ID: 915248661

View in Genome Browser
Species Human (GRCh38)
Location 1:154573029-154573051
Sequence CAGCTGTCCTAGAGGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915248661_915248664 -10 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248664 1:154573042-154573064 AGGACAGCTGCCATTCTGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 181
915248661_915248671 12 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248671 1:154573064-154573086 GGGGATGAAGAAGGGCACTGCGG 0: 1
1: 1
2: 5
3: 64
4: 473
915248661_915248666 -8 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248666 1:154573044-154573066 GACAGCTGCCATTCTGGCTGGGG 0: 1
1: 0
2: 0
3: 36
4: 243
915248661_915248670 4 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248670 1:154573056-154573078 TCTGGCTGGGGGATGAAGAAGGG 0: 1
1: 0
2: 6
3: 47
4: 492
915248661_915248673 18 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248673 1:154573070-154573092 GAAGAAGGGCACTGCGGTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 184
915248661_915248665 -9 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248665 1:154573043-154573065 GGACAGCTGCCATTCTGGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 194
915248661_915248672 17 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248672 1:154573069-154573091 TGAAGAAGGGCACTGCGGTGTGG 0: 1
1: 0
2: 1
3: 11
4: 182
915248661_915248669 3 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248669 1:154573055-154573077 TTCTGGCTGGGGGATGAAGAAGG 0: 1
1: 0
2: 4
3: 42
4: 381
915248661_915248667 -7 Left 915248661 1:154573029-154573051 CCAGGTTTCCTCTAGGACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 200
Right 915248667 1:154573045-154573067 ACAGCTGCCATTCTGGCTGGGGG 0: 1
1: 0
2: 5
3: 30
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915248661 Original CRISPR CAGCTGTCCTAGAGGAAACC TGG (reversed) Intronic
901237535 1:7675564-7675586 CAGCACCCCTACAGGAAACCAGG - Intronic
901437622 1:9257670-9257692 CAGCTGGGCTAGAAGAAGCCAGG + Intronic
901892585 1:12280282-12280304 CAGCTGTTCTGGAGTAACCCAGG + Intronic
903662195 1:24984942-24984964 CAGCTGTCCTGGTGGATTCCAGG + Intergenic
908410641 1:63861140-63861162 CAGCTGTCCAGGAGGAATCCGGG + Intronic
912692728 1:111816374-111816396 AAGCTTTCCTGGAGGAAACAAGG - Intronic
913211886 1:116589179-116589201 GAACTGTGCTGGAGGAAACCTGG - Intronic
913429275 1:118772218-118772240 CAGCCTTCCTAGATTAAACCAGG + Intergenic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
915687548 1:157649881-157649903 GAACTGTCATAGAAGAAACCTGG - Intergenic
915999675 1:160602917-160602939 CAGCCCTCCTAGATTAAACCAGG - Intergenic
917913327 1:179674753-179674775 CAACTGTCCTAGATTAAACCAGG - Intronic
918417031 1:184320748-184320770 CAGCTGTCCATGAGGAGAGCTGG + Intergenic
920202467 1:204267975-204267997 CATCTGTCCATCAGGAAACCGGG + Intronic
921496681 1:215851468-215851490 CAACTCTCCTAGATTAAACCAGG + Intronic
922099874 1:222471412-222471434 CAGCTGTGCCAGGGGAAAGCTGG + Intergenic
923877368 1:238063516-238063538 CAGCTGAACTATAGCAAACCTGG - Intergenic
1063939199 10:11109585-11109607 TAGCTGTGTCAGAGGAAACCTGG - Intronic
1069599179 10:69692536-69692558 CAGCTCCCCCAGAGGAAACAGGG - Intergenic
1070769636 10:79074739-79074761 CAGCTGAGCTACAGAAAACCAGG - Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1073191671 10:101655634-101655656 TAGCTGTCCTAGAGAAACCTGGG - Intronic
