2:134459423-134459445 CTGTTCCTGTAACAGGAACAAGG + Intronic
942204405 2:173605118-173605140 CTTTTCTTGAAATAGGGTCTGGG + Intergenic
943436434 2:187869842-187869864 CTGTTCTTCTGTTAGGGTCATGG - Intergenic
943611975 2:190044937-190044959 CTGCTTTTGTAAGAGGGTCCTGG - Intronic
944463661 2:199978718-199978740 CAGTTCCTGCAAAAGTGTCAGGG - Intronic
944542534 2:200767337-200767359 GTGTCCTTGTAAGAGGGCCATGG - Intergenic
945271214 2:207942333-207942355 ATTTTTTTGTAAAAGAGTCAGGG - Intronic
1172708555 20:36901928-36901950 TTGTTCTTGTCAAAGGCTTAGGG - Intronic
1174061093 20:47833620-47833642 CTGTTCTAGTGTGAGGGTCATGG + Intergenic
1174061103 20:47833674-47833696 CTGTTCTAGTGTGAGGGTCATGG + Intergenic
1174070673 20:47897025-47897047 CTGTTCTAGTGTGAGGGTCATGG - Intergenic
1174070683 20:47897079-47897101 CTGTTCTAGTGTGAGGGTCATGG - Intergenic
1174100405 20:48122597-48122619 CTGTTCTAGTTTGAGGGTCATGG + Intergenic
1174100416 20:48122650-48122672 CTGTTCTAGTGTGAGGGTCATGG + Intergenic
1174100426 20:48122704-48122726 CTGTTCTAGTGTGAGGGTCATGG + Intergenic
1174149015 20:48473058-48473080 CTGTTCTAGTTTGAGGGTCAGGG - Intergenic
1174149080 20:48473467-48473489 CTGTTCTAGTTTGAGGGTCATGG - Intergenic
1174149390 20:48475495-48475517 CTGTTCAAGTATAAGGGTCATGG - Intergenic
1174149543 20:48476439-48476461 CTGTTCCTGTTTGAGGGTCATGG - Intergenic
1174149621 20:48476890-48476912 CTGTTCTAGTTTGAGGGTCATGG - Intergenic
1174153376 20:48501577-48501599 CTGTTCTAGTTTGAGGGTCATGG + Intergenic
1174153386 20:48501631-48501653 CTGTTCTAGTGTGAGGGTCATGG + Intergenic
1174890341 20:54385074-54385096 CTGTTATTGTAATAAAGTCAGGG - Intergenic
1176605257 21:8824998-8825020 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1177292913 21:19138655-19138677 CTGTTATTTGAAAAGGGTGATGG + Intergenic
1178234553 21:30825656-30825678 CTGCTCTTATAATAGAGTCAGGG - Intergenic
1180347551 22:11716603-11716625 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1182346947 22:29673120-29673142 CATTTCTTGTCAGAGGGTCATGG + Intronic
1184061720 22:42087025-42087047 CTGATCTTTTAAATTGGTCAGGG + Intronic
1203294908 22_KI270736v1_random:32663-32685 TGGTTCTTATAAAAGGGTCTGGG - Intergenic
952693102 3:36233342-36233364 ATGATCTTGTAACAGGGTCTAGG - Intergenic
953121107 3:40043468-40043490 CTGTTCTTTTAAAAAGCTCCTGG - Intronic
955264677 3:57430227-57430249 CTGTTTTTTTAAAAAGGTAATGG - Intronic
956482336 3:69685675-69685697 CTGTTATTAGCAAAGGGTCAAGG - Intergenic
957766038 3:84625171-84625193 GTGTTCTTGTCAAAGTGTCTAGG - Intergenic
958704321 3:97634653-97634675 CTGCTCGTGTAAAGGGGTCATGG - Intronic
960776103 3:121255869-121255891 ATATTCTGGTAAAAGGGGCAAGG - Intronic
962649407 3:137473505-137473527 CTGTACCTGTAAAAGCCTCAGGG - Intergenic
964384438 3:156132100-156132122 CTGTGCTTGAAACAGGGTTAGGG + Intronic
964394102 3:156227701-156227723 CTCTTCATGTAACAGGCTCAAGG + Intronic
965148474 3:164938544-164938566 CATTTCTTGGAAAAGGGCCATGG + Intergenic
