ID: 915235297

View in Genome Browser
Species Human (GRCh38)
Location 1:154475993-154476015
Sequence TCTCCATTTTAAAACGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915235294_915235297 14 Left 915235294 1:154475956-154475978 CCAGCCCATTGTATTAGTTTCTA 0: 1
1: 0
2: 1
3: 25
4: 354
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235292_915235297 23 Left 915235292 1:154475947-154475969 CCACTGTGCCCAGCCCATTGTAT 0: 2
1: 25
2: 275
3: 1580
4: 7729
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235295_915235297 10 Left 915235295 1:154475960-154475982 CCCATTGTATTAGTTTCTAAAAA 0: 1
1: 0
2: 4
3: 69
4: 618
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235293_915235297 15 Left 915235293 1:154475955-154475977 CCCAGCCCATTGTATTAGTTTCT 0: 1
1: 0
2: 4
3: 42
4: 424
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197
915235296_915235297 9 Left 915235296 1:154475961-154475983 CCATTGTATTAGTTTCTAAAAAA 0: 1
1: 0
2: 3
3: 64
4: 669
Right 915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG 0: 1
1: 0
2: 1
3: 13
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915235297 Original CRISPR TCTCCATTTTAAAACGTGCA AGG Intronic