ID: 915253119

View in Genome Browser
Species Human (GRCh38)
Location 1:154604625-154604647
Sequence TTTGCTGTGTCACCAAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915253119 Original CRISPR TTTGCTGTGTCACCAAACCC TGG (reversed) Intronic
903197640 1:21703760-21703782 TTTGCTGTGTCACCCAGGCTGGG + Intronic
903451056 1:23453895-23453917 TTTCCTGTGTCACCAACCCCTGG + Intronic
903682174 1:25104419-25104441 TTTGCTCTGTCACCCTACCAAGG + Intergenic
904718254 1:32485692-32485714 CTTGCTGTGTGTCCAAACTCTGG + Exonic
904800550 1:33089672-33089694 TTGGCTGTGTCACCACAGACAGG + Intronic
904898785 1:33839364-33839386 CTTTCTGTGTCACCAAAGCCTGG - Intronic
905574506 1:39033024-39033046 TTTTCTGTGTCACAGAATCCAGG + Intronic
907908345 1:58805570-58805592 TCTGCTGTGTCCCCAGAACCTGG + Intergenic
908021285 1:59901239-59901261 TCTCCTGTGTCCCCCAACCCAGG + Intronic
908721341 1:67129432-67129454 CTTGCTCTGTCACCCAAGCCGGG - Intronic
910407212 1:86901200-86901222 TTTTCTGTGTCACTCAACTCTGG - Intronic
911049117 1:93654592-93654614 TTTGCTGTGTAACAAAAACTTGG - Intronic
915253119 1:154604625-154604647 TTTGCTGTGTCACCAAACCCTGG - Intronic
915627689 1:157125619-157125641 TTCGCTGTCTCTCCAATCCCTGG - Exonic
916050999 1:161037086-161037108 TTTCCTGTGCCACCAAAACCAGG - Intronic
917029003 1:170669242-170669264 TTGGCTGAGACACCTAACCCCGG + Intronic
918665441 1:187145266-187145288 CCTGCTGTCACACCAAACCCTGG + Intergenic
921058102 1:211559758-211559780 TTTGCTGGGTCACTAATGCCTGG - Intergenic
921995830 1:221416975-221416997 TTTGCTGTGTCACCCAGGCTGGG - Intergenic
922152541 1:223018109-223018131 TCTGCTTTGTCCCCAAAGCCGGG - Intergenic
922603480 1:226874216-226874238 CTGCCTGTGTGACCAAACCCTGG + Intronic
924780256 1:247141119-247141141 TGTGCTGTGGGACCAAGCCCAGG + Intronic
1063415916 10:5872446-5872468 CTTGCTGTGTCACCCAGGCCGGG - Intronic
1065578444 10:27147769-27147791 TGTGCAGTTTCACCAAACCCTGG + Intronic
1065777954 10:29139736-29139758 TTTTCTATGTCAACAAACCCTGG + Intergenic
1066078129 10:31901501-31901523 TTTGCTCTGTCACCCAAGCCTGG - Intronic
1066269510 10:33808571-33808593 TTTGCTGTGTCCCCCAAGTCTGG - Intergenic
1068003189 10:51360877-51360899 TTTGCTATGTCATCAAACCATGG + Intronic
1068123245 10:52806315-52806337 ATTTCTGTGTCAATAAACCCTGG - Intergenic
1073177316 10:101564548-101564570 TTTGCTGTGTCCCCCAACTCTGG + Intergenic
1074855498 10:117470194-117470216 TTTGCTGTGTCTGCCAAGCCAGG - Intergenic
1075253685 10:120906979-120907001 TTTTCTGATTCACCAAAGCCAGG + Intronic
1075304533 10:121355994-121356016 TTTCCTGGGTCACCAAATCCCGG + Intergenic
1075923206 10:126230104-126230126 TTTCCTGTCTTACCAAGCCCAGG + Intronic
1076577513 10:131479536-131479558 TCTGCTGTGTCTCCAAGACCAGG + Intergenic
