ID: 915235297

View in Genome Browser
Species Human (GRCh38)
Location 1:154475993-154476015
Sequence TCTCCATTTTAAAACGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915235294_915235297 14 Left 915235294 1:154475956-154475978 CCAGCCCATTGTATTAGTTTCTA 0: 1
1: 0
2: 1
3: 25
4: 354
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235295_915235297 10 Left 915235295 1:154475960-154475982 CCCATTGTATTAGTTTCTAAAAA 0: 1
1: 0
2: 4
3: 69
4: 618
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235293_915235297 15 Left 915235293 1:154475955-154475977 CCCAGCCCATTGTATTAGTTTCT 0: 1
1: 0
2: 4
3: 42
4: 424
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235292_915235297 23 Left 915235292 1:154475947-154475969 CCACTGTGCCCAGCCCATTGTAT 0: 2
1: 25
2: 275
3: 1580
4: 7729
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235296_915235297 9 Left 915235296 1:154475961-154475983 CCATTGTATTAGTTTCTAAAAAA 0: 1
1: 0
2: 3
3: 64
4: 669
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915235297 Original CRISPR TCTCCATTTTAAAACGTGCA AGG Intronic
903160673 1:21486945-21486967 CCTCCATTTAAAAAGGTGAAGGG - Intergenic
906522914 1:46477801-46477823 TCTCTATTTGAAATCCTGCAAGG + Intergenic
906545121 1:46615083-46615105 TCTCCATTTTAAACTCTGCTTGG + Exonic
907063185 1:51451740-51451762 TCTTCATTTTAAAGCATTCAAGG + Intronic
913500368 1:119467394-119467416 GCTACATTTTAAACCTTGCATGG + Intergenic
913511207 1:119564239-119564261 GCTCCATTTTAAACCCTGCATGG + Intergenic
915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG + Intronic
916093454 1:161327530-161327552 ACTCCATCTTAAAACTAGCAAGG - Intronic
916698778 1:167268713-167268735 TCTCCTTTTAAAAACCTACAGGG + Intronic
918092726 1:181311300-181311322 TCTCCATTTAAAAAATTGCTTGG + Intergenic
918650783 1:186960451-186960473 CCTACAATTTAAAACGTACAAGG - Intronic
921784798 1:219217538-219217560 TCTTCATTCTAAATCATGCAAGG + Intergenic
921808381 1:219481501-219481523 TTTCCATTTTAAAAGTTGGAAGG + Intergenic
922367128 1:224876404-224876426 TATCAATATTAAAACCTGCAGGG - Intergenic
923412432 1:233723671-233723693 TCTCCTTTTTTAAGCTTGCATGG + Intergenic
924314766 1:242784462-242784484 TCTCTATTTTAGAACATCCAGGG + Intergenic
1062855298 10:777135-777157 TCACCTTTCTAAAACGGGCATGG - Intergenic
1064184688 10:13151249-13151271 TCTGCATTTTAAAAAGTGCAAGG - Intergenic
1064679585 10:17796493-17796515 TCTCCATTTTAAAAAGGAAATGG + Exonic
1064855974 10:19767464-19767486 ACTCCATCTTAAAACTAGCAAGG + Intronic
1065505334 10:26424724-26424746 CCTCCATCTTAAAACTAGCAGGG + Intergenic
1068292925 10:55029091-55029113 CCTCAATTTTCAAACGTACAGGG - Intronic
1068907203 10:62340073-62340095 TCCCCATTTTAGAACATGTAGGG + Intergenic
1070644701 10:78193658-78193680 TCTCCTCTTTAAAACGGGCATGG - Intergenic
1072720346 10:97776841-97776863 TCTCAATTTTTAAGAGTGCAAGG + Intergenic
1073992940 10:109284275-109284297 TATCCATGTTAATACGTTCATGG - Intergenic
1076024096 10:127098396-127098418 TTTCCATGTCAACACGTGCATGG + Intronic
1077639614 11:3869702-3869724 TCCCCTTGTCAAAACGTGCAAGG - Intronic
1080883425 11:36343867-36343889 TCTACATTGTAAAAAGAGCATGG - Intronic
1085365736 11:75941911-75941933 TCTCCTTTTTAAAAATTACATGG - Intronic
1085542124 11:77281379-77281401 TCTCCATTTCAAACTGTGCGAGG - Intronic
1086562623 11:88185875-88185897 TCTACTTTTTAAAAAGTGCTAGG + Intergenic
1088613982 11:111604175-111604197 TCTTCATTTTAAAAAATGCTGGG - Intronic
1089135556 11:116246291-116246313 TCTCCACTCTCAAACATGCATGG + Intergenic
1089932170 11:122324026-122324048 TCTCCATTGCAAAACGAGAAGGG - Intergenic
1090904399 11:131062599-131062621 TCAGCATTTTTATACGTGCAGGG - Intergenic
1092891401 12:12972468-12972490 ACTCCATTTTATGACCTGCAAGG - Intergenic
1093263317 12:16968470-16968492 TTTCCTTTTTAAAATGTGAATGG - Intergenic
1093932918 12:24972133-24972155 ACTCCATCTTAAAACCAGCAAGG + Intergenic
1094797835 12:33997126-33997148 TTTCCATTCTAAAAGGTGCTTGG - Intergenic
1097545355 12:60993463-60993485 TCTCCATCTTTAAAATTGCAGGG - Intergenic
1099026507 12:77470783-77470805 TCTCCCTTTTAAAACATTCCAGG - Intergenic
1099939057 12:89163313-89163335 TCTCCCTTTTGAAAGGTGGATGG + Intergenic
1100640428 12:96477178-96477200 ACTCCATCTTAAAACTTACAAGG - Intergenic
1100642675 12:96497546-96497568 ACTCCATTTTAAAATTAGCAAGG + Intronic
1101743959 12:107523701-107523723 TCTACATTTTAATACGTACTCGG + Intronic
1107066292 13:36217123-36217145 TCCCTATTTGAAAACGTACAAGG + Intronic
1107436616 13:40386000-40386022 TCTCCATTTTCAAAAGGGGAAGG - Intergenic
1109608034 13:64723960-64723982 TCTCCATTTCAAAACATTCCAGG + Intergenic
1109651398 13:65331456-65331478 TCTCTATTCTAAAATGTGTATGG + Intergenic
1112125997 13:96469174-96469196 TCTGCATTACAAAACATGCATGG - Intronic
1112718114 13:102210497-102210519 GCTTCATTTAAAAATGTGCAAGG + Intronic
1116343030 14:43751149-43751171 ACTCCATCTTAAAACTAGCAAGG - Intergenic
1116803100 14:49464020-49464042 TCTCCATTCCCAAACTTGCAGGG - Intergenic
1117112090 14:52468575-52468597 ACTCCATTTTAAAAAGTGAGTGG + Intronic
1119999249 14:79283887-79283909 TCCATATTTTAAAAAGTGCAAGG + Intronic
1124116619 15:26849397-26849419 TGTCCATTTTACAAAGAGCAAGG + Intronic
1125063294 15:35451097-35451119 TCTCATTTTTAAAACTTTCATGG + Intronic
1125124519 15:36204321-36204343 ACTCAATTTAAAAAAGTGCAAGG + Intergenic
1126152117 15:45532845-45532867 TCTCCATTTTAGACCATGTAGGG + Intergenic
1127842942 15:62846278-62846300 TCTCCATTTTATAGCCAGCAAGG + Intergenic
1127850468 15:62907600-62907622 GCTTCATCTTAAAACGAGCAAGG + Intergenic
1128641699 15:69343132-69343154 TTTCCATTTTAAAGCAAGCATGG + Intronic
1129647079 15:77446068-77446090 TCTGGATTTTCAAACGTGTAAGG + Intronic
1130945396 15:88547019-88547041 ACTCCATCTTAAAACTAGCAAGG - Intergenic
1132283156 15:100638098-100638120 TCTCCAATTTTAAAAGTGCAAGG + Intronic
1133195579 16:4167653-4167675 TTTGGATTTTAACACGTGCAGGG + Intergenic
1134209439 16:12263578-12263600 TGTCCATTTTTAAATGTGTATGG - Intronic
1134509489 16:14834598-14834620 TCTCCATTTTCAGAAGTGGAGGG - Intronic
1134697194 16:16233413-16233435 TCTCCATTTTCAGAAGTGGAGGG - Intronic
1134974652 16:18561272-18561294 TCTCCATTTTCAGAAGTGGAGGG + Intronic
1135399667 16:22157591-22157613 TGTCCATTTTAAAAATTGGATGG - Intergenic
1135690611 16:24534275-24534297 ACTCCATCTTAAAACTAGCAAGG + Intergenic
1139159029 16:64480647-64480669 ACTCCATCTTAAAACTGGCAAGG - Intergenic
1140746534 16:77985508-77985530 TCTCCATTTTAATAGGAGAAAGG - Intergenic
1141547069 16:84777276-84777298 TCTCCATTCTAAAATGTCAAGGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1146100032 17:29972370-29972392 TCCCCATTTTAAAAGGAGCCAGG - Intronic
1153495972 18:5700082-5700104 TCTCGCTTTTAAAAAGTGCATGG + Intergenic
1153870076 18:9310194-9310216 TCTACATTTTAAAAAGTAAAAGG + Intergenic
1155216638 18:23648939-23648961 TATCCTTTTTAAAACATCCAAGG - Intronic
1155423032 18:25676167-25676189 TTTCCATGTTAAGACTTGCATGG - Intergenic
1155863672 18:30936658-30936680 TTGCCATTTTAACAGGTGCAAGG + Intergenic
1157587566 18:48814539-48814561 TCCCCATTTTAAAATGAGAATGG + Intronic
1159219948 18:65447704-65447726 TATTCATTTTAAAACATGAAAGG - Intergenic
1159505037 18:69325728-69325750 GCTCCATCTTAAAATTTGCAAGG + Intergenic
1159884957 18:73894998-73895020 TCTCCAACCTAAAATGTGCACGG - Intergenic
1162846443 19:13396412-13396434 TCTCCATTCCATAACATGCATGG + Intronic
1163674959 19:18651086-18651108 TTCACATTTTAAAAAGTGCAAGG + Intronic
925688181 2:6494260-6494282 TTTCCATTTCAAAACACGCAGGG + Intergenic
927851504 2:26503030-26503052 TCTCCATTTAAGAAGGTGAAGGG + Intronic
928122894 2:28596431-28596453 TCTTCATTTTAAAACAAGTATGG - Intronic
929283756 2:40112805-40112827 TCTCCATTTTAAACCAAGAAGGG - Intronic
931541251 2:63331548-63331570 TCACCACTTTAAACAGTGCAAGG + Intronic
932459570 2:71873512-71873534 TTTTCTTTTTAAAACCTGCATGG - Intergenic
932845705 2:75134058-75134080 TCCCCTTTTTAGACCGTGCAGGG - Intronic
933514106 2:83279007-83279029 TCTTCATTTTGGAACTTGCATGG + Intergenic
933594667 2:84271228-84271250 TCTACATTTTGAAATTTGCATGG - Intergenic
934231955 2:90191801-90191823 TCTGCATTTTAACAAGTGTAGGG + Intergenic
934846764 2:97666230-97666252 ACTCCATCTTAAAACTAGCAAGG - Intergenic
936018708 2:108978735-108978757 TCTCCATACCAAAACCTGCACGG - Intronic
936268244 2:111027808-111027830 ACTCCATCTTAAAACTAGCAAGG - Intronic
936388533 2:112052894-112052916 ACTCCATCTTAAAACTAGCAAGG - Intergenic
937276777 2:120689931-120689953 TCTGCTTTTTAAAATCTGCAGGG - Intergenic
937342109 2:121097695-121097717 ACTCCATGTTAAAACTAGCAAGG + Intergenic
937741185 2:125356586-125356608 ACTCCATCTTAAAACCAGCAAGG + Intergenic
938594918 2:132778735-132778757 TCTGAATTTTAAAAGGTTCATGG + Intronic
939329404 2:140737951-140737973 TCTGCATTGGAAAAAGTGCATGG - Intronic
939750428 2:146038227-146038249 TTTACATTTTAAAATTTGCATGG + Intergenic
942409825 2:175697342-175697364 TGTCCATCTTAAAAAGTACAGGG - Intergenic
943429524 2:187781766-187781788 TCTACATTTCAAAAATTGCAAGG - Intergenic
943778810 2:191798408-191798430 TCTGCATTTTAAATTGTTCAGGG + Intergenic
944273657 2:197810519-197810541 TCTCCATTGTAAAAAGGGAAAGG - Intronic
944665100 2:201953272-201953294 TCTGCATTTTAACAAGTGCCAGG - Intergenic
945891367 2:215435023-215435045 TCACATTTTTAAAACATGCAAGG + Intronic
946535952 2:220628465-220628487 TCTGCATTTTAAAAAGTCCCTGG - Intergenic
946596686 2:221313377-221313399 TCTTAATTCTAAAATGTGCAAGG + Intergenic
948742910 2:240059884-240059906 ACTCCATCTTAAAACTAGCAAGG - Intergenic
948871308 2:240799633-240799655 TTTCCAGTTTTAAAAGTGCAGGG - Intronic
1169051497 20:2582383-2582405 GCTTCATTTTAAAACATCCATGG - Intronic
1176298976 21:5089609-5089631 TCTCCTTTTTAGACCGTGCAGGG - Intergenic
1177162984 21:17568870-17568892 TTTCCATTTTAGAAAGTCCATGG - Exonic
1177331835 21:19674520-19674542 TCTCTATTTTATAAAGGGCAAGG - Intergenic
1179858050 21:44172340-44172362 TCTCCTTTTTAGACCGTGCAGGG + Intergenic
1182039794 22:27228546-27228568 TCTCCATTATAAAATGAGAATGG - Intergenic
1184673265 22:46026916-46026938 TGTCCCTTTTAAAAACTGCATGG - Intergenic
949971220 3:9406777-9406799 GCTCCATCCTAAAATGTGCAGGG - Intronic
952813403 3:37425084-37425106 CCTCCATTTTAAAATGTGCCAGG + Intronic
953360231 3:42289250-42289272 TCTCCATTTGGAAACCTGTAGGG - Intergenic
953802206 3:46032814-46032836 TATCCATTCTAATACGTGCATGG + Intergenic
953910858 3:46892399-46892421 TCTCCATGTGAGAACGCGCACGG + Intronic
955097031 3:55809172-55809194 TATCAATTTTAAAAGGTACAGGG - Intronic
958544487 3:95525022-95525044 TTTCTATTTTAAAATTTGCATGG + Intergenic
959185612 3:103043240-103043262 AGGCCATTTAAAAACGTGCAAGG + Intergenic
959235373 3:103715044-103715066 TCGCCATTCTAAAACTTGTAAGG - Intergenic
964538826 3:157756714-157756736 TCTACATTTTACAAAGTGGAAGG + Intergenic
965327629 3:167327596-167327618 GCTTCATTTTAAAACATTCATGG + Intronic
966994735 3:185268465-185268487 ACTCCATCTTAAAACTAGCAAGG + Intronic
967702576 3:192610690-192610712 TGTCCATATTAGAACCTGCAAGG + Intronic
969154228 4:5196032-5196054 TCTCCATTTTAAACAATGAAAGG - Intronic
970082796 4:12307306-12307328 TCTCAATTTTAAAAAATGCTTGG - Intergenic
972674027 4:41241994-41242016 TCAACATTTTAAAACTTGCTTGG - Intergenic
973236090 4:47907455-47907477 TCTCAAATTTCAAACTTGCATGG - Intronic
973988032 4:56374812-56374834 TCTCCATTTTAAAATGGGGGTGG - Intronic
974521202 4:62982458-62982480 TCTACTTTTTAAAACTTTCATGG + Intergenic
975455773 4:74588115-74588137 TCTCAATTTTAAGATGTGCTGGG + Intergenic
975469269 4:74746610-74746632 TGTCCATTTTCAAATGAGCAAGG + Exonic
975664431 4:76720960-76720982 TTTCCTTTTTAAAATGTGAAAGG + Intronic
977585055 4:98765783-98765805 ACTCAATTTTAAAATGGGCAAGG - Intergenic
978227048 4:106349005-106349027 TCTGCCTTTTATAACATGCAGGG - Exonic
981847560 4:149186916-149186938 TGTCCATTTTAAAAACTGTATGG - Intergenic
983813716 4:172096736-172096758 TCTTTATTTTAAAACATGAATGG - Intronic
984187431 4:176562980-176563002 GCTTCATTTTAAAACGTGGTAGG + Intergenic
984647485 4:182234938-182234960 GCTGCATTTTAAAGGGTGCATGG + Intronic
984895131 4:184532479-184532501 TCTCCATTTTAAAAGTTGTTTGG - Intergenic
986678400 5:10210871-10210893 TCTCTATTTTAAAAAGAGAAAGG + Intergenic
987754468 5:22083193-22083215 TCTGGATTTTAATACGTGCAAGG - Intronic
988030742 5:25759750-25759772 ACTCCATCTTAAAACTAGCAAGG - Intergenic
989167063 5:38442811-38442833 ACTCCATCTTAAAACTAGCAAGG + Intronic
990148627 5:52790570-52790592 TCTCCATCTTCAACCGAGCAGGG + Intronic
992272429 5:75078922-75078944 ACTCCATTTTAAAACTTAAAAGG + Intronic
992848966 5:80784691-80784713 TCACCACTTTAAAATGTGGAGGG - Intronic
993312792 5:86357695-86357717 CCTCCATTTTCAAACTAGCAAGG + Intergenic
993930081 5:93927202-93927224 TCTGTATTTTAAAGCGTGCCTGG + Intronic
1005053260 6:21705423-21705445 ACTGAATTTTAAAACATGCAGGG - Intergenic
1009346272 6:62615599-62615621 CCTCCACTTTAAAACTTGCCTGG - Intergenic
1009478698 6:64128330-64128352 GCTCCATTTTAGAAAGTTCATGG - Intronic
1009894876 6:69735761-69735783 TTTCCATTTAAAAACTTCCAGGG + Intronic
1010568533 6:77449133-77449155 TCTCCAGTTTAGTACTTGCATGG + Intergenic
1011844645 6:91548373-91548395 TCTCCATTTGACCACGTGAATGG - Intergenic
1013077421 6:106783663-106783685 ACTTCATTTTCAAATGTGCAAGG + Intergenic
1016472887 6:144393333-144393355 TCTCAACTTTAAAATGTGCATGG + Intronic
1017777470 6:157691352-157691374 TCTGCCTTTTAAAATGAGCATGG + Intergenic
1019879699 7:3847682-3847704 TATCCTTTTTAAAATGTGCAAGG - Intronic
1023552219 7:41382693-41382715 TCTCCCTTTTAAAAGGATCAAGG + Intergenic
1030658353 7:112192541-112192563 TCTTCATTTTAAAGCTTGAAGGG + Intronic
1031516056 7:122700460-122700482 ACTACCTTTTAAAATGTGCAGGG - Intronic
1031784035 7:126006166-126006188 TCTCCATTTTATCACCTGCTTGG - Intergenic
1034484702 7:151351992-151352014 ACACCATTTTAAAACATACAAGG - Intronic
1035529479 8:339370-339392 TCTCCGTTTAAGAACCTGCATGG - Intergenic
1038149161 8:24927453-24927475 ACTCCATCTTAAAACTAGCAAGG + Intergenic
1038816597 8:30911642-30911664 TCACCATTTTTAAACTTGAAGGG + Intergenic
1038918959 8:32060835-32060857 GCTCCATTTTAAAACGTAACAGG - Intronic
1039089469 8:33812961-33812983 TCTCCATGTTAATACCTGCATGG + Intergenic
1039231744 8:35455969-35455991 TATCCCTTGTAAAAAGTGCAGGG + Intronic
1040116021 8:43620416-43620438 TCTCCAGTTCAAAACTTGAAAGG + Intergenic
1041724518 8:61005544-61005566 TCTCCTTTTTGCACCGTGCAGGG - Intergenic
1045755074 8:105533346-105533368 GCTCCATTTCAAAATGTGTAAGG + Intronic
1046211152 8:111078950-111078972 TCTCCACTTTAAATCGAACAAGG + Intergenic
1047074469 8:121384666-121384688 TCTCTAATTTAAAACGTGTGGGG - Intergenic
1048654527 8:136521217-136521239 ACCCCATTTTAAAAGGGGCAGGG - Intergenic
1049456590 8:142694802-142694824 ATTCCATTTTAAAACAAGCAAGG - Intergenic
1049505718 8:142996171-142996193 TCTTCATTTGAAAATGTGAAAGG + Intergenic
1053193685 9:36097483-36097505 TAGCCATTTTAACACGTGAAGGG - Intronic
1056250191 9:84739792-84739814 TCCCCGTTTTAAAACTTGTAAGG + Intronic
1056597792 9:88021821-88021843 TCTCCATTTTAAAGCTTTCTGGG + Intergenic
1057240777 9:93406650-93406672 ACTCCATCTTAAAACTGGCAAGG - Intergenic
1057342336 9:94214083-94214105 TTTGCATTTTGAAACGTGAATGG - Intergenic
1058762693 9:108150718-108150740 TCAGCATTTTAAAAGCTGCAGGG + Intergenic
1059253860 9:112910947-112910969 TCTCCATTTTCAAACTTCCCAGG - Intergenic
1060590758 9:124815134-124815156 TCTCCATTTTAATAGGAGAAAGG - Intergenic
1185522710 X:753771-753793 TCACCATTTTGCAAAGTGCAGGG + Intergenic
1187668017 X:21636879-21636901 TTTCCATTTTAAAATCTGAATGG + Intronic
1188521011 X:31037768-31037790 TCTGCATTTTAACAAGTGCCAGG - Intergenic
1188610666 X:32092499-32092521 TTTCTATTTTAAATAGTGCAGGG + Intronic
1188798230 X:34493164-34493186 TCTCCATCTTTAAACCAGCATGG + Intergenic
1192818399 X:74617623-74617645 CCTCCATTTCAAAATGTGCAAGG + Intergenic
1193416630 X:81232745-81232767 TTTCCTTCTTAAAACATGCAGGG + Intronic
1193737220 X:85173084-85173106 TCTCCATTTTTAAAAGTAGATGG + Intergenic
1198931270 X:141863642-141863664 TATTCATTTTAAAATATGCAAGG + Intronic
1199487344 X:148362560-148362582 TCTCCATCTTCAAACGTTCTTGG - Intergenic
1201614677 Y:15884149-15884171 ACTCCATCTTAAAACTAGCAAGG - Intergenic