966440447 3:179939007-179939029 CTGGTCTAGTAAATGGCTCAGGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968528147 4:1075104-1075126 CCTTTCTTGTAAATGGGCCATGG + Intronic
969886061 4:10216627-10216649 ATGTGCCTGTAGAAGGGTCAGGG - Intergenic
970636613 4:18017623-18017645 CTGTACTTTTAAAAATGTCAAGG + Intronic
971547390 4:27903544-27903566 GGGTTCTTGGATAAGGGTCAAGG + Intergenic
972556361 4:40185056-40185078 CTGTTATTTTTAAAGGGACATGG - Intergenic
973349162 4:49090604-49090626 CTGTTTTTGTAGAATGCTCAGGG + Intergenic
973372848 4:49265909-49265931 CTTTTCTTGTGCAAGGATCATGG - Intergenic
973388149 4:49529154-49529176 CTTTTCTTGTGCAAGGATCATGG + Intergenic
974776305 4:66487087-66487109 CTGCTCTTTTAAATGGGTCCAGG + Intergenic
976364704 4:84220504-84220526 TTGTTTTTGTTAAAGGGTAAAGG - Intergenic
978101639 4:104848565-104848587 CTGTACTTTTAAAAGTATCAAGG - Intergenic
979506240 4:121501002-121501024 CTGTTTTTGTTAAAGCGTTAAGG + Intergenic
980316676 4:131209839-131209861 CTGTTCATGTCAAGGGATCAGGG - Intergenic
980463145 4:133144476-133144498 CTGGGCTAGTAAAAAGGTCATGG - Intergenic
982009620 4:151094014-151094036 CTTTTTTGGTAAAAGGGTAAGGG + Intergenic
983148600 4:164247724-164247746 CTGTTTTTTCAAAATGGTCATGG + Intronic
988580828 5:32467392-32467414 CTGTTGTTGGAAAAGGGGAATGG + Intergenic
990081036 5:51913843-51913865 CTGTTCTTGTCAAAGTGGCCTGG + Intergenic
990582674 5:57180549-57180571 CTGATGTAGAAAAAGGGTCATGG + Intronic
991303317 5:65149766-65149788 CTGTTCTTTGAAAAGGCGCAAGG + Exonic
996135426 5:119836075-119836097 CTGTGCATGTAAAAGAGGCAGGG - Intergenic
996613612 5:125413465-125413487 CTCTTTTTATTAAAGGGTCAGGG + Intergenic
998280281 5:140800341-140800363 TAGTTCTTGAAAAAGGGGCATGG + Intronic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
999559211 5:152781862-152781884 CTGTTAGTGTAAAATGTTCATGG + Intergenic
999947842 5:156616727-156616749 CTGTTTTTATAAAGTGGTCAGGG - Intronic
1008192369 6:48475587-48475609 TTTTTCTTGTAAAAAGGTGAAGG + Intergenic
1008599448 6:53076274-53076296 CTTTTCTTCTAAAAGGTTTATGG + Intronic
1011307464 6:85944240-85944262 CTCATCTTTTAAAAGAGTCAGGG + Intergenic
1014653519 6:124070885-124070907 CTGTTTTTGTAACAGTGCCATGG - Intronic
1014947111 6:127512169-127512191 CTGTTCTTTTAGAAGACTCATGG + Intronic
1015963066 6:138670251-138670273 CTATTCATGTAAGAGGGTGAGGG - Intronic
1016995557 6:149960429-149960451 TTGTTCTTGGAAAGGGCTCAGGG + Intergenic
1017009377 6:150052989-150053011 CTGTTCTAGTTTGAGGGTCATGG - Intergenic
1017009619 6:150054429-150054451 CTGTTCTAGTGTGAGGGTCATGG - Intergenic
1018691183 6:166345428-166345450 GTCTTCTTGTAAAAGGGAAAGGG - Intergenic
1020490292 7:8774268-8774290 CTGTTTTTGTACAAGTGCCATGG + Intergenic
1022370773 7:29769292-29769314 CTGTTTTTGTACCAGGATCATGG - Intergenic
1023628974 7:42144270-42144292 CTGATCTTGTATCAGAGTCAGGG - Intronic
1024683995 7:51725255-51725277 CTGCTCTTCAAAACGGGTCAAGG + Intergenic
1028970463 7:96852898-96852920 CTGTTCTTGTAACAGGTGAATGG + Intergenic
