ID: 915238204

View in Genome Browser
Species Human (GRCh38)
Location 1:154501601-154501623
Sequence GGTGCTGCAGCCCGAGCTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915238198_915238204 21 Left 915238198 1:154501557-154501579 CCGTTCTTCTCCTGAGTGTCCAC 0: 1
1: 1
2: 1
3: 12
4: 323
Right 915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG 0: 1
1: 0
2: 2
3: 19
4: 246
915238200_915238204 2 Left 915238200 1:154501576-154501598 CCACCTTGATGAGCCTGTTGATG 0: 1
1: 0
2: 0
3: 12
4: 119
Right 915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG 0: 1
1: 0
2: 2
3: 19
4: 246
915238199_915238204 11 Left 915238199 1:154501567-154501589 CCTGAGTGTCCACCTTGATGAGC 0: 1
1: 0
2: 1
3: 22
4: 106
Right 915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG 0: 1
1: 0
2: 2
3: 19
4: 246
915238197_915238204 22 Left 915238197 1:154501556-154501578 CCCGTTCTTCTCCTGAGTGTCCA 0: 1
1: 0
2: 3
3: 22
4: 247
Right 915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG 0: 1
1: 0
2: 2
3: 19
4: 246
915238201_915238204 -1 Left 915238201 1:154501579-154501601 CCTTGATGAGCCTGTTGATGTAG 0: 1
1: 0
2: 1
3: 8
4: 115
Right 915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG 0: 1
1: 0
2: 2
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915238204 Original CRISPR GGTGCTGCAGCCCGAGCTCT TGG Exonic
900144344 1:1151388-1151410 GGGCCTGGAGCCCGAGATCTGGG - Intergenic
900210442 1:1453073-1453095 GGCGCTGCAGTCACAGCTCTGGG - Intronic
900223417 1:1521567-1521589 GGCGCTGCAGTCACAGCTCTGGG - Intronic
901018652 1:6245233-6245255 GGTGCTGCCGGCGGCGCTCTCGG - Exonic
901789533 1:11647107-11647129 GGAGATGCAGCCCCTGCTCTGGG - Intergenic
902575491 1:17374706-17374728 GGTCCTGGAGGCCGAGCCCTGGG - Intronic
902983988 1:20144271-20144293 ACTGCTGCAGCCGGGGCTCTGGG + Intronic
903740552 1:25556216-25556238 GGTGCTCCTGCCCCACCTCTGGG + Intronic
905548164 1:38816523-38816545 GGGCCTGCAGCTCCAGCTCTGGG - Intergenic
908778038 1:67660591-67660613 GGTACTACAGCCCAAGCACTAGG + Intergenic
910258773 1:85276385-85276407 GGCGGCGCAGCCCGAGCTCCCGG - Exonic
910704921 1:90118592-90118614 GATGCTACAGCCAGTGCTCTAGG - Intergenic
912461435 1:109834798-109834820 GGTGCTGCAGACCCCGCTTTGGG + Intergenic
915006659 1:152644578-152644600 CCTGCTGCAGCTCTAGCTCTGGG - Intergenic
915012318 1:152699050-152699072 GCTGCTGCGGCTCCAGCTCTGGG + Exonic
915020764 1:152776640-152776662 GCTGCAGCAGTCAGAGCTCTGGG - Exonic
915021958 1:152787568-152787590 GCTGCAGCAGTCAGAGCTCTGGG - Exonic
915022921 1:152798051-152798073 GCTGCAGCAGTCAGAGCTCTGGG - Exonic
915023578 1:152805188-152805210 GCTGCAGCAGCCAGAGCTCTGGG + Exonic
915024288 1:152812715-152812737 GCTGCAGCAGCCAGAGCTCTGGG - Exonic
915238204 1:154501601-154501623 GGTGCTGCAGCCCGAGCTCTTGG + Exonic
915553132 1:156646630-156646652 GGTCCTGCAGCCCTACCTCTAGG - Intronic
