ID: 915245559

View in Genome Browser
Species Human (GRCh38)
Location 1:154553793-154553815
Sequence CTCACTGAGCATAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 416}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915245552_915245559 15 Left 915245552 1:154553755-154553777 CCCCTTATTCATCCTGCTCTAAG 0: 1
1: 0
2: 0
3: 20
4: 170
Right 915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 416
915245555_915245559 3 Left 915245555 1:154553767-154553789 CCTGCTCTAAGTGAGCAAGCAAC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 416
915245554_915245559 13 Left 915245554 1:154553757-154553779 CCTTATTCATCCTGCTCTAAGTG 0: 1
1: 0
2: 1
3: 12
4: 134
Right 915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 416
915245553_915245559 14 Left 915245553 1:154553756-154553778 CCCTTATTCATCCTGCTCTAAGT 0: 1
1: 0
2: 0
3: 7
4: 183
Right 915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915245559 Original CRISPR CTCACTGAGCATAGGGAAGG AGG Intronic
901163031 1:7194765-7194787 CTTCCCGAGCACAGGGAAGGAGG - Intronic
904404364 1:30276251-30276273 CTCACTGACAATGGGGAAGGTGG - Intergenic
904711345 1:32432805-32432827 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
904934564 1:34120897-34120919 CTCGCTGGGCATATGGCAGGAGG - Intronic
905503070 1:38454646-38454668 CTTACTGGACATAGAGAAGGGGG + Intergenic
905923805 1:41736044-41736066 CTCATTGAGCATGGAAAAGGTGG - Intronic
906744838 1:48214334-48214356 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
906932601 1:50184196-50184218 TTCACTGAGCAGAGAGAAGAGGG - Intronic
908673359 1:66573751-66573773 ATCACTGAGCAGAGGGTTGGAGG + Intronic
909222920 1:72984963-72984985 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
909793274 1:79701554-79701576 CTCACGGAGCAGAGAGCAGGAGG + Intergenic
910144151 1:84058840-84058862 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
911038364 1:93572873-93572895 CTCCCTGAGCAAAGGGCAGCAGG + Intronic
911148313 1:94572306-94572328 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
912412484 1:109488470-109488492 CTCACCGTGCAGTGGGAAGGGGG - Intronic
912495196 1:110087121-110087143 GTCACTGGGCATAGGAATGGAGG + Intergenic
912744265 1:112232136-112232158 CTCTCTGAGCCTAGTGGAGGGGG - Intergenic
912813326 1:112810136-112810158 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
914241340 1:145854999-145855021 CTCACTGACCAAGGGGATGGAGG + Intronic
915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG + Intronic
915580170 1:156808735-156808757 CTCAGTGAGCTCAGGGGAGGGGG - Intronic
916055768 1:161068287-161068309 CTCACTGGGCAGAGTGGAGGTGG - Intronic
916328628 1:163591761-163591783 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
918568009 1:185953686-185953708 CTCACGGAGCAAAGAGCAGGAGG + Intronic
918594926 1:186282083-186282105 CTCAAAGAGCATATGGAAAGAGG - Intergenic
918714689 1:187770688-187770710 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
919306577 1:195848058-195848080 CTCACTGAACAAAGAGCAGGAGG + Intergenic
919476071 1:198035112-198035134 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
920068023 1:203282824-203282846 GTGGCTGAGAATAGGGAAGGTGG + Intergenic
921519857 1:216146107-216146129 CTCACAGAGCAAAGAGCAGGAGG - Intronic
921625352 1:217373029-217373051 GTCAATGAGCATGGGGAGGGAGG + Intergenic
921732530 1:218594116-218594138 CTCATGGAGCAAAGGGCAGGAGG - Intergenic
922048119 1:221966410-221966432 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
922154364 1:223029624-223029646 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
922880755 1:228978817-228978839 GACACTGAGCAGAGAGAAGGCGG - Intergenic
924024697 1:239819978-239820000 CTCACTGGGCAGTGAGAAGGTGG + Intronic
924180332 1:241434345-241434367 CTCACAGAGCAAAGAGAAGGAGG - Intergenic
1062930522 10:1349476-1349498 CTCACAGAGCAAAGAGCAGGAGG - Intronic
1062992653 10:1834814-1834836 GTCACTGAGCCGAGGGAAGAGGG + Intergenic
1063362812 10:5471235-5471257 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1063611855 10:7569551-7569573 CTCACTGAGCGTCTGTAAGGTGG + Intronic
1064664095 10:17631979-17632001 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1064887301 10:20124457-20124479 CTCACGGAGCAAAGGACAGGAGG + Intronic
1067360090 10:45571624-45571646 CTCACAGAGCAAAGAGCAGGAGG - Intronic
1070370593 10:75778412-75778434 CTCACAGAGCAGGGGGAAGGTGG - Intronic
1071515728 10:86295485-86295507 TTCACTGAGGAGAGAGAAGGTGG - Intronic
1073554368 10:104434406-104434428 TTCAATGAGCATAGTGTAGGAGG + Intronic
1073683294 10:105728058-105728080 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1074948282 10:118302785-118302807 ATCACAAACCATAGGGAAGGAGG - Exonic
1075248436 10:120845455-120845477 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1076030140 10:127150340-127150362 CCCACTGAGCAAAGAGAAAGGGG - Intronic
1076937321 10:133575094-133575116 GTCTGTGAGCACAGGGAAGGAGG + Intergenic
1077611880 11:3648362-3648384 CTCACAGAGCAAAGAGCAGGAGG - Intronic
1077766702 11:5165628-5165650 CTCACGGAGCAAAGAGCAGGAGG + Intronic
1077775704 11:5269496-5269518 CTCACTCAGCTTAGCAAAGGCGG + Exonic
1078149863 11:8749306-8749328 CTCACTCAGTACAGGGAAGCTGG + Intronic
1079377817 11:19909526-19909548 CTCACTGAGGGTATGGAAAGTGG - Intronic
1080446925 11:32345984-32346006 CTCTCTGCCCACAGGGAAGGTGG - Intergenic
1081119069 11:39241854-39241876 CTCACTGAGCTGAGGGTTGGAGG + Intergenic
1082782774 11:57300268-57300290 GTCCCTGAGCACAGGGAAGCAGG + Intronic
1083766834 11:64845265-64845287 CACACTGAGGCTTGGGAAGGAGG + Intergenic
1084245853 11:67856534-67856556 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1084613593 11:70219678-70219700 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1084803627 11:71564166-71564188 TTAACTGAGCAGTGGGAAGGAGG + Intronic
1084826818 11:71737980-71738002 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1086004787 11:82025914-82025936 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1086550834 11:88049690-88049712 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1086644061 11:89197091-89197113 CTCACTGAGCAGAGAAGAGGAGG + Intronic
1087196595 11:95309944-95309966 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1087839844 11:102909423-102909445 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1089104398 11:115990157-115990179 CTCGCTGGGCATGGGGAAGGCGG - Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089329735 11:117680953-117680975 CTCAAAGAGCATGGGGAAGGGGG + Intronic
1089987095 11:122824886-122824908 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1090208324 11:124897850-124897872 CTCACAGTGAAGAGGGAAGGAGG + Exonic
1090527071 11:127547991-127548013 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1090546780 11:127774423-127774445 CTCACGGAGCAAAGCAAAGGAGG + Intergenic
1090850864 11:130569454-130569476 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1092416436 12:8293664-8293686 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1092470720 12:8777659-8777681 CTCACTCATCATCAGGAAGGGGG - Intronic
1092925107 12:13265042-13265064 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1093071447 12:14710081-14710103 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1093268288 12:17026857-17026879 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1093341092 12:17974746-17974768 CTAACTGAGCATGGAAAAGGAGG + Intergenic
1093584786 12:20822109-20822131 CTCACGGAGCAAAGAGCAGGAGG + Intronic
1094316359 12:29140276-29140298 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1094500679 12:31018288-31018310 CTGAGTGGGCCTAGGGAAGGAGG + Intergenic
1095295111 12:40518670-40518692 TTCTCTGAGCACAGGGAAGGTGG - Intronic
1095295972 12:40527911-40527933 CTCACTGAGCATGAGGCAGATGG - Intronic
1095637430 12:44450519-44450541 CTCACCGAGCAAAGAGCAGGAGG - Intergenic
1095981823 12:47978512-47978534 CTCACAGAGCATGGGGTAGGAGG - Intronic
1096098684 12:48956098-48956120 CTGATTGAGGACAGGGAAGGAGG + Intronic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1096773252 12:53949750-53949772 CACAGGGAGCACAGGGAAGGGGG + Intergenic
1097195808 12:57241963-57241985 CTCAGTGAGGCTAGGGAGGGGGG + Intergenic
1097417336 12:59328427-59328449 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1098441668 12:70525673-70525695 CTCACGGAGTATAAGGAAGGGGG - Intronic
1098715867 12:73828041-73828063 CTCAGTGATCAAAGGCAAGGTGG + Intergenic
1100886744 12:99079323-99079345 CAAACTGAGGATAGAGAAGGGGG + Intronic
1101343461 12:103863727-103863749 CTCAGTGAGCAAAGAGCAGGAGG - Intergenic
1101900738 12:108789490-108789512 CTCACTGACCAAAAGGCAGGAGG - Intronic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1104934588 12:132357779-132357801 CTCACTGAGCGCAGGGCGGGGGG - Intergenic
1105898926 13:24740625-24740647 CCCACTGAGCACAGGCCAGGCGG - Intergenic
1106285607 13:28316144-28316166 CTGCCTGAGCGTAGGGAAGCGGG - Intronic
1108512697 13:51170370-51170392 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1108804109 13:54132683-54132705 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1114252997 14:20977565-20977587 TGCCCTGAGCATAGGGCAGGTGG - Intergenic
1114495258 14:23127545-23127567 GTCAGTGGGCACAGGGAAGGTGG - Intronic
1115116308 14:29884724-29884746 TTCACTGAGCGTGGAGAAGGAGG + Intronic
1116573190 14:46544523-46544545 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1116613239 14:47104733-47104755 CTCACGGAGCAAAGAGCAGGAGG - Intronic
1116702658 14:48260463-48260485 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1116703614 14:48267794-48267816 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1118937613 14:70301461-70301483 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1119316865 14:73703824-73703846 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119704623 14:76776053-76776075 CTCGCTGAGCGTGCGGAAGGCGG - Exonic
1120438359 14:84505487-84505509 CTCACTGAGCAAAGAACAGGAGG + Intergenic
1121289128 14:92760259-92760281 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1124201943 15:27686308-27686330 CTCCCTGTGCTTAGGGATGGAGG - Intergenic
1124828086 15:33119503-33119525 CCCACTGAGCGTACGGACGGTGG - Intronic
1125045437 15:35239116-35239138 CTCACGGAGCAAAGAGCAGGAGG - Intronic
1125470513 15:39997905-39997927 CTTACTGAGCAGAGTGAAGCAGG + Intronic
1126317980 15:47391204-47391226 CTCAGAGAGCAGAGGAAAGGAGG - Intronic
1126843448 15:52739043-52739065 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1127115005 15:55717974-55717996 CTCACGGAGCAAAGAGCAGGAGG - Intronic
1127285228 15:57526868-57526890 CACGCTGGGCATTGGGAAGGGGG + Intronic
1127849747 15:62902186-62902208 CTCACAGACAATAGGGAAGAAGG + Intergenic
1128287950 15:66454074-66454096 CTCACAGAGGATGGGGAAAGAGG - Intronic
1129192340 15:73944774-73944796 TTAACTGAACAGAGGGAAGGAGG + Intronic
1129259188 15:74354593-74354615 CTCACTGAGCAAAGAGCAGGAGG - Intronic
1130332728 15:82934387-82934409 CTAAAGGAGCATGGGGAAGGAGG - Intronic
1130871865 15:87978176-87978198 TCCACTGAGGAGAGGGAAGGGGG - Intronic
1132262699 15:100440663-100440685 CTCACAGAGCAAAGAGCAGGAGG - Intronic
1133310493 16:4843045-4843067 TTGACTGAGCATCTGGAAGGTGG + Intronic
1134362269 16:13542596-13542618 CTCATTCAGCATAGAGTAGGGGG - Intergenic
1135033516 16:19057802-19057824 CTCACTGAATGAAGGGAAGGTGG - Intronic
1135843289 16:25895715-25895737 CTCACACAGCAGAGGGAAAGAGG + Intronic
1137055594 16:35745224-35745246 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1137480812 16:48850427-48850449 CTCAATCAGCACTGGGAAGGTGG - Intergenic
1139039724 16:62985026-62985048 CTCACGGAGCAAAGGGCAGGAGG + Intergenic
1139380619 16:66528281-66528303 GTCTCTGAGCACAGGGATGGAGG + Intronic
1139469220 16:67169537-67169559 CTAACTGAGCAGAAGGCAGGCGG + Intronic
1139944000 16:70625937-70625959 CTCACAGAGCAAAGAGCAGGAGG + Intronic
1140616564 16:76671435-76671457 CACACTGAGCTTAGGGATAGGGG + Intergenic
1141061870 16:80880887-80880909 CTCATTCACAATAGGGAAGGAGG + Intergenic
1141232820 16:82186257-82186279 CTCAGTGAGCACAAGGAATGAGG + Intergenic
1141865484 16:86747127-86747149 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1141962077 16:87415672-87415694 CTCACAGAGCAGAGGGCAAGTGG - Intronic
1142238516 16:88934532-88934554 CACACTGTGCACAGGGAAGATGG - Intronic
1143408106 17:6691347-6691369 CTGACTGGGTATAAGGAAGGAGG - Intronic
1143521877 17:7448936-7448958 TTCACTGAGCGGAGGAAAGGTGG - Intronic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1145962003 17:28892275-28892297 CTCAATGTGCAGTGGGAAGGTGG + Intronic
1146428985 17:32773081-32773103 CTCACAGAGCAAAGAGCAGGAGG - Intronic
1146443077 17:32914022-32914044 GTCCCTGAGCAAAAGGAAGGAGG + Intergenic
1146689903 17:34866175-34866197 CTCAGTGAGGTTAAGGAAGGTGG - Intergenic
1146816043 17:35943450-35943472 GTCACTGAGCCTCGGGAAGCAGG + Intronic
1147653766 17:42076908-42076930 CTCACTGGGCAAGTGGAAGGTGG - Intergenic
1148336969 17:46848452-46848474 CCCACAGGGCAGAGGGAAGGTGG + Intronic
1148360866 17:47010866-47010888 GTCACTGAGCCTCGGGAAGGAGG - Intronic
1149344519 17:55720954-55720976 CTCACTGACCAGAGGGACTGTGG + Exonic
1149992811 17:61392229-61392251 GTCACTAAGCTTGGGGAAGGTGG - Exonic
1150785669 17:68161292-68161314 GTCACTGAGCCTCGGGAAGGAGG + Intergenic
1152032291 17:77851472-77851494 CTCACAGAGAACAGAGAAGGAGG - Intergenic
1152858377 17:82679733-82679755 GTCACCGAGCACAGGGCAGGGGG + Intronic
1154085039 18:11295789-11295811 CTCCCAGAGTATAGGTAAGGAGG - Intergenic
1155817433 18:30331367-30331389 TATACTGAACATAGGGAAGGAGG - Intergenic
1156237115 18:35216466-35216488 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1157395344 18:47336475-47336497 TTCACAGAGCATAGGGAAGTTGG + Intergenic
1157440882 18:47710811-47710833 CTCACTAACCAAAGGGAAGAGGG + Intergenic
1157487888 18:48101521-48101543 CTCACTGAGCACTGGAAACGTGG - Intronic
1158099743 18:53817727-53817749 CTGACTTAGCCTAGGGAATGAGG - Intergenic
1158302347 18:56066063-56066085 CTCCCTTAGCATTGGGGAGGTGG + Intergenic
1158336051 18:56415939-56415961 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1158394958 18:57071974-57071996 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1159550025 18:69885341-69885363 CTCACTGTCCCTAAGGAAGGAGG + Intronic
1159929000 18:74293245-74293267 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1161550153 19:4908465-4908487 CCCACTGAGCAAAGGGGAGGGGG - Intronic
1161587249 19:5112383-5112405 GTCACTGCTCAAAGGGAAGGGGG - Intronic
1161661439 19:5549070-5549092 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1162242450 19:9365935-9365957 CTCACAGAGCAAAGAGCAGGAGG + Intronic
1163251621 19:16129263-16129285 CTCACAGGGCTTAGGGGAGGTGG + Intronic
1163384297 19:16989896-16989918 CTCCCTGAGGATTGGGGAGGGGG - Intronic
1165127837 19:33613250-33613272 CTCTCTGAGGACAGGGACGGGGG + Intergenic
1165497275 19:36160502-36160524 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1165510614 19:36264715-36264737 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1167046876 19:47054899-47054921 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1168051328 19:53831910-53831932 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
926407447 2:12570163-12570185 TTCACAGAGCAAAGGGCAGGAGG - Intergenic
927187430 2:20491937-20491959 CTCCCTCAGCCTGGGGAAGGAGG - Intergenic
929793375 2:45039681-45039703 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
930185805 2:48411040-48411062 GTCCCTGAGGATAGGGATGGGGG - Intergenic
930487598 2:52027109-52027131 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
931625462 2:64252951-64252973 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
931850123 2:66244392-66244414 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
932159750 2:69448866-69448888 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
933649703 2:84840702-84840724 CTTGCTGAGGGTAGGGAAGGGGG - Intronic
934557069 2:95293145-95293167 CTCAGGGAGAGTAGGGAAGGGGG - Intergenic
935189877 2:100768574-100768596 CTCCCTGAGCATTGTGATGGAGG - Intergenic
936166964 2:110129213-110129235 CTCCAAGAGCATGGGGAAGGTGG + Exonic
936794516 2:116189222-116189244 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
938488405 2:131740068-131740090 TTCAGAGAGCATAGAGAAGGAGG + Intronic
938742283 2:134244363-134244385 ATCAATGAGCACAGGGAAGAAGG - Intronic
939460969 2:142494867-142494889 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
939984600 2:148817001-148817023 CTCACTCAGCTGAGGGTAGGGGG - Intergenic
941026386 2:160460806-160460828 CTCACAGAGCTTAGGGACTGGGG - Intronic
941068341 2:160928527-160928549 CTTGCTGGGAATAGGGAAGGAGG - Intergenic
941456468 2:165715640-165715662 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
941520230 2:166533218-166533240 AACACTGAGCAGAGGGAGGGAGG - Intergenic
941936186 2:170982908-170982930 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
942184070 2:173407644-173407666 TTCACTTAGCATAGGGCAGTTGG - Intergenic
942642642 2:178075716-178075738 CTCACTGGGCAAAGAGTAGGAGG + Intronic
942730547 2:179056854-179056876 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
943061319 2:183044535-183044557 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
944507150 2:200424615-200424637 CTCAGGAAGCATAGGGCAGGAGG - Intronic
945071071 2:205989489-205989511 GTGACTGAGCATAAGGAATGTGG - Intergenic
945360834 2:208894222-208894244 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
945375803 2:209078525-209078547 CTCACGGAGCAAAGAGAAGGAGG - Intergenic
945394043 2:209299846-209299868 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
946781330 2:223195024-223195046 CTCACGGAGCAAAGAGCAGGAGG + Intronic
947078543 2:226370056-226370078 CTCACTGATGCTGGGGAAGGTGG + Intergenic
947832717 2:233153116-233153138 TTCACTGGGCGTGGGGAAGGTGG + Intronic
948131931 2:235607447-235607469 CTCACAGAGCCCAGGGCAGGAGG + Intronic
948170539 2:235898259-235898281 CTCAATAAGCAAAGGGAACGGGG + Intronic
1168943559 20:1733062-1733084 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1169335063 20:4749060-4749082 CTGACTGAACAAAGAGAAGGAGG + Intergenic
1169858803 20:10131052-10131074 CTTACTGAGCCTGGGAAAGGGGG - Intergenic
1170069145 20:12345430-12345452 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1170165584 20:13358386-13358408 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1170820982 20:19756270-19756292 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1172625597 20:36344856-36344878 CTCGATGTGCCTAGGGAAGGAGG - Intronic
1173349876 20:42234860-42234882 CACACTGAGCAGAGGGGATGGGG + Intronic
1173744852 20:45428393-45428415 CTCACTGATAATAGTGGAGGTGG - Intergenic
1173781346 20:45759807-45759829 CTCACGGAGCAAAGAGCAGGAGG - Intronic
1177100335 21:16892667-16892689 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1177862702 21:26473567-26473589 TCCACTGAGCACAGTGAAGGGGG - Intronic
1179286173 21:39979083-39979105 CTCACTGAGCCTGGGCAAGGTGG + Intergenic
1180560609 22:16611801-16611823 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1180588951 22:16919393-16919415 CTCACAGAGGGTGGGGAAGGTGG + Intergenic
1181146582 22:20852689-20852711 CTCACAAAGCAAAGGGAAAGAGG + Intronic
1181381520 22:22508446-22508468 CCCGCTGAGATTAGGGAAGGGGG + Intronic
1181761995 22:25065074-25065096 CTGCCTGAGCATAGGCAGGGAGG + Intronic
1182113651 22:27742488-27742510 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1182998371 22:34835077-34835099 CTCACGGAGCAGAGAGCAGGAGG - Intergenic
1183463938 22:37969488-37969510 ATCACTGAGGATGTGGAAGGAGG - Intronic
1184692597 22:46123981-46124003 CTCACTGGGCCTGGGGGAGGTGG + Intergenic
949670849 3:6398096-6398118 CTCACCGAGCAAAGAGCAGGAGG - Intergenic
950926187 3:16744736-16744758 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
951763047 3:26165396-26165418 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
952604398 3:35126789-35126811 CTCTCTGAGGATAATGAAGGGGG + Intergenic
953077449 3:39583131-39583153 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
954795620 3:53160173-53160195 CTCACAGAGCAATGAGAAGGTGG - Intronic
954969554 3:54639675-54639697 CTCACGGAGCAAAGAGCAGGAGG + Intronic
955253111 3:57304318-57304340 CTCACCGAGCAAAGAGCAGGAGG - Intronic
955711663 3:61785876-61785898 CACACTTAGCTTAGGGAAGTAGG + Intronic
956708949 3:72023588-72023610 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
959641586 3:108643693-108643715 CTCACTGAGCATTGGAAATGCGG - Intronic
959771616 3:110105746-110105768 ATGACTGAGCACAGGGAAGATGG - Intergenic
959972562 3:112422836-112422858 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
961293209 3:125864150-125864172 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
961730293 3:128960305-128960327 CTCACGGAGCAAAGAGCAGGAGG - Intronic
961981011 3:131078487-131078509 CTCACTGAGAAATGGGATGGGGG + Intronic
962660379 3:137596104-137596126 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
963319501 3:143797994-143798016 CTCACGGAGCAAAGAGCAGGAGG - Intronic
963684016 3:148414750-148414772 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
964025029 3:152062626-152062648 GCCAGTAAGCATAGGGAAGGTGG + Intergenic
965262923 3:166505942-166505964 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
965334816 3:167422899-167422921 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
966105377 3:176326835-176326857 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
966233051 3:177670603-177670625 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
966933564 3:184691313-184691335 CATTCTGAGCATAGGGCAGGCGG - Intergenic
967853332 3:194098302-194098324 CTCACTGACCACAGGGCAGTGGG + Intergenic
969004069 4:4005334-4005356 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
970374037 4:15438514-15438536 CTCATTTAGGATAGGGAAGTTGG - Intronic
971180276 4:24323771-24323793 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
971199827 4:24501481-24501503 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
971314307 4:25554415-25554437 CTCACTGAGAGGAGGGGAGGAGG + Intergenic
972098752 4:35383959-35383981 CACACTGAGGAAAGGTAAGGTGG + Intergenic
974428679 4:61769465-61769487 CTCACGGAGCAAAGAGCAGGAGG + Intronic
976740187 4:88348705-88348727 GTCACTGAGCAAAGAGCAGGAGG + Intergenic
977041711 4:92026296-92026318 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
977217444 4:94298388-94298410 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
977225655 4:94388790-94388812 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
978001410 4:103558965-103558987 CTCACAGAGCAAAGTGTAGGAGG + Intergenic
978031220 4:103941779-103941801 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
979380958 4:120006111-120006133 TTCAGTGAGCACAGTGAAGGAGG + Intergenic
979695801 4:123611790-123611812 CACACAGATCATAGGTAAGGAGG - Intergenic
980575924 4:134683068-134683090 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
981524839 4:145699327-145699349 CTCACAGAGCAAAGAGCAGGAGG - Intronic
981584410 4:146285699-146285721 CTCAGTGAGCCTTGGGAAGGAGG + Intronic
982208714 4:153017982-153018004 CACCCTGAGACTAGGGAAGGAGG + Intergenic
983447773 4:167876764-167876786 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
984393890 4:179170042-179170064 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
985063981 4:186104460-186104482 CTCTCTGACGATAGGGAAGGTGG - Intronic
986214426 5:5705692-5705714 CTCACAGAGCAGAAGGAATGAGG + Intergenic
986369220 5:7063257-7063279 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
986407063 5:7436914-7436936 ACCACTCAGCATGGGGAAGGTGG - Intronic
987671373 5:21014422-21014444 CTTACTGAGCATAGACAAGAAGG - Intergenic
987782232 5:22454125-22454147 CTTACTGTCCATGGGGAAGGGGG + Intronic
988518811 5:31928000-31928022 CTCACTGAGAATATGTAAGGAGG + Intronic
988730484 5:33967942-33967964 CTCTCTTATCTTAGGGAAGGGGG + Intronic
989432685 5:41374065-41374087 CTAACTGAGCCTAGGGAGGAGGG + Intronic
989659704 5:43786914-43786936 CTCATTGAGCAAAGAGCAGGAGG - Intergenic
991178082 5:63714122-63714144 CACACTAAGCTTAGGAAAGGTGG - Intergenic
991450407 5:66744984-66745006 CTAAGAAAGCATAGGGAAGGGGG + Intronic
992164404 5:74034905-74034927 CTCACAGGGCATTTGGAAGGTGG - Intergenic
993899009 5:93571957-93571979 CTGACTGAGCAAAGGGAAATCGG + Intergenic
994126350 5:96171868-96171890 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
995296588 5:110531387-110531409 CTCACAGAGCAAAGAGCAGGAGG - Intronic
995486266 5:112643432-112643454 CTCACTTACCATAGAGAAAGTGG + Intergenic
996052898 5:118952192-118952214 CTCACGGAGCAAAGAGCAGGAGG + Intronic
996345075 5:122478656-122478678 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
996358858 5:122623845-122623867 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
996754927 5:126925681-126925703 CCCACTGAGCTGAGGGAGGGGGG + Intronic
996837391 5:127808609-127808631 CTCACTCTGCAAAGGGATGGAGG - Intergenic
997262170 5:132473744-132473766 CTCACTGAGGTTTGGGGAGGGGG + Intronic
997532719 5:134592144-134592166 CTGACTGACCAGAGGCAAGGAGG + Intergenic
997788680 5:136737488-136737510 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
998392296 5:141795186-141795208 CTCTCTGAGCCTAGGGAGGAAGG - Intergenic
998593895 5:143507476-143507498 GACACTGAGCATAGGGAGGCAGG - Intergenic
998996663 5:147874000-147874022 CTCACGGAGCAAAGAGCAGGAGG + Intronic
1000519722 5:162280673-162280695 CTCACCGAGCAAAGAGCAGGAGG + Intergenic
1001264276 5:170261238-170261260 CCCACTGAGCCTAGGGAAGATGG + Intronic
1001775898 5:174328953-174328975 CACACTGAGTCTAAGGAAGGTGG + Intergenic
1002611273 5:180419995-180420017 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1005993322 6:30916864-30916886 CTCTCTGGGCACAGGAAAGGTGG + Exonic
1006055550 6:31381883-31381905 CTAATTCAGCATGGGGAAGGGGG + Intergenic
1006645752 6:35512941-35512963 CTCCTTGAGCAGGGGGAAGGGGG - Intergenic
1006786209 6:36669096-36669118 ACCACTGAGGATAGGGAAGAGGG + Intergenic
1007166062 6:39829954-39829976 CTAACTCAGCGTGGGGAAGGAGG - Intronic
1007251600 6:40499075-40499097 CTCACTTAGAATGAGGAAGGAGG + Intronic
1007312643 6:40958795-40958817 CTGCCTGAGCATAGAGGAGGAGG - Intergenic
1009464119 6:63950647-63950669 CTCACGGAGCAAAGAGCAGGAGG - Intronic
1010071967 6:71753584-71753606 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1010827205 6:80487631-80487653 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1010841574 6:80652905-80652927 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1012848467 6:104419090-104419112 CTAACAGACCATAGGGAAAGAGG + Intergenic
1013299852 6:108794762-108794784 ATCTCTGAGCATAGAGAGGGCGG - Intergenic
1013891384 6:115032299-115032321 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1014395702 6:120925290-120925312 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1014891270 6:126849330-126849352 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1015164911 6:130192766-130192788 CTCACGGAGCAAAGAGCAGGAGG - Intronic
1016114428 6:140262592-140262614 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1016204244 6:141453280-141453302 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1016518506 6:144923662-144923684 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1016650661 6:146455960-146455982 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1017926091 6:158912829-158912851 CTCACTGAGCACAGGGAGTGGGG - Intergenic
1018077339 6:160229105-160229127 CTCACAGAGCAAAGAGCAGGAGG - Intronic
1018495770 6:164344294-164344316 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1020324209 7:6961835-6961857 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1021810363 7:24396753-24396775 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1023627153 7:42127409-42127431 CTCATTGAGAAGAGGGAAGTGGG - Intronic
1023699191 7:42875846-42875868 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1023805595 7:43870575-43870597 CACACTGAGAAGAGGGAAAGAGG + Intronic
1024053993 7:45648049-45648071 CTCACAGGGCACATGGAAGGTGG - Intronic
1024110854 7:46145117-46145139 TTCACTGGGCATTGGGAAGGAGG + Intergenic
1024308458 7:47947642-47947664 CGCACAGAGCATGGGGAAGAGGG + Intronic
1024410517 7:49036109-49036131 ATCACTGAGCATGTGGAAGGGGG - Intergenic
1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG + Intronic
1026888980 7:73971175-73971197 CTCACTGAGCAGGGGGAGTGAGG + Intergenic
1030446011 7:109647088-109647110 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1030751799 7:113238762-113238784 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1030993350 7:116328265-116328287 TTCACTGTGCATTTGGAAGGAGG + Intronic
1031004397 7:116456119-116456141 CTCACGGAGCAAAGAGCAGGAGG - Intronic
1031296387 7:120009685-120009707 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1031365041 7:120890906-120890928 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033585536 7:142771926-142771948 CTCAGTGAGGCTAGGCAAGGGGG - Intergenic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1035415915 7:158685911-158685933 CTCACTGGGCATTTGGAACGTGG - Intronic
1035935571 8:3834327-3834349 CTCACTGCTTATAGGTAAGGTGG + Intronic
1036371857 8:8169130-8169152 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1036639161 8:10571537-10571559 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1036879045 8:12496514-12496536 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1037611540 8:20480386-20480408 GTCACAGATCAAAGGGAAGGAGG + Intergenic
1038041124 8:23725284-23725306 TTTGCTGAGAATAGGGAAGGAGG - Intergenic
1044258890 8:90095359-90095381 CTCACAGAGCAAAGAGCAGGAGG + Intronic
1044416777 8:91948481-91948503 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1045644485 8:104286395-104286417 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1046558982 8:115815108-115815130 CTCACCGAGCAAAGAGCAGGAGG - Intergenic
1048728675 8:137413406-137413428 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1048764534 8:137830089-137830111 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1050258377 9:3816289-3816311 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1050296137 9:4207239-4207261 CACACTATGCAGAGGGAAGGTGG + Intronic
1050297725 9:4222889-4222911 TGCACTGAGCAGAGGGAACGGGG + Intronic
1050575734 9:6993588-6993610 TTCACTGTCCATAGAGAAGGAGG + Intronic
1051336532 9:16070871-16070893 CTAACTAAGCATCGGGAAAGGGG - Intergenic
1051361672 9:16286443-16286465 CCCACTGAGCAGAGGGACCGAGG + Intergenic
1051849595 9:21490969-21490991 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1052917430 9:33934178-33934200 CTCACTGTGCATTTGGAAGTAGG - Intronic
1053447480 9:38164185-38164207 CTCACTGTGCAAAGGGAAGCAGG + Intergenic
1053619394 9:39800208-39800230 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053877554 9:42559547-42559569 CTCACTGTTCCTAGGGAAGCAGG + Intergenic
1053895100 9:42734830-42734852 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054234140 9:62542147-62542169 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054264762 9:62907235-62907257 CTCACTGTTCCTAGGGAAGCAGG - Intergenic
1054807742 9:69409830-69409852 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1055300046 9:74873272-74873294 CTGAGAGAGCATGGGGAAGGAGG - Intronic
1055348036 9:75357086-75357108 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1056045011 9:82705771-82705793 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1056437570 9:86588510-86588532 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1056450937 9:86716212-86716234 CACACTGAGCATAGACAAGGAGG + Intergenic
1056882718 9:90413200-90413222 CTCACGGAGCACAGAGCAGGAGG - Intergenic
1057852284 9:98574950-98574972 CTCAATGATCAGAGGGATGGAGG - Intronic
1058425408 9:104871368-104871390 CTTACTGAGAAGAGGGAAGGTGG + Intronic
1059574286 9:115473688-115473710 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1059982806 9:119791918-119791940 TTGACTGAGCAAAGGCAAGGAGG + Intergenic
1061578249 9:131521296-131521318 CTCCCTGAGCAGAGGGCAGGTGG + Intronic
1061582788 9:131547676-131547698 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1062267297 9:135693030-135693052 CTCACTGTGCATGGGGAATAGGG - Intergenic
1185858881 X:3559652-3559674 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1185932823 X:4221868-4221890 CCAACTGAGCATGGGGAATGGGG - Intergenic
1186565717 X:10660118-10660140 CTCACAGAGCAAAGGAAAGATGG + Intronic
1186783777 X:12940332-12940354 CTCACAGAGCAGAGAGCAGGAGG - Intergenic
1187100191 X:16183951-16183973 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1187347760 X:18481968-18481990 CTCACTGGGCATAGAGCTGGGGG + Intronic
1187765776 X:22640229-22640251 CTCACTGAGTATAGGGCAGGAGG - Intergenic
1188301293 X:28507385-28507407 CTCACAGAGCAAAGGGCAGGAGG + Intergenic
1188886096 X:35551496-35551518 ATCACAGAGTAAAGGGAAGGAGG + Intergenic
1189032050 X:37460784-37460806 CTCACAGAGCAAAGAGCAGGAGG + Intronic
1190109582 X:47581502-47581524 ATGAATGAGCATTGGGAAGGGGG - Intronic
1192705841 X:73528179-73528201 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1194186554 X:90778629-90778651 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1194503290 X:94704099-94704121 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1194919904 X:99751950-99751972 CTGACAGAGAACAGGGAAGGAGG - Intergenic
1195001442 X:100647072-100647094 CTCAGTGAGAAGAGGGAAAGGGG + Intronic
1195279617 X:103318350-103318372 ATCAGTGAACAAAGGGAAGGAGG + Intergenic
1195908953 X:109870346-109870368 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1196299743 X:114040544-114040566 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1196342054 X:114606716-114606738 CTCACGGAGCAAAGAGCAGGAGG + Intronic
1196572199 X:117279634-117279656 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1197064615 X:122222510-122222532 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1197352347 X:125394032-125394054 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1198060633 X:133042424-133042446 CTCCCTCAGCCAAGGGAAGGCGG - Intronic
1198525335 X:137494647-137494669 CTCACTGAGCCTAAAGAATGAGG - Intergenic
1198598132 X:138259115-138259137 CTCACAGAGCAAAGAGCAGGAGG - Intergenic
1198599692 X:138269554-138269576 CTCACAGAGCAAAGAGCAGGAGG + Intergenic
1198983970 X:142428471-142428493 CTCACGGAGCAAAGAGCAGGAGG + Intergenic
1200310418 X:155071602-155071624 CGCTCTGAGCACAGAGAAGGAGG + Exonic
1200659309 Y:5941616-5941638 CTCACGGAGCAAAGAGCAGGAGG - Intergenic
1200676440 Y:6152010-6152032 CTCCGTCAGCCTAGGGAAGGAGG + Intergenic
1201575057 Y:15454639-15454661 CTCACTGGGCAGGGGGAAGGTGG + Intergenic
1202076845 Y:21044669-21044691 CTCACAGAGCAAAGAGCAGGAGG + Intergenic