ID: 915235030

View in Genome Browser
Species Human (GRCh38)
Location 1:154474197-154474219
Sequence CACGTTTATCAGTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915235027_915235030 0 Left 915235027 1:154474174-154474196 CCTGGTATCCTCATGTGGTTTGT 0: 1
1: 0
2: 0
3: 8
4: 142
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73
915235017_915235030 30 Left 915235017 1:154474144-154474166 CCTGACCCACTCACCCCGGGAGG 0: 1
1: 0
2: 3
3: 14
4: 178
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73
915235023_915235030 17 Left 915235023 1:154474157-154474179 CCCCGGGAGGAGATGGACCTGGT 0: 1
1: 0
2: 1
3: 22
4: 149
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73
915235019_915235030 25 Left 915235019 1:154474149-154474171 CCCACTCACCCCGGGAGGAGATG 0: 1
1: 0
2: 0
3: 12
4: 119
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73
915235025_915235030 15 Left 915235025 1:154474159-154474181 CCGGGAGGAGATGGACCTGGTAT 0: 1
1: 0
2: 1
3: 10
4: 177
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73
915235020_915235030 24 Left 915235020 1:154474150-154474172 CCACTCACCCCGGGAGGAGATGG 0: 1
1: 0
2: 1
3: 15
4: 173
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73
915235024_915235030 16 Left 915235024 1:154474158-154474180 CCCGGGAGGAGATGGACCTGGTA 0: 1
1: 0
2: 1
3: 21
4: 206
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73
915235028_915235030 -8 Left 915235028 1:154474182-154474204 CCTCATGTGGTTTGTCACGTTTA 0: 1
1: 0
2: 0
3: 6
4: 93
Right 915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915235030 Original CRISPR CACGTTTATCAGTGTGAGCT GGG Intronic
910051916 1:82984936-82984958 CAGGTTCACCTGTGTGAGCTTGG - Intergenic
911150134 1:94590448-94590470 CAAGTTTATCATTTTGAACTAGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
915013853 1:152714855-152714877 CACTTCTAACTGTGTGAGCTTGG + Intergenic
915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG + Intronic
918790607 1:188822572-188822594 CAGGCTTATCAGTGAAAGCTGGG - Intergenic
923413994 1:233736877-233736899 CACTTTTATCTGTGTGACCTTGG + Intergenic
1066587711 10:36955760-36955782 CAAGTTTCTCACTGTGAGTTGGG - Intergenic
1069468623 10:68665205-68665227 CAAGTTGATCAATGTGAGGTAGG + Intronic
1070323265 10:75370997-75371019 CACTTTTCTCACTTTGAGCTAGG - Intergenic
1073814360 10:107189788-107189810 AACCTTTATCTGTGTGAGATTGG + Intergenic
1073829999 10:107372950-107372972 CATGTTTCTCAGAGTGTGCTTGG + Intergenic
1074265562 10:111899637-111899659 CACATTTAGCAGTGTGACTTTGG + Intergenic
1076484194 10:130805253-130805275 CAGGTTTATCAGAGGAAGCTAGG - Intergenic
1079521435 11:21331767-21331789 CTAGTTTATCAGAGTGAACTGGG - Intronic
1083620027 11:64044651-64044673 CACGTTCATTAGGGTGAACTTGG + Intronic
1083918767 11:65768495-65768517 CACCTTTACAAGTGTGAGCCAGG - Intergenic
1085900379 11:80692192-80692214 GAAGTTTCTCAGTGTGAGTTGGG + Intergenic
1086800355 11:91166385-91166407 CAGGTTGATCATTGTGAGCTAGG + Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1091145747 11:133278472-133278494 CACCTTTCTCACTGTCAGCTTGG + Intronic
1096541414 12:52309398-52309420 CACTATTGACAGTGTGAGCTGGG + Intergenic
1098251648 12:68576217-68576239 CATGTTTAACTGTGTGAGCATGG + Intergenic
1103499247 12:121388205-121388227 CACATTTATGAGTGAGATCTTGG + Intronic
1105328649 13:19393941-19393963 CAGGATCATCAATGTGAGCTGGG - Intergenic
1105863242 13:24435593-24435615 CAGGATCATCAATGTGAGCTGGG + Intronic
1111420516 13:88005100-88005122 CATGTTTATCATTGTGACCTGGG + Intergenic
1116050017 14:39790896-39790918 AACGTTCACCAGTGTGAACTGGG - Intergenic
1119557004 14:75560984-75561006 CACGTTTAACTGTGTGACCTTGG - Intergenic
1121246751 14:92466124-92466146 CACTTCTAGCTGTGTGAGCTTGG + Intronic
1121966353 14:98310153-98310175 CAACTTTATCTGTGTGACCTTGG - Intergenic
1124654389 15:31496829-31496851 CAAGTTTATAAGTGTCTGCTAGG - Intronic
1128951832 15:71893011-71893033 CAAGCTTCTCACTGTGAGCTAGG - Intronic
1130928745 15:88405150-88405172 GACTTTGATCAGTGGGAGCTGGG - Intergenic
1133869626 16:9675143-9675165 GACGGTTATCAGCGTGAGATTGG + Intronic
1133939477 16:10296440-10296462 CACGTTTATTAGCATGTGCTGGG + Intergenic
1135934260 16:26766295-26766317 CACATTTAAAAGTGTGGGCTGGG + Intergenic
1139021568 16:62756252-62756274 TATCTTTATCAGTGTGAGCACGG + Intergenic
1148637791 17:49162357-49162379 CACTTTTCTCAGTGTGAGAGTGG - Intronic
1149996883 17:61410297-61410319 CACTTCTAGCAGTGGGAGCTGGG + Intergenic
1155834545 18:30563639-30563661 CTAATTTATCTGTGTGAGCTTGG + Intergenic
1165987977 19:39787249-39787271 CACCTTTTTCTCTGTGAGCTAGG - Intergenic
935232718 2:101112976-101112998 CACGGGTATCAGAGTGCGCTGGG - Intronic
937667548 2:124503938-124503960 CACGTTCCACATTGTGAGCTTGG + Intronic
937877357 2:126835754-126835776 TAGGATTATCTGTGTGAGCTTGG + Intergenic
938707614 2:133945826-133945848 CACGTTTTTCAGTGTGGCATGGG - Intergenic
941405055 2:165076848-165076870 CATGTTCATCACTGTCAGCTGGG + Intergenic
943421978 2:187676460-187676482 CACGTATATCAGTGTGTGCCAGG - Intergenic
945738421 2:213630505-213630527 AACATTTATCAGTGTGGGCTGGG + Intronic
1178786826 21:35661421-35661443 CAGGTTGATCTTTGTGAGCTCGG + Intronic
950643681 3:14364503-14364525 CCTGTTTATGAGTATGAGCTAGG - Intergenic
956258211 3:67307372-67307394 CACATCTATCAGTATGAACTGGG + Intergenic
958819736 3:98959399-98959421 CACTTTTATCAGTGGCAGCATGG - Intergenic
962478082 3:135774461-135774483 CACATATATCTGTGTGATCTAGG - Intergenic
963109747 3:141678116-141678138 CATATTTATCAGTCTGAGATAGG + Intergenic
973552011 4:52045046-52045068 AAAGTTTATCAGTTTAAGCTGGG + Intergenic
974396623 4:61344606-61344628 CAAGTTTTACAGTGTGAGATTGG + Intronic
977124889 4:93152927-93152949 CATGTTTATCAGTGTTTACTTGG + Intronic
979193426 4:117891163-117891185 CTCGCTTATAAGTGGGAGCTAGG - Intergenic
988448025 5:31310310-31310332 CTCCTTTATCAGTGTGCCCTAGG - Intronic
1000118830 5:158177667-158177689 ATAGTTTTTCAGTGTGAGCTGGG + Intergenic
1003570530 6:7253647-7253669 CACATTTATATGTGGGAGCTTGG + Intergenic
1009572763 6:65409579-65409601 CACGTATATCATTTTTAGCTAGG - Intronic
1010284597 6:74060710-74060732 CAAGTTTATCGGTTTGAGCATGG + Intergenic
1014956642 6:127626754-127626776 CACCCTTATCATTGTTAGCTGGG + Intergenic
1025156985 7:56615871-56615893 CATTTTTATCCCTGTGAGCTGGG + Intergenic
1027158194 7:75783313-75783335 GGCGGTTATCAGTGTGAGATTGG - Intronic
1031569461 7:123341137-123341159 CACTTTTTCCAGTGTGAGTTGGG + Intergenic
1035187099 7:157134865-157134887 CACGTTGATCAGGCTGATCTTGG - Intergenic
1036278999 8:7382999-7383021 CTCATTTATAAGTGGGAGCTAGG - Intronic
1036342521 8:7928871-7928893 CTCATTTATAAGTGGGAGCTAGG + Intronic
1037063559 8:14546880-14546902 CTTGTTCATCAGTGTGACCTTGG + Intronic
1039096465 8:33892008-33892030 CACTATTATCTGTGTGACCTGGG - Intergenic
1039312662 8:36335128-36335150 CACTTTTATCAGTGTTAGCACGG - Intergenic
1044699830 8:94955880-94955902 CAGGTGTATCAGTGTGTGCTAGG - Intronic
1046600781 8:116314970-116314992 CTCTTGTATCAGTGTGACCTGGG - Intergenic
1047634873 8:126750361-126750383 CACATGTATTAGTGTGATCTTGG - Intergenic
1056765395 9:89441800-89441822 GAAGTTTAACAGTGTGGGCTGGG - Intronic
1058626311 9:106936758-106936780 CACTTTTACCAGCGAGAGCTGGG + Intronic
1058937808 9:109785393-109785415 CACCTCTATCTGTGTAAGCTTGG - Intronic
1196120171 X:112041535-112041557 CACCATTAACTGTGTGAGCTTGG - Intronic
1199531554 X:148853605-148853627 CACTATTACCTGTGTGAGCTGGG - Intronic