1029102486 7:98143937-98143959 GTGTTCCTATAAAAGGATCAAGG + Intronic
1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG + Intronic
1034148753 7:148896624-148896646 TTCTTATTGTAAAAGAGTCAGGG - Intergenic
1035675503 8:1452869-1452891 CTGTTTTTGTAAAAGGGGGGTGG + Intergenic
1035963574 8:4165227-4165249 CTGTTCTTTTCAAAAGGACATGG + Intronic
1038163889 8:25066477-25066499 CTGTTCTCCTAAAATTGTCATGG + Intergenic
1038827609 8:31021915-31021937 CTGCTCTTTTAAAATGGTCATGG + Intronic
1038956242 8:32471430-32471452 CTTTTCTTATAAAAGGGTAGTGG + Intronic
1040941579 8:52839357-52839379 CTGTTCTCCTAAAAATGTCAAGG - Intergenic
1042445383 8:68878814-68878836 CAGCTCTTGTAAAAGGGTTTTGG - Intergenic
1042482920 8:69324021-69324043 CTGTTCTAGTTTGAGGGTCACGG + Intergenic
1043381505 8:79707148-79707170 CTGGTCTGGTAAATGTGTCATGG - Intergenic
1047661196 8:127038868-127038890 CTGTTCTTATAAAAGCTTCAGGG - Intergenic
1053348953 9:37399208-37399230 CTGCGCTTGTAAAAGGCCCACGG + Intergenic
1053514061 9:38714740-38714762 CTGTTCATTTAGAAGTGTCAAGG + Intergenic
1053655635 9:40216064-40216086 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1053905999 9:42845285-42845307 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1054352031 9:64026098-64026120 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1054367753 9:64362294-64362316 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1054528970 9:66160222-66160244 CTTTTCTTGTGCAAGGATCATGG - Intergenic
1054675370 9:67852034-67852056 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1056016405 9:82392828-82392850 CTCTTCTTGTAAAACTCTCAAGG + Intergenic
1058631893 9:106997553-106997575 GAGTTCTTGTAAAAGCTTCAAGG - Intronic
1060049955 9:120371498-120371520 CTGTTCTCCTAAAAGGCTCTGGG + Intergenic
1060161053 9:121364805-121364827 ATGTTGTTTTAAAAGGGTAAAGG - Intronic
1062486308 9:136778160-136778182 GTGTTCTAGTTTAAGGGTCATGG - Intergenic
1203696564 Un_GL000214v1:103931-103953 CTTTTCTTGTGCAAGGATCATGG - Intergenic
1203639709 Un_KI270751v1:132-154 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1186400889 X:9258397-9258419 ATGTTTGTGTAAAAGGGTCAGGG + Intergenic
1188896639 X:35677400-35677422 GTGTTCTTCTCAAAGGCTCAAGG - Intergenic
1189783373 X:44537316-44537338 CTGTTAGTGTAAAAGGGTACTGG - Intronic
1190449773 X:50567149-50567171 CTGGTCATGTAAAAGGGAGAGGG + Intergenic
1193424882 X:81329648-81329670 CTGTTCTTTAAAAAGGCTTAGGG - Intergenic
1195532185 X:105969553-105969575 TTTTACTTGTAAGAGGGTCAGGG - Intergenic
1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG + Intergenic
1198086071 X:133283734-133283756 CTGTTTTGGTAATAGTGTCATGG - Intergenic
1201153920 Y:11112668-11112690 CTTTTCTTGTGCAAGGATCATGG + Intergenic
1202191203 Y:22247816-22247838 CTGTTCTTTAAAATGGTTCAAGG - Intergenic
1202368385 Y:24181986-24182008 ATGTTCTTGAAAGAGGGTCATGG + Intergenic
1202502400 Y:25488131-25488153 ATGTTCTTGAAAGAGGGTCATGG - Intergenic