915904259 1:159866325-159866347 GGTGCTGCAGGGTGAGCCCTGGG - Intronic
915914062 1:159930776-159930798 GGGGCTGCAGCCCTGGCACTAGG + Exonic
920147369 1:203873459-203873481 GGAGCTGCAGTCCTAGATCTTGG - Intergenic
920706209 1:208252494-208252516 GGTGCGGGAGCCCCAGCTCCTGG + Intergenic
922717434 1:227884840-227884862 GGTCCTGCAGCCCCTCCTCTGGG - Intergenic
922717581 1:227885343-227885365 GGTGGTGCAGACAGAGTTCTGGG - Intergenic
922803698 1:228375308-228375330 GGGGCTACAGGCCTAGCTCTGGG + Intronic
922821232 1:228487270-228487292 TGTGCTGCAGCCGGAGGTCCTGG - Exonic
922929936 1:229381217-229381239 GCTGCTGCAGCCCCAGGTCTTGG - Intergenic
1063004217 10:1952838-1952860 GGGGCTGGAGCCCGGGCACTCGG + Intergenic
1065188799 10:23192734-23192756 GCTGCTGCAGCCCGCGCCCCCGG + Exonic
1065523471 10:26594164-26594186 GGGGCGGCAGCAGGAGCTCTGGG - Intergenic
1066400819 10:35074006-35074028 CGTGCTGCGGCCGGTGCTCTAGG + Intronic
1070727236 10:78800827-78800849 GATGCTGAAGTCCTAGCTCTTGG - Intergenic
1070735540 10:78861459-78861481 GGTGCTGCAGCTGGAGCCCAAGG + Intergenic
1071447331 10:85760952-85760974 GGTGCTGAAGCCACAGCTCATGG - Intronic
1071574223 10:86714241-86714263 GATCCTGCAGCCAGGGCTCTTGG + Intronic
1073261237 10:102192137-102192159 GGTGCTGCAGCCCAGGATATGGG - Intergenic
1073543852 10:104333251-104333273 GGTGCTGCAGTCTCAGATCTGGG - Intronic
1075032135 10:119030416-119030438 GCTGCTGAAGCCCGAGCTGCAGG + Exonic
1076611486 10:131728777-131728799 GGTCCGGCAGCCCCAGCTGTGGG - Intergenic
1076742705 10:132494974-132494996 GGTGCAGGAGGCCAAGCTCTCGG - Intergenic
1076743285 10:132498826-132498848 GGTCCTGGAGCCTAAGCTCTAGG + Intergenic
1076817581 10:132922428-132922450 GGTGCTGCAGCCCCAGCATGGGG - Intronic
1077258074 11:1598101-1598123 GGGGCTGCAGCTCCAGCTGTGGG - Exonic
1077544904 11:3165068-3165090 GGGGCTGCGGCGCGAGCTCCTGG + Intronic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1078191480 11:9095181-9095203 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1078583260 11:12556985-12557007 GCTGCAGCAGCCAGAGCTTTGGG + Intergenic
1078627236 11:12968718-12968740 GGTGCTGCAGCCTGGGCTTCAGG - Intergenic
1079157765 11:17964361-17964383 GGTGCTGCAGCCATAGCTATAGG + Intronic
1081301475 11:41457771-41457793 GGTACTCCAGGCAGAGCTCTTGG - Intronic
1083794070 11:65004472-65004494 GGTGCTGCAGACAGAGACCTGGG + Intergenic
1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG + Intronic
1084173501 11:67411591-67411613 GGTGCAGCAGCCTCAGCCCTGGG + Intronic
1084189853 11:67493984-67494006 GGTGAGGCGGCCCGAGCTATTGG + Exonic
1087497323 11:98907962-98907984 GAAGCTCCAGCCCAAGCTCTAGG - Intergenic
1089383072 11:118050086-118050108 TGTGCTGGAGCCCCAGCCCTGGG + Intergenic
1089519993 11:119057031-119057053 GCTCCTGCGGCCCCAGCTCTGGG + Exonic
1090000629 11:122954204-122954226 GCTGCTGCAGCTCCAGCTCCAGG + Intronic
1090256332 11:125287251-125287273 TGTGGTTCAGCCCGGGCTCTGGG - Intronic