1077078911 11:714258-714280 TTTGCTGTGTCACCCAGGCTGGG + Intronic
1077093724 11:790696-790718 GGTGCTGTGTCCCCAAAACCGGG - Exonic
1077293789 11:1814652-1814674 ATTTCTGTGTCCCCAAACCGGGG + Intergenic
1079145950 11:17852047-17852069 TTTGCTGTGTCTCCAAGCTGTGG - Intronic
1081046729 11:38282603-38282625 TTTGCTTTGCCACCAAATACTGG + Intergenic
1081285414 11:41263042-41263064 TTTCCTGTGTGACCAAAACATGG - Intronic
1084011041 11:66348479-66348501 TTTTCCGTGCCACCAACCCCTGG - Intronic
1084706443 11:70818841-70818863 TTGGCTGTGGCCCCAAAGCCTGG + Intronic
1084801391 11:71546625-71546647 GTAGCTGTGTCACCAACACCTGG - Intronic
1086564221 11:88206863-88206885 TTTGTTGTATCATCAAACACTGG + Intergenic
1088710523 11:112504257-112504279 TTTGCTGTGTAACCAGCCCTGGG + Intergenic
1089565159 11:119367406-119367428 CCAGCAGTGTCACCAAACCCTGG - Intronic
1093678420 12:21971353-21971375 TTTTATGTGTCACCTAACTCTGG + Intergenic
1093695829 12:22159232-22159254 TTGGCTCAGTCACCACACCCAGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098110294 12:67114386-67114408 TTGGATGTGTCATCACACCCAGG - Intergenic
1099331272 12:81291719-81291741 TTTGCTGAGCCCCCAAAGCCTGG - Intronic
1100176717 12:92038891-92038913 TTTCCTGTGTAAGCAAAGCCGGG + Intronic
1101288491 12:103341333-103341355 TTTGCTGTGTCACCAAGGATAGG - Intronic
1102010376 12:109614662-109614684 CATGCTGTGTCACCAGGCCCAGG - Intergenic
1103595948 12:122024172-122024194 TGTGTTGTTTCCCCAAACCCAGG - Intronic
1105237145 13:18567842-18567864 TTTGCTGCCGCACCTAACCCGGG + Intergenic
1106769487 13:32948072-32948094 TTTGTTGGATCACCAAGCCCAGG + Intergenic
1109765731 13:66894593-66894615 TTTGGTGTTTCACCAAATTCTGG - Intronic
1112439862 13:99417588-99417610 TTGCCTGGGTCACAAAACCCAGG - Intergenic
1116096038 14:40369370-40369392 CTAGCTGTGTGACAAAACCCAGG + Intergenic
1116242194 14:42359241-42359263 TTTGCCCTGTTACCAAACCTGGG - Intergenic
1117010820 14:51468640-51468662 CTTGCTTTGTTCCCAAACCCGGG + Intergenic
1117797395 14:59408576-59408598 GTTCCTGTGTCTCCAAACCCAGG + Intergenic
1118373536 14:65157623-65157645 CTTGCTGTGTTCCCAGACCCTGG - Intergenic
1119503280 14:75149369-75149391 TTTGCTGTGTCACAATAACATGG - Intronic
1119890952 14:78181721-78181743 GTAGCTGTTTCACCAATCCCAGG - Intergenic
1120418862 14:84256403-84256425 ATTGCTGTTTCTCCAATCCCAGG + Intergenic
1120728163 14:87969921-87969943 TTTACTGAGTCACTAAACTCAGG + Intronic
1122514888 14:102300348-102300370 TTTGCTGTGTTGCCCAGCCCAGG - Intronic
1122530270 14:102420501-102420523 CTTGCTGTGTCACCAAGGCTGGG + Intronic
1202892723 14_KI270722v1_random:174784-174806 CTTGCTGTGTCACCAAGGCTGGG - Intergenic
1123765840 15:23477758-23477780 ATGGCTGTGTGACCAAAACCCGG + Intergenic
1124843629 15:33268382-33268404 TTTGCTCTGTCACCCAGGCCTGG + Intergenic
1125806917 15:42501428-42501450 CTTGCTGTGTCACCAAGGCTGGG + Intronic
1127242739 15:57136295-57136317 TTTGCTGTGTCAAAAAACACTGG + Intronic
1127992672 15:64132432-64132454 TGTGCTGTGTCACCCCACACTGG + Intronic
1133929751 16:10222692-10222714 TGGGCTGTGTCACCAAGTCCCGG - Intergenic
1134182052 16:12055829-12055851 TTTGCTGGGCCACAATACCCAGG - Intronic
1134342702 16:13359804-13359826 TGTTCTGTGTCACCACACTCAGG - Intergenic
1135046959 16:19163759-19163781 CTTTCTGTGTCATGAAACCCTGG + Intronic
1135075916 16:19393474-19393496 TTTGCTCTGTCGGCAAATCCTGG - Intergenic
1137820953 16:51445390-51445412 TTTTCTGTGTCAACAAAGCTTGG + Intergenic
1139637307 16:68265427-68265449 TTAACTGTGTCACCAAGCCCAGG - Intronic
1141307366 16:82878288-82878310 TTTGCTCTCTCAGTAAACCCTGG + Intronic
1141435563 16:83997906-83997928 TGTGCTGTGTCTCCAGGCCCTGG + Intronic
1141812564 16:86385258-86385280 TTGGCTGTGTCACCACCCTCAGG + Intergenic
1142429025 16:90016497-90016519 ATTGCTGTGTCCCCACACTCTGG - Intronic
1143517842 17:7428934-7428956 TGTGCTCTGGCACCAACCCCAGG + Intergenic
1143801894 17:9390059-9390081 TTCCCTGTGTCCCCAAAGCCTGG - Intronic
1144640942 17:16936115-16936137 TGTGCTGTGTCACCAGATTCGGG - Intronic
1145969254 17:28946503-28946525 ATAGCTGTGTTACCAAGCCCGGG + Intronic
1151725604 17:75882028-75882050 TTTGTGGCCTCACCAAACCCAGG - Intronic
1151955998 17:77380565-77380587 TTTCCTGTGTCCTCAAAGCCAGG + Intronic
1154354544 18:13615050-13615072 TTTCCTGGAGCACCAAACCCAGG - Intronic
1155394109 18:25368073-25368095 TTTGCTGTTCCACCCAAGCCAGG - Intergenic
1156395347 18:36694364-36694386 TTTGCTGGCTCTCCAAACCTTGG + Intronic
1156398386 18:36719053-36719075 CTTGCTGACTCACCAAACACGGG + Intronic
1156480673 18:37434592-37434614 TTTGCTGTGCCACCCCTCCCTGG + Intronic
1160060639 18:75526124-75526146 TTTGCTCTGTAGCCAAGCCCAGG + Intergenic
1161031809 19:2061190-2061212 TTTGCTGCGTCGCCAAATGCCGG + Intergenic
1161244694 19:3243293-3243315 TTTGCTATGTCGCAAAACCTTGG + Intronic
1162244405 19:9387427-9387449 CTTGCTCTGCCACCCAACCCTGG - Intergenic
1163869633 19:19808811-19808833 CTCGCTGTGTCACCAAGGCCAGG - Intronic
1164861089 19:31562763-31562785 ATTGCTGGCTCACCAAACCATGG - Intergenic
1165321192 19:35086310-35086332 ATTGCTGTGTCCCCAGGCCCTGG + Intergenic
1167266987 19:48488167-48488189 TTGGCAGTGTCCCCATACCCTGG + Intronic
1168299864 19:55398163-55398185 TTCGCTGTGTCACCCAGCCTGGG - Intronic
929723863 2:44402296-44402318 CTTGCTGTGTCACCCAAGCTGGG - Intronic
930368674 2:50476349-50476371 TTTTCTCTGTCTACAAACCCTGG + Intronic
932713250 2:74083077-74083099 TTGACTGTGTCCCCAAATCCTGG - Intronic
934979074 2:98825497-98825519 TTCGCTCTGTCACCAAGTCCTGG + Intronic
935168369 2:100589719-100589741 CTTGCTTTATCACCCAACCCTGG + Intergenic
935404925 2:102698966-102698988 TTTTCTGTGTCACCAGTGCCTGG - Intronic
935929425 2:108107281-108107303 ATTGATGGGTCACCAAACACTGG - Intergenic
936370317 2:111898116-111898138 TTTTCTGTGTCAGCCAAGCCCGG + Intergenic
936738061 2:115470397-115470419 TTTTCTGTGCCATGAAACCCTGG - Intronic
937926958 2:127174988-127175010 TTTGCTTCTGCACCAAACCCAGG + Intergenic
938893599 2:135729353-135729375 TTTGCTCTGTCACCCAAGCTGGG + Intergenic
939642204 2:144654354-144654376 TTTGCTGTGTTTCAAAACTCTGG + Intergenic
939818949 2:146931397-146931419 TTTGCTCTGTCGCCCAACCTGGG - Intergenic
940204158 2:151184188-151184210 TATGCTGTCTCATCAAACACTGG - Intergenic
942888989 2:180964592-180964614 TTTATTGTGTCACCAAATTCTGG + Intergenic
942890094 2:180979225-180979247 ATTGCTGTGTGACTAAAGCCAGG - Intronic
943168783 2:184369023-184369045 TTTCCTGTGCCATAAAACCCTGG - Intergenic
943617053 2:190104757-190104779 CTTGCTTTGTCACCTAAGCCAGG - Intronic
943941870 2:194008784-194008806 TTTGCTTTGGTACCAAACACTGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944994907 2:205282950-205282972 TTTGCTGTATCAACCAACCAGGG - Intronic
947455990 2:230254598-230254620 TTTACTGAGACAGCAAACCCTGG - Intronic
948404863 2:237709728-237709750 TAGGCAGTGTCACCAAGCCCTGG + Intronic
1169606661 20:7328496-7328518 TTTGATATGTCACTAAAGCCAGG - Intergenic
1170519136 20:17165787-17165809 CTGCCTGTGTAACCAAACCCAGG + Intergenic
1172768239 20:37362551-37362573 CTTGCTGTGTGACCAAGGCCCGG + Intronic
1173287859 20:41689237-41689259 TTTGCTATGACCCCAAACCAGGG - Intergenic
1173404236 20:42751352-42751374 TTTCCTTTGTCCCCAGACCCGGG + Intronic
1173476415 20:43363064-43363086 TTTGCTGTCTCAACAAACGTAGG - Intergenic
1174322184 20:49750657-49750679 TTTGCTGTGTCCCCACTCCTGGG + Intergenic
1176781132 21:13196124-13196146 TTTGCTGCCGCACCTAACCCGGG + Intergenic
1177201903 21:17966820-17966842 CTTTCTGTATCACCAAACACTGG - Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1181338017 22:22155627-22155649 GTTCCTGTGTCACCACAACCTGG - Intergenic
1183944606 22:41317898-41317920 TCTGCGGTGTCACTGAACCCAGG + Intronic
1184294359 22:43514649-43514671 TTCGCTGGGTCCGCAAACCCCGG - Intergenic
1185321443 22:50201813-50201835 TTCGCTGGGGCTCCAAACCCAGG + Intronic
949785397 3:7734635-7734657 TTTCTTGTGTCAACAAATCCAGG + Intronic
950456601 3:13096406-13096428 TTTACTCTGTCACCATACACTGG + Intergenic
953082166 3:39631121-39631143 TTTGCTCTGTCAACAGAGCCTGG - Intergenic
953084362 3:39652539-39652561 TTTGCTCTGTCAACAGAGCCTGG + Intergenic
955065449 3:55530232-55530254 TTTGCTATCTTACCAATCCCTGG - Intronic
956731932 3:72204227-72204249 TTTGCTGTGATGCCAAACCATGG + Intergenic
957111556 3:75966597-75966619 TTTTCTGTGTGAGAAAACCCAGG - Intