ID: 915238279

View in Genome Browser
Species Human (GRCh38)
Location 1:154501861-154501883
Sequence CCTGAAGACCGTGTCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915238279_915238292 19 Left 915238279 1:154501861-154501883 CCCGCTCCGACACGGTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 57
Right 915238292 1:154501903-154501925 ACCACTTGGCCGCCATGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 51
915238279_915238294 25 Left 915238279 1:154501861-154501883 CCCGCTCCGACACGGTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 57
Right 915238294 1:154501909-154501931 TGGCCGCCATGAGGGGGCCCCGG 0: 1
1: 0
2: 2
3: 19
4: 180
915238279_915238290 17 Left 915238279 1:154501861-154501883 CCCGCTCCGACACGGTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 57
Right 915238290 1:154501901-154501923 GAACCACTTGGCCGCCATGAGGG 0: 1
1: 0
2: 0
3: 3
4: 53
915238279_915238296 29 Left 915238279 1:154501861-154501883 CCCGCTCCGACACGGTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 57
Right 915238296 1:154501913-154501935 CGCCATGAGGGGGCCCCGGCCGG 0: 1
1: 0
2: 0
3: 13
4: 164
915238279_915238291 18 Left 915238279 1:154501861-154501883 CCCGCTCCGACACGGTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 57
Right 915238291 1:154501902-154501924 AACCACTTGGCCGCCATGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 53
915238279_915238289 16 Left 915238279 1:154501861-154501883 CCCGCTCCGACACGGTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 57
Right 915238289 1:154501900-154501922 TGAACCACTTGGCCGCCATGAGG 0: 1
1: 0
2: 1
3: 6
4: 55
915238279_915238287 5 Left 915238279 1:154501861-154501883 CCCGCTCCGACACGGTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 57
Right 915238287 1:154501889-154501911 GGGGAACTCCTTGAACCACTTGG 0: 1
1: 0
2: 1
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915238279 Original CRISPR CCTGAAGACCGTGTCGGAGC GGG (reversed) Exonic
900619212 1:3579340-3579362 CCTGAAGACCAGGTTGAAGCAGG - Intronic
902559327 1:17267235-17267257 CCTGAAGACTGTGTCTGATCTGG + Intronic
906165906 1:43685886-43685908 CCTGAAGCTCCTGTCTGAGCTGG - Intronic
915238279 1:154501861-154501883 CCTGAAGACCGTGTCGGAGCGGG - Exonic
915585757 1:156843075-156843097 CCTGAAGACGGTGAATGAGCTGG - Exonic
1063460515 10:6212448-6212470 CCTGGAGACAGTGGTGGAGCCGG + Intronic
1068814503 10:61294405-61294427 TCTGAAGTCTGTGTCTGAGCGGG + Intergenic
1076346005 10:129779534-129779556 CCTGGAGACCGCGCAGGAGCTGG - Intergenic
1076635037 10:131876192-131876214 CCTGAAACCCGAGTCCGAGCAGG - Intergenic
1081279095 11:41186611-41186633 CCTGAACACTGGGTCGGAGGTGG + Intronic
1083989006 11:66235227-66235249 CCTGCAGACCCTCTCGGAGAGGG - Intronic
1088808706 11:113374807-113374829 CCTGAAGAGCAAGTCGCAGCTGG - Intronic
1091330625 11:134728594-134728616 CCTCAAGACCATGTCTCAGCTGG - Intergenic
1091761709 12:3091852-3091874 GCTGAAGACTGTGTTGGAGGAGG + Intronic
1092728601 12:11507980-11508002 CCAGAAGACCGTGTCCCAGTGGG - Intergenic
1093326183 12:17777721-17777743 CCTTAAGACAGTGTCCTAGCTGG - Intergenic
1095998050 12:48105954-48105976 CCAGGAGACTGTGTCGGACCCGG - Exonic
1099477189 12:83121959-83121981 CCTTCAGATCGTGTGGGAGCTGG - Intronic
1100744731 12:97633403-97633425 CCTCAAGACTGTGTCTCAGCTGG + Intergenic
1101600552 12:106205852-106205874 CCTCAAGACCCTGTGGGAGCTGG + Intergenic
1104877257 12:132044218-132044240 CCTGAAGACCCTGCAGGAGAGGG + Exonic
1108326251 13:49334533-49334555 CCCGAAGACGATGTCTGAGCTGG - Intronic
1118288817 14:64502780-64502802 CCTGAAGAGCGTGATGTAGCTGG - Intronic
1122341411 14:101030912-101030934 CCTGAAGCGCGTGTCACAGCCGG - Intergenic
1124161213 15:27271663-27271685 CCTGGGAACCGTGTGGGAGCAGG + Intronic
1132870403 16:2113248-2113270 CCGGAAGACCATGTCCGAGCCGG + Exonic
1134522137 16:14923677-14923699 CCAGAAGACCATGTCCGAGCCGG - Intronic
1134709806 16:16322328-16322350 CCGGAAGACCATGTCCGAGCCGG - Intergenic
1134717020 16:16362358-16362380 CCGGAAGACCATGTCCGAGCCGG - Intergenic
1134949797 16:18346317-18346339 CCGGAAGACCATGTCCGAGCCGG + Intergenic
1134957731 16:18389801-18389823 CCGGAAGACCATGTCCGAGCCGG + Intergenic
1136347621 16:29686279-29686301 CCTGCAGACAGTGTCGGGGTGGG - Intronic
1147570667 17:41568543-41568565 CCTGGACACCGTGCCGGAGCTGG + Exonic
1150538935 17:66076390-66076412 CCTGAAGACTGTGTGGGAGCTGG + Intronic
1152403745 17:80084826-80084848 CCAGAAGACCCTGGTGGAGCTGG + Exonic
1152734563 17:81991122-81991144 TCTGAAGACCGTGAGGGAGCAGG + Intronic
1153451757 18:5238054-5238076 CCGGAAGTGCGTGTCGGCGCGGG - Intergenic
1162731164 19:12719857-12719879 CCTGAAGACCCAGCCAGAGCAGG + Intronic
1163322265 19:16581711-16581733 CCTGGAAACTGTGTGGGAGCTGG + Intronic
1166211460 19:41309236-41309258 CCTGAAGAACGAGTAGGAGCTGG - Intronic
1167280980 19:48568412-48568434 CCTGAAGACAGAGAAGGAGCTGG + Intronic
927725713 2:25421143-25421165 TCTGTAGACTGTGTGGGAGCAGG - Intronic
928235184 2:29533156-29533178 GCATAAGACCGTGTCTGAGCTGG + Intronic
938064195 2:128272225-128272247 CCTGCAGACCGTGACGGTGCTGG - Intronic
948489645 2:238304274-238304296 CCTGAAGAGCGTGTAGTGGCTGG - Intergenic
1169334036 20:4740463-4740485 CCTGGAGACCATGTCTGAGCTGG - Exonic
1172036965 20:32017996-32018018 GCTGAAGACCACGGCGGAGCAGG + Exonic
1178323960 21:31628393-31628415 CCTGAAGCCCATGTTGCAGCAGG - Intergenic
1181088438 22:20455948-20455970 TCTGAAGGCCGAGTCAGAGCAGG - Intronic
1182876972 22:33700673-33700695 CCTGGAGGCGGTGTCTGAGCTGG + Intronic
1182897817 22:33873444-33873466 CCTGAAGGCCGTGTCGCTCCTGG + Intronic
949324238 3:2846016-2846038 CCTTAAGAAGGTGTGGGAGCAGG + Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950891865 3:16411151-16411173 CCTGAAGTCCCTGTGAGAGCAGG + Intronic
952582420 3:34850172-34850194 CCTGAAGCTGGTGGCGGAGCGGG + Intergenic
959930715 3:111979093-111979115 CCTGGGTACCTTGTCGGAGCTGG + Exonic
961319205 3:126061351-126061373 CTTGGAGACAGTGTGGGAGCAGG - Intronic
962350630 3:134653121-134653143 TCTGAAGACAGCTTCGGAGCAGG + Intronic
975999818 4:80360323-80360345 CCTGAAGACTGTGCTGGAGGCGG + Intronic
985506116 5:281456-281478 GCTGAAGACAGTGAAGGAGCTGG + Intronic
987414668 5:17650085-17650107 CCTGAAGGCTGTGTCTGAGCAGG + Intergenic
992615826 5:78545184-78545206 CCTGCAGATCGTATTGGAGCTGG - Intronic
995879620 5:116829851-116829873 CCTGCAGACCCTCTTGGAGCTGG - Intergenic
1001460683 5:171910593-171910615 CCTGAAGCCCATGTTGCAGCGGG - Exonic
1013991034 6:116253828-116253850 CCTGGAGACCGTTGCGGAGGGGG - Exonic
1019328940 7:453231-453253 CCTGGAGACACTGTGGGAGCCGG + Intergenic
1021978388 7:26030980-26031002 CCTGAAGAAGGTGAGGGAGCGGG + Intergenic
1032703036 7:134398792-134398814 ACTGAAGACTGGGTCTGAGCTGG + Intergenic
1040636738 8:49284036-49284058 CCTGAAGACCTAGTCTGGGCTGG - Intergenic
1041807239 8:61865418-61865440 CCTGAAATCAGTGTAGGAGCAGG + Intergenic
1061135424 9:128730698-128730720 CCTGAAGACCCTCTAGGAGCAGG - Exonic
1185835022 X:3337667-3337689 CCTGGAGAACGTGTCAGAGCTGG + Intronic
1189492719 X:41482532-41482554 CCTGAACACAGTCTCAGAGCGGG - Intergenic
1200117081 X:153774117-153774139 CCTGAGCACCGTGGCGGGGCAGG - Intronic
1201241586 Y:11962039-11962061 CCTGGAGAACTTGTCAGAGCTGG - Intergenic