1091395394 12:151329-151351 GGTGCTCCAGCCAGAGCTCCAGG + Intronic
1093548071 12:20370177-20370199 GCTGCTGCAGCCGGACATCTCGG - Exonic
1096237550 12:49939965-49939987 GGCCCTGGAGCCTGAGCTCTGGG - Intergenic
1096309181 12:50505215-50505237 GGAGCTGGAGCTGGAGCTCTCGG + Exonic
1096626663 12:52900035-52900057 GGAGCTGCAGTCCCAGATCTCGG - Exonic
1098264655 12:68706333-68706355 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1100215747 12:92446347-92446369 GGGACTGCAGCCTGAGCACTGGG + Intergenic
1101514993 12:105426398-105426420 GGAGCAGCAGTCTGAGCTCTTGG + Intergenic
1101863621 12:108503097-108503119 GGTGCTGCAGCCCAAGAGATAGG + Intergenic
1102575310 12:113852576-113852598 GGTGCTGCAGCCTGAAACCTAGG - Intronic
1102768110 12:115450968-115450990 GGTGCTGCAGCCCTGGAGCTGGG - Intergenic
1103583205 12:121931678-121931700 GTTCCTGGAGCCCCAGCTCTGGG + Intronic
1104127386 12:125861328-125861350 GATCCTGCATCCTGAGCTCTGGG + Intergenic
1104390451 12:128387316-128387338 GGTGCAGAAGCCCCAGATCTGGG - Intronic
1104860541 12:131921183-131921205 GGGGCTGCAGCACATGCTCTCGG + Exonic
1110377846 13:74814445-74814467 GAAGCTGCAGCCCAATCTCTAGG - Intergenic
1112586775 13:100725587-100725609 TGTGCTGCAGCCCTGCCTCTTGG + Intergenic
1113631897 13:111893822-111893844 GGAGGGGCAGCCCGAGCTGTTGG + Intergenic
1115951573 14:38727735-38727757 GGAGCTGCAGTCCCAGGTCTGGG + Intergenic
1117690235 14:58298758-58298780 GCTGCTGCTGCCCGAGGTCCCGG + Intronic
1118849468 14:69573056-69573078 GCTGCTGCTGCCCGCGCTCGGGG + Exonic
1121171606 14:91859125-91859147 GGTGCTAGAGACCGAGCTCTGGG - Intronic
1121219453 14:92274831-92274853 AGTGCAGGAGCCCGAGCTCCTGG + Intergenic
1121472742 14:94167881-94167903 GGAGCTGCAGATGGAGCTCTGGG + Intronic
1122232384 14:100313182-100313204 GGGGCTGGGGCCCGAGCTGTTGG + Intergenic
1122807592 14:104268023-104268045 GATGCTGCCGTCCCAGCTCTGGG + Intergenic
1123439008 15:20276587-20276609 GGTGTGGCAGCCCCAGCTTTGGG - Intergenic
1123468651 15:20534198-20534220 GGGGCAGAAGGCCGAGCTCTTGG - Intronic
1123649463 15:22466864-22466886 GGGGCAGAAGGCCGAGCTCTTGG + Intronic
1123728969 15:23129409-23129431 GGGGCAGAAGGCCGAGCTCTTGG - Intronic
1123747133 15:23326874-23326896 GGGGCAGAAGGCCGAGCTCTTGG - Intergenic
1124279402 15:28350190-28350212 GGGGCAGAAGGCCGAGCTCTTGG - Intergenic
1124303296 15:28561418-28561440 GGGGCAGAAGGCCGAGCTCTTGG + Intergenic
1125185157 15:36921632-36921654 GGTGCTGAAACACAAGCTCTGGG - Intronic
1125589401 15:40844860-40844882 GGAGCTGCAGCCCGACCGCGGGG + Exonic
1125841079 15:42801693-42801715 GGAGCTGCAGTCCCAGATCTCGG - Intronic
1129207200 15:74044321-74044343 AGTGCTGCAGCCCCACCTCCAGG - Exonic
1129450141 15:75647153-75647175 GGTGCTGCACCCGCAGCTCTCGG + Intronic
1129520930 15:76185983-76186005 GGGGCTGGAGGCTGAGCTCTTGG - Intronic
1131119701 15:89814675-89814697 GGAGCTGCAGACCCAGCGCTTGG - Intronic