1075188377 10:120283866-120283888 CAGCTTTCAAAAAGGAAACCTGG - Intergenic
1075942707 10:126405281-126405303 TGACTGTCCTAGAGGCAACCAGG - Intergenic
1077413473 11:2414031-2414053 CAGCTCTCCTCGAGGACAGCTGG + Intronic
1077571021 11:3338802-3338824 CTGATGTACTAGAGGAGACCTGG + Intergenic
1080787215 11:35486567-35486589 CTGCTGTCCTTGAGAAAGCCTGG + Intronic
1081935168 11:46899152-46899174 GGGCTGTCCCAGATGAAACCTGG - Intronic
1086855588 11:91861371-91861393 CATGTGTCCTGGAGGAAACATGG + Intergenic
1088817448 11:113431411-113431433 CAGCTGCCCTGGTGGAAGCCAGG + Intronic
1089010132 11:115125400-115125422 CCGCTGTCCTAGAGCACCCCAGG + Intergenic
1090682945 11:129081038-129081060 CAACCCTCCTAGAGTAAACCAGG + Intronic
1092527152 12:9316193-9316215 CAGCTGGCCTAGAGGCTACTGGG + Intergenic
1092540120 12:9415580-9415602 CAGCTGGCCTAGAGGCTACTGGG - Intergenic
1092711274 12:11340157-11340179 CAGCAGTCCTAGATCAAACTGGG - Intergenic
1094449236 12:30566761-30566783 AACATGTCCAAGAGGAAACCTGG + Intergenic
1094490994 12:30960514-30960536 CAGCAGACCTGGAGGAAAGCAGG - Intronic
1094512920 12:31106876-31106898 CAGCTGGCCTAGAGGCTACTGGG + Intergenic
1097348794 12:58524863-58524885 CAGCTGGCCTACAGGAAATTTGG - Intergenic
1099209773 12:79770024-79770046 CATCTGTCCTAAAGGACTCCAGG - Intergenic
1099295594 12:80824293-80824315 CAACTTTCCTAGATTAAACCAGG + Intronic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1100059251 12:90552711-90552733 CAACCCTCCTAGATGAAACCAGG - Intergenic
1102746707 12:115255309-115255331 CAACAGTCACAGAGGAAACCTGG - Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1103996532 12:124833855-124833877 GAGCTGTCCTAAGAGAAACCCGG + Intronic
1104337919 12:127918114-127918136 CAGGTGTCAAAGAGGAAACAGGG - Intergenic
1109819444 13:67633913-67633935 CAGCTCTCCTAGCAGAAGCCCGG + Intergenic
1110504972 13:76275095-76275117 CAACTCTCCTAGATTAAACCAGG + Intergenic
1111714876 13:91867289-91867311 CTGCTGTCCCAGTGGAAACAGGG + Intronic
1113440130 13:110322361-110322383 AAGCTGTCCAGGAGGGAACCGGG + Intronic
1113597289 13:111542313-111542335 CATCTGTCCTGGTGGAAAACAGG + Intergenic
1113883968 13:113647662-113647684 CGGCTGTCCTCGAGGACTCCGGG + Intergenic
1116912861 14:50489876-50489898 GAGATGTCCTACTGGAAACCTGG + Intronic
1117271630 14:54149997-54150019 CAGCCCTCCTAGATTAAACCAGG + Intergenic
1120785591 14:88532031-88532053 CAACTCTCCTAGATTAAACCAGG + Intronic
1122293269 14:100690968-100690990 CAGCTGCCCAAGAGGAGACTTGG - Intergenic
1122492437 14:102128138-102128160 AGGGTGTCCTAGAGGAGACCAGG + Intronic
1122808532 14:104275747-104275769 CGGCTGACCTACAGGAAACGCGG + Intergenic
1123908746 15:24945875-24945897 CATCTGTCCCACAGGAAAGCAGG - Intronic
1128328866 15:66742766-66742788 GAGCTGTCCTTAAGGAAGCCAGG + Intronic
1130319923 15:82833044-82833066 CAGCTGTCCTGGATTCAACCAGG + Intronic
1132939001 16:2497772-2497794 CAGCTGGCCTAGAGTCAGCCTGG - Intronic
1133780883 16:8938224-8938246 TAGCAGTCCTACAGGAATCCAGG - Intronic
1141004329 16:80337998-80338020 CAGCTGTCCTCCAGGAAAAGTGG + Intergenic
1141474299 16:84262083-84262105 GAGCAGGCCCAGAGGAAACCTGG - Intergenic
1141571787 16:84938575-84938597 CTGCTGTCTTAAAGAAAACCTGG + Intergenic
1142237136 16:88927654-88927676 CAGCTGTCACAGAGGGAGCCGGG + Intronic
1143786328 17:9258526-9258548 CAGCTGCGCCAGGGGAAACCAGG + Intronic
1146727537 17:35168444-35168466 CTGCTGTCCTTGAGGAGACCAGG + Intronic
1147240257 17:39086195-39086217 CACCAGTCCTCGAGGAACCCTGG + Intronic
1147458002 17:40550558-40550580 CAGCGGTCCCAAAGGAAATCAGG - Intergenic
1147595032 17:41711640-41711662 CAGCTGACCTAGAAGACACGGGG + Intergenic
1150763384 17:67983251-67983273 CTGCTGTCCTGGAGAAATCCAGG - Intronic
1151680554 17:75620586-75620608 CAGCTGTCCAACGGGGAACCAGG + Intergenic
1153597156 18:6739128-6739150 CACCAGTTCTAGAGGAGACCGGG - Intronic
1153933537 18:9900468-9900490 CAGTTTTCCTAGAGCACACCTGG - Intergenic
1156392404 18:36663133-36663155 CAGAAGTACTAGAAGAAACCAGG - Intronic
1157330259 18:46698871-46698893 CAGCTATAATAGAGGAAACAAGG + Intronic
1160050339 18:75427513-75427535 CAGCTGTGCTATAGGGAATCGGG + Exonic
1160184801 18:76667662-76667684 CAGCTGACCCGGAGTAAACCCGG - Intergenic
1160294466 18:77624450-77624472 CAGCTCCCATGGAGGAAACCAGG - Intergenic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1161081584 19:2313057-2313079 CAGCTCTCCAAGAGGAACCGAGG + Intronic
1161810443 19:6468251-6468273 CTGCTGTCACAGAGGAGACCTGG - Exonic
1162575155 19:11495048-11495070 CAGCTGGCCGAGGGGAAGCCGGG - Intronic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1165950595 19:39472268-39472290 CAGCTGTCACAGAGGAATTCAGG + Intronic
1166116312 19:40657193-40657215 CATCTGCCTTAGAGGAAAGCAGG - Intergenic
1166230174 19:41421976-41421998 CAGCTGAGCAAGAGGAGACCTGG + Intronic
1168132168 19:54328538-54328560 CAGCTGTCCTAGAGAGAGGCAGG + Intergenic
929197369 2:39199268-39199290 CAACTCTCCTAGATTAAACCAGG + Intronic
930769973 2:55120961-55120983 CAGCTGTCCTGGTGGCCACCAGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
936504847 2:113097877-113097899 CAGCCCTCCTAGATTAAACCAGG - Intergenic
939265824 2:139871588-139871610 CAGCTGTCCAAGAGTAGACTTGG - Intergenic
939882059 2:147642051-147642073 CAGCTGTTCAAGTGAAAACCTGG - Intergenic
941063176 2:160871232-160871254 CAGCTGTCCTAGGGAACATCTGG - Intergenic
942541701 2:177021796-177021818 CAGCAGTCCTAAAGGAAACAGGG - Intergenic
943979543 2:194530409-194530431 CAGCTCTCCTAAATGAGACCAGG + Intergenic
944072926 2:195693513-195693535 CAACCGTCCTAGATCAAACCAGG - Intronic
944665272 2:201954233-201954255 CAGCTGCCCTGAAGGAAAGCTGG + Intergenic
947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG + Intergenic
1168948502 20:1780782-1780804 CAGCTGCTCTAGAGAAAACCTGG - Intergenic
1169841284 20:9940668-9940690 CAGCTGCCATAGAACAAACCTGG - Intergenic
1173731138 20:45329562-45329584 CATCTGTCCTGGATGAAGCCAGG + Intronic
1179006614 21:37520864-37520886 TAGCAGTCCTGGAGGAATCCAGG - Intergenic
1179108501 21:38424841-38424863 CAGCAGTCCTAGAGGACCCTTGG + Intronic
1182977279 22:34635273-34635295 CAGCTGTCCTGGAGGAATTAAGG + Intergenic
1183028465 22:35084208-35084230 CAGCTTTCTGAGAGGGAACCGGG - Intronic
1183083659 22:35473424-35473446 CAGCTCACCTAGCAGAAACCTGG + Intergenic
1183087692 22:35496822-35496844 CAGGTGTCCCAGAGGAAAGCTGG + Intergenic
1183200162 22:36380373-36380395 CAGATGTCTTAGGGGAAACTGGG + Intronic
1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG + Intronic
952024209 3:29058774-29058796 CAACTCTCCTAGATTAAACCAGG + Intergenic
952103573 3:30043342-30043364 CAGCTTACCAAGAGGAAACAGGG - Intergenic
953195508 3:40728796-40728818 CAACTCTCCTAGATTAAACCAGG - Intergenic
953224276 3:41002198-41002220 CAGCTGTCTGACAGGAAGCCAGG + Intergenic
953743142 3:45554148-45554170 CAGATGCCCTGCAGGAAACCTGG + Intergenic
953747687 3:45587592-45587614 AAGCTTTCCTAAAGGAAAGCTGG + Intronic
956743709 3:72294847-72294869 CAGAGATCCTAGAGCAAACCTGG - Intergenic
962257742 3:133883971-133883993 CAGCTGGCCCAGAGAAAAACTGG - Intronic
962861914 3:139411424-139411446 CAGCTATCCTAGATTAAATCAGG - Intergenic
964563817 3:158027195-158027217 CAGCTTACCTAGAGGATAACTGG - Intergenic
965089512 3:164144545-164144567 CAGCTTTCCCAGGGGAAACACGG - Intergenic
967236379 3:187388154-187388176 CAACTCTCCTAGATTAAACCAGG + Intergenic
968875769 4:3267085-3267107 GAGCTCTTCTAGAGGAAACGTGG + Intronic
969467968 4:7368803-7368825 CAGGTGTCCTGGGAGAAACCCGG + Intronic
971456242 4:26847502-26847524 CACCGGTCCTAGAACAAACCAGG - Intergenic
974123341 4:57665977-57665999 CAGCTGCCCTAGAGGCAGCAAGG - Intergenic
975601258 4:76101769-76101791 CAGATGTCCTCAAGGATACCGGG + Intronic
975897597 4:79112644-79112666 CAACTATCCCAGAGGAGACCAGG + Intergenic
977635792 4:99296738-99296760 CACCTGGCCTAGATTAAACCAGG + Intergenic
983165032 4:164465152-164465174 CAGCTGAAATACAGGAAACCTGG + Intergenic
983749640 4:171250100-171250122 CAACTTTCCTAGATTAAACCAGG - Intergenic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
984519813 4:180788166-180788188 CAGGTGTCCTACACCAAACCTGG - Intergenic
987440361 5:17948513-17948535 CAGCCCTCCTAGATTAAACCAGG - Intergenic
989453414 5:41613551-41613573 CAGCTGTCTTAGTGCAAACTTGG - Intergenic
989623825 5:43410652-43410674 CAGCTCTCCTACAGGAAAGGAGG - Intronic
992012370 5:72541546-72541568 CAGCTGGCCTGGAGAAAACATGG - Intergenic
992160548 5:73996536-73996558 CAGCTGGCCTAAAGGCAAACAGG + Intergenic
995660553 5:114478071-114478093 CACCTGACCTAAAGGAAAACTGG + Intronic
995699688 5:114920627-114920649 CAACTCTCCTAGATTAAACCAGG + Intergenic
996608759 5:125354534-125354556 CAACCCTCCTAGATGAAACCAGG - Intergenic
997508421 5:134436558-134436580 CAGATTTCCCAGATGAAACCTGG - Intergenic
997930592 5:138069512-138069534 CAGCTTTCCTAGAGAAAACAAGG - Intergenic
999481856 5:151956039-151956061 CAGCTTTCCTAAATGAATCCAGG - Intergenic
1003307523 6:4943134-4943156 AAGCTGTCACAGAGGAAATCTGG - Intronic
1003368942 6:5506139-5506161 CAGCTGTCCCAGTGGAGAGCAGG + Intronic
1003826658 6:9960240-9960262 CAGCTGTCAGTTAGGAAACCAGG + Intronic
1005270391 6:24157416-24157438 CAGCTGCCAGAGAGTAAACCAGG - Intergenic
1005955633 6:30661501-30661523 CAGTTGTCCCACAGGACACCAGG - Intronic
1006900552 6:37497950-37497972 CAGCTGTCCTACTGTAAACAAGG - Intronic
1007279474 6:40699926-40699948 CATGTGTCCTAGTGGGAACCTGG - Intergenic
1007821606 6:44564504-44564526 AGACTGGCCTAGAGGAAACCAGG + Intergenic
1008231773 6:48991553-48991575 CAACTCTCCTAGATTAAACCAGG + Intergenic
1014278342 6:119413446-119413468 CAGCCTTCCTAGATTAAACCAGG - Intergenic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1021218283 7:17943469-17943491 CAGTTGTTACAGAGGAAACCTGG + Intergenic
1024456012 7:49607859-49607881 CAACTGTCCTAGATTAAACCAGG + Intergenic
1026850680 7:73721425-73721447 CATGAGTCCTAGAGGAAGCCAGG - Intergenic
1028278183 7:88885369-88885391 CAGCAGTCACAGAGAAAACCCGG - Intronic
1028482599 7:91324060-91324082 GAGCAGTCCCAGAGCAAACCAGG - Intergenic
1029880381 7:103802087-103802109 CTTCTGACCAAGAGGAAACCTGG - Intronic
1030845722 7:114407907-114407929 AAGCTGTCCTTGATGAAACATGG - Intronic
1031655176 7:124346163-124346185 CAACTCTCCTAGATTAAACCAGG - Intergenic
1036477742 8:9109080-9109102 CAACTGTCCTACAGGAACTCTGG - Intronic
1038270523 8:26071547-26071569 CACATGTCCTAGAGGAAATAGGG + Intergenic
1038409325 8:27345829-27345851 TAGCTGCCATGGAGGAAACCAGG + Intronic
1038471426 8:27826347-27826369 CAGATGTCCTAAATGAAAACGGG + Intronic
1039896596 8:41720833-41720855 CAGCTACCCTAGGGGAACCCAGG + Intronic
1040314297 8:46252861-46252883 CTCCTATCCTAGAGGACACCAGG + Intergenic
1040375779 8:46823390-46823412 CAACTGTCCTACATGAAAACAGG + Intergenic
1040379168 8:46855676-46855698 CAACTGTCCTACATGAAAACAGG + Intergenic
1040641688 8:49341763-49341785 CAGCTGGTCTAGAGAAAACATGG - Intergenic
1042995785 8:74696747-74696769 CAGCCCTCCTAGATTAAACCAGG + Intronic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1045722780 8:105133326-105133348 CCTCAGTCCTAAAGGAAACCTGG - Intronic
1048276109 8:133067246-133067268 CACCTGCCCTAGAGGAGAGCAGG - Intronic
1048475121 8:134736022-134736044 CACCTGTCCTGGAGGGAAACTGG + Intergenic
1049853889 8:144849706-144849728 CACCTGCCCTAGAGGCACCCGGG + Intronic
1051366647 9:16325998-16326020 GTGATGTCCCAGAGGAAACCAGG + Intergenic
1055107476 9:72527700-72527722 CAGCTCTCCTACAATAAACCAGG - Intronic
1055810915 9:80146803-80146825 CAGCTGTGTTAAAGGGAACCTGG - Intergenic
1055846800 9:80575047-80575069 CAACTGTCCTAGATTAAACTCGG + Intergenic
1056294244 9:85175670-85175692 CATCTGTCCTAAAGGTAACCTGG + Intergenic
1056958488 9:91101523-91101545 CAGTTGTCCCAGATGAACCCTGG + Intergenic
1057249561 9:93489472-93489494 CAGCTGTCCTACTGGAACCTGGG - Intronic
1057294829 9:93828732-93828754 CAGCTCTCCGAGAGGCCACCCGG - Intergenic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1060700059 9:125743073-125743095 CAGCTATATTAGAGGAATCCAGG - Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1187108975 X:16275991-16276013 CAGCCCTCCTAGATTAAACCAGG - Intergenic
1187581939 X:20616505-20616527 CAACTGTCCTGGAGGGAAACTGG + Intergenic
1189936150 X:46070725-46070747 CATCAGTCCTAGAGAAAACTTGG - Intergenic
1192503968 X:71669829-71669851 CAGCTGTCCCACAGGAAATGGGG + Intergenic
1194505136 X:94724862-94724884 CAACTCTCCTAGATTAAACCAGG + Intergenic
1195696296 X:107669972-107669994 TAGCTGTCCTCGAGGCACCCAGG - Intergenic
1198665019 X:139011082-139011104 CAACTCTCCTAGATTAAACCAGG + Intronic
1198805448 X:140489852-140489874 GAGCTGTCCTAGAGATAACAAGG - Intergenic
1200135043 X:153870682-153870704 AAGCTGTTCTTGAGGAAGCCTGG + Intronic
1200514593 Y:4128707-4128729 CAACTCTCCTAGATTAAACCAGG + Intergenic
1200857000 Y:7949695-7949717 CAACTGTCCTACATGAAAACAGG - Intergenic
1202251625 Y:22879167-22879189 CAGCTCTCCTACAGGTAAACAGG - Intergenic
1202261296 Y:22973188-22973210 CATCTGTCCTACATGAAAACAGG + Intergenic
1202381263 Y:24277829-24277851 CAGCTGTGCCAGGGGAAAGCTGG - Intergenic
1202404613 Y:24512916-24512938 CAGCTCTCCTACAGGTAAACAGG - Intergenic
1202414284 Y:24606929-24606951 CATCTGTCCTACATGAAAACAGG + Intergenic
1202456501 Y:25063157-25063179 CATCTGTCCTACATGAAAACAGG - Intergenic
1202466166 Y:25157166-25157188 CAGCTCTCCTACAGGTAAACAGG + Intergenic
1202489522 Y:25392297-25392319 CAGCTGTGCCAGGGGAAAGCTGG + Intergenic