1131529574 15:93180075-93180097 GAAGCAGCAGCCCCAGCTCTCGG - Intergenic
1139472443 16:67185360-67185382 GGCGCTGCAGGCGGAGCTCCAGG - Exonic
1139530170 16:67538768-67538790 GGTGCCGCAGCCCGAGCGGCTGG + Exonic
1141471376 16:84240838-84240860 GGTTTTGCAGCCCAGGCTCTTGG + Intergenic
1141957679 16:87383519-87383541 GGAGCTGCCGCCCGAGCTGCTGG - Exonic
1142357980 16:89612884-89612906 GCTGCAAAAGCCCGAGCTCTGGG + Intergenic
1144214932 17:13047051-13047073 GCTTCTGCAGTCCCAGCTCTGGG + Intergenic
1144263445 17:13545610-13545632 GGTGATGCAGCCGCAGCTCCAGG - Intronic
1144464779 17:15488583-15488605 TGTGCAGCAGCCCAAGCTCCTGG + Intronic
1144520020 17:15947083-15947105 TGTGCTGCTGCCCGTGCTGTTGG + Intronic
1144836547 17:18159358-18159380 GGGACTGCAGCCAGGGCTCTGGG + Intronic
1146219820 17:31008653-31008675 GGGGCTGAGGCCCGAGCTTTTGG - Intergenic
1146255316 17:31388893-31388915 GGGGCTGCACTCTGAGCTCTTGG + Intergenic
1146815552 17:35939248-35939270 GGTGCTGCAGCTGGAGGACTTGG - Exonic
1148271869 17:46267578-46267600 GGTGCCACAGCCCGGGCTGTGGG + Intergenic
1150764504 17:67992962-67992984 GGTGCCACAGCCCGGGCTGTAGG - Intronic
1151124010 17:71825624-71825646 GGGGTAGCAGCCCAAGCTCTGGG + Intergenic
1151233934 17:72704755-72704777 GGAGCTCCAGTCCAAGCTCTAGG + Intronic
1151539915 17:74759572-74759594 GGAGCTGCAGCCTGAGCTGGGGG - Intronic
1151674230 17:75589521-75589543 GGTGCCGCAGCCCGGGCTCACGG - Intergenic
1151729840 17:75904752-75904774 GGGGCTGTCGCCCGAGCTGTGGG - Intronic
1152018606 17:77768676-77768698 GGTGTGGCAGCCTGAGCTCTGGG + Intergenic
1152108515 17:78344026-78344048 GGGTCTGCAGTCCCAGCTCTGGG - Intergenic
1152846616 17:82604036-82604058 GGTGCTGCAGCTCCAGCACCAGG - Exonic
1153031025 18:712762-712784 GGAGCTGCAGTCCCAGCTCCGGG + Intergenic
1158317261 18:56224981-56225003 GGTTCTGGAGACGGAGCTCTTGG - Intergenic
1160164194 18:76495636-76495658 GCTGCTGCAGCCCCGGCTCCCGG + Exonic
1161154761 19:2726882-2726904 TGAGCTGCAGCCCTGGCTCTGGG - Intronic
1161589646 19:5123541-5123563 GGTGCTGCAGTCCTAGCCCCCGG - Intronic
1162125749 19:8498754-8498776 GCTGCTGCAGCCGGAGCGCCGGG - Exonic
1163132054 19:15280476-15280498 GGTGCTGCAGGGAGAGGTCTTGG - Intronic
1163703935 19:18801380-18801402 ACTGCTGCAGCCCGTGCTCTTGG - Intergenic
1163906303 19:20151927-20151949 CTGGCTGCAGCCTGAGCTCTGGG - Intergenic
1163983426 19:20923261-20923283 CTCGCTGCAGCCTGAGCTCTAGG + Intronic
1164042429 19:21505634-21505656 CTTGCTGCAGCCAGAGCTCCAGG + Exonic
1164739291 19:30564627-30564649 GGAGCTCCAGCCCGAGCGCCAGG - Intronic
1165944809 19:39435736-39435758 GGAGCTGGAGCCGGAGCTCACGG - Intronic
1166331197 19:42079017-42079039 GGTGGTTCAGCCAGAGCTCCTGG - Exonic
1166762662 19:45234632-45234654 GGCCCTGCAGCGCGAGCTGTGGG - Intronic
1167291227 19:48626135-48626157 GGTGCAGCAGCCTGAGACCTCGG - Exonic
1167713231 19:51124983-51125005 GCTGCTGCTGCCCCTGCTCTGGG + Exonic
1167715822 19:51142381-51142403 GCTGCTGCTGCCCCTGCTCTGGG + Exonic
1167721806 19:51184818-51184840 GCTGCTGCTGCCCCTGCTCTGGG + Intergenic
1167762504 19:51458351-51458373 GCTGCTGCTGCCCCTGCTCTGGG - Exonic
1168724882 19:58575630-58575652 GGAGCTGCAGCCCCTCCTCTTGG + Intergenic
925326164 2:3023666-3023688 GGTGCTGCACCCTGAGCTGAGGG + Intergenic
927846011 2:26473267-26473289 GGTGCAGCAGCTCGTTCTCTGGG + Exonic
930022090 2:47007705-47007727 GGTGCTGCAGCCTGAGTGCGGGG + Intronic
930438269 2:51374593-51374615 GTTACTGCAGCCCGAACTCCTGG - Intergenic
934510221 2:94932645-94932667 GGTGCTGCAGCCCAGGAGCTGGG + Intergenic
935216808 2:100981383-100981405 GGGCCTGCAGCCCCTGCTCTGGG - Intronic
939641866 2:144649328-144649350 GGTGCTGGTGTCCGAGCTCTGGG + Intergenic
940756624 2:157690300-157690322 GGTGCAAGAGCCCTAGCTCTTGG + Intergenic
947827053 2:233113650-233113672 GTTACTGCAGCCAGAGATCTAGG + Intronic
947852968 2:233303457-233303479 GGTCCTGCAGCCTCAGCTCAGGG + Intergenic
948130809 2:235599392-235599414 GATGCTGCAGGGTGAGCTCTGGG + Intronic
948436690 2:237958531-237958553 GGGGCTGCAGCCTGGGGTCTGGG - Intergenic
948578030 2:238966571-238966593 GGGGCTGCAGGCCCAGCACTTGG - Intergenic
1172781296 20:37438374-37438396 GGCACAGCAGCCTGAGCTCTGGG + Intergenic
1172793097 20:37519689-37519711 GGGGCTGCAGCCCGTCCTCAAGG + Intronic
1174153587 20:48502774-48502796 GGTTCTGCAGCTGGAGCCCTAGG - Intergenic
1175276079 20:57771768-57771790 GTTACTGCAGCCCGAACTCCTGG - Intergenic
1175368564 20:58471516-58471538 GGCGCTGCAGCACAAGCTCCAGG + Intronic
1176131003 20:63496834-63496856 GGTGATGCAGCCCAAACTCAGGG + Intronic
1176179117 20:63741322-63741344 GGTGACCCAGCCAGAGCTCTGGG - Intronic
1179890540 21:44333100-44333122 GGTGCCGCAGCACGGGTTCTCGG + Exonic
1181573633 22:23780896-23780918 TGTGCTGCAGCCCCAGCACGTGG - Exonic
1184271164 22:43385050-43385072 CCTGCTGCATCCCCAGCTCTGGG - Intergenic
1184293616 22:43510662-43510684 GGTGTTGGAGCCTCAGCTCTTGG + Intergenic
1184368512 22:44068031-44068053 GGTGCTCCAGGCGGGGCTCTGGG - Intronic
1184424332 22:44400390-44400412 GGTGCTGCACCCTGAGCTGATGG - Intergenic
1184522333 22:45002515-45002537 GGTGCTGGACCCAGAGCCCTGGG - Intronic
1184645067 22:45891091-45891113 GGGGCTGCGGCCAGAGCTCCTGG - Intergenic
1184689530 22:46111121-46111143 GGTGCTGAATCTCTAGCTCTAGG - Intronic
1185245649 22:49771495-49771517 GGTTCTGCACCTCGCGCTCTGGG + Intergenic
1185274565 22:49944731-49944753 GGCACTGCAGCCTGAGGTCTGGG - Intergenic
1185302571 22:50090160-50090182 GCAGCTGGAGCCCGAGCTCGCGG + Exonic
950453465 3:13078758-13078780 GGCGCTGGAGCCGGAGGTCTGGG + Intergenic
950521448 3:13500257-13500279 GGTGATGGATCCCGGGCTCTAGG + Intronic
950659313 3:14456970-14456992 GTTGCAGCAGTCAGAGCTCTGGG + Intronic
951163669 3:19458752-19458774 GGACCTGCAGCCCCAGCTCATGG + Intronic
954449300 3:50563134-50563156 GGTCCTGCAGGAGGAGCTCTGGG - Intronic
954792317 3:53142497-53142519 GGTGAAGCAGGCTGAGCTCTTGG - Intergenic
957636423 3:82791247-82791269 GGTGCAACAGCCCTGGCTCTGGG - Intergenic
961018244 3:123483371-123483393 GGTGCTGCAGCCTGGGCTCCAGG + Intergenic
961385126 3:126518824-126518846 GGTGCTAGAGCCAGACCTCTGGG - Intergenic
961411593 3:126726068-126726090 GGTGCAACAGGCCTAGCTCTCGG + Intronic
962369249 3:134807085-134807107 GATGATGCAGCCCCATCTCTGGG + Intronic
962712860 3:138102196-138102218 GGAGCTGCAGTCCCAGATCTCGG - Intronic
964876325 3:161372264-161372286 GCTGCCCCAGCCCGAGCCCTGGG - Exonic
965205132 3:165712686-165712708 GGTGTTGCAGCCCTGGCTCAAGG + Intergenic
965605719 3:170496130-170496152 GGAGCTGCAGTCCCAGATCTCGG + Intronic
968064732 3:195752347-195752369 AGTGCTGCAGGCCGCGCTCTGGG - Intronic
968592660 4:1466593-1466615 GGAGCTGCAGCCTGAGACCTTGG + Intergenic
968653095 4:1767639-1767661 GCGGCTGCGGCCCGAGCTGTTGG - Intergenic
969402330 4:6963634-6963656 GGTGCTGTAGCCTGGGGTCTGGG - Intronic
969696695 4:8738901-8738923 GGTGCTGCAGCCGGTGGTCAGGG - Intergenic
969857008 4:10008095-10008117 GTTGCTGCAGCCAGAGAGCTGGG - Intronic
971148561 4:24006384-24006406 GGTGCTGCAGCCTTTGCTCTAGG - Intergenic
977928724 4:102729452-102729474 GGAGCTGCAGTCCCAGATCTCGG - Intronic
980113207 4:128654341-128654363 GCTGCTGCAGCCCCACTTCTTGG + Intergenic
985150808 4:186945299-186945321 GCTGCTTCAGCCCCTGCTCTCGG - Intergenic
985908211 5:2858180-2858202 GGTGCTGCAGTCTCAGCTCCAGG - Intergenic
985974156 5:3402015-3402037 GGCGTTGCAGCCCCATCTCTAGG - Intergenic
987004773 5:13699049-13699071 AGTGCTGCAACCCCAGCACTAGG + Intronic
990266992 5:54087376-54087398 GGAGCTGCAGCCCAAGATCTCGG - Intronic
990506884 5:56454228-56454250 GGCGCTGGAGTCTGAGCTCTGGG - Intergenic
990900543 5:60744282-60744304 GGAGCTGCAGTCCCAGATCTCGG - Intergenic
994320853 5:98392806-98392828 GGAGCTGCAGTCCCAGATCTTGG - Intergenic
998128073 5:139637628-139637650 GGCGGTCCAGCCCGAGCTCCGGG - Intergenic
998887221 5:146706896-146706918 GGAGCTGCAGTCCCAGATCTCGG - Intronic
999843508 5:155453875-155453897 GGTTGTGCAGCCCTTGCTCTGGG + Intergenic
1001411855 5:171517941-171517963 GTTGCTGAAGACCAAGCTCTGGG + Intergenic
1002105417 5:176877415-176877437 GGTCCTGCAGCCCAAGCCCCTGG + Intronic
1002661198 5:180792143-180792165 GCTGCTGTTGGCCGAGCTCTGGG - Exonic
1005315449 6:24599051-24599073 GGAGCTGCAGTCCCAGATCTGGG + Intronic
1005958196 6:30679209-30679231 GCTGCTGCAGCCAGAGCTCCAGG - Exonic
1006834030 6:36986085-36986107 GGAGCTGGAGCCGGAGCTCGCGG - Exonic
1009385223 6:63079090-63079112 GGTGCTGCTGCAGGAGGTCTGGG + Intergenic
1009510820 6:64548001-64548023 AGGGCTGCAGCACGAGTTCTGGG - Intronic
1009534241 6:64860591-64860613 GGTGTTGCAGCCCTAGCTTGGGG + Intronic
1011099550 6:83707719-83707741 GGTGGTGCGGCCTGCGCTCTTGG - Intronic
1012803050 6:103858368-103858390 GGTACTGCACCCCTTGCTCTAGG - Intergenic
1012890183 6:104888245-104888267 GGTGCTGCAGCCAGGGATATGGG - Intergenic
1013033719 6:106360700-106360722 AGCACTGCAGCCCGAGCTGTTGG - Intergenic
1015539286 6:134298003-134298025 GGAGCTGCAGTCCCAGATCTCGG - Intronic
1018317216 6:162569009-162569031 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1019014234 6:168867956-168867978 GCTGCTGCGGCCCCAGCTCTGGG + Intergenic
1019474279 7:1236551-1236573 GGTGCCGCAGGCCGCGCTCAAGG + Exonic
1019534978 7:1524041-1524063 GGTGTGGCAGCCGGGGCTCTGGG - Intergenic
1019598030 7:1867391-1867413 GGCACTGCAGCCTGAGCTCCAGG + Intronic
1019711279 7:2519385-2519407 GGTGCTGAGACCCGGGCTCTGGG - Intronic
1021280133 7:18707055-18707077 GGGGCTCCACCCCTAGCTCTTGG - Intronic
1022793618 7:33714388-33714410 TCTGCTGCAGCCCTAGCACTGGG + Intergenic
1023289602 7:38655892-38655914 GGAGCTGCAGTCCTAGATCTCGG + Intergenic
1024310640 7:47965987-47966009 GCTGCAGCTCCCCGAGCTCTCGG - Intronic
1026020057 7:66699160-66699182 GGTGCTCAAGCCAGAGCTCGGGG - Intronic
1028035043 7:85971902-85971924 GTTGCTGCTGTCCAAGCTCTTGG - Intergenic
1029422504 7:100478615-100478637 GGCCCTGGAGTCCGAGCTCTTGG - Intronic
1030300836 7:107973059-107973081 TGTTCTGCAGCCAGAGCACTGGG - Exonic
1032369048 7:131328010-131328032 GGTGGGGCAGCACGAGCTCAAGG - Intronic
1033477102 7:141701952-141701974 GCTGCTGCAGCCCGGGCGCCTGG - Exonic
1034201926 7:149288005-149288027 GCTGCTGAAGCCTGACCTCTGGG + Intronic
1034252111 7:149701076-149701098 GGTGTTACAGCCCTGGCTCTGGG + Intergenic
1034871344 7:154686906-154686928 GGACCTGGAGTCCGAGCTCTGGG - Intronic
1035234607 7:157488095-157488117 GGGGCTGCAGCCCCTCCTCTAGG - Intergenic
1036762299 8:11517782-11517804 GGTGCTGCAGGCCAAGCTCTTGG + Intronic
1037280609 8:17237765-17237787 GGAGCTGCAGCCATAGCTGTGGG + Intronic
1038035377 8:23682538-23682560 GTCCCTGCACCCCGAGCTCTGGG + Intronic
1039817881 8:41110869-41110891 AGTCCTGCAGCCCTGGCTCTTGG + Intergenic
1040495318 8:47960684-47960706 GGTCCTACAGCACCAGCTCTCGG - Intronic
1041781093 8:61578918-61578940 GGAGCTGCAGTCCCAGATCTCGG + Intronic
1049237976 8:141522166-141522188 GGGGCTACAGCACGGGCTCTGGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1053905556 9:42840888-42840910 GGTGCTGCAGCCCAGGAGCTGGG - Intergenic
1056994364 9:91442790-91442812 GGTGCCACAGCCCTGGCTCTGGG + Intergenic
1057372124 9:94483461-94483483 GGTGCTGCAGCCCAGGAGCTGGG - Intergenic
1057459052 9:95242866-95242888 GATGCTCCAGCCTGAGCTCAGGG - Intronic
1057705750 9:97393820-97393842 GGTGATGCGGCCCTAGCTTTGGG - Intergenic
1060282382 9:122223076-122223098 TGCACTGCAGCCCAAGCTCTGGG - Intronic
1185612132 X:1399048-1399070 GATGCTGTCGCCCCAGCTCTGGG + Intergenic
1192143705 X:68666235-68666257 GGTGCTGGAGCCTGAACTCCTGG + Intronic
1194008487 X:88528916-88528938 GGTGCTGCAGCCAAAGAGCTGGG + Intergenic
1195111626 X:101656630-101656652 GCTGCTGCAGCCCCATCTCCAGG + Exonic
1199612652 X:149631431-149631453 GATGCTGCAGCCCGAGGACCCGG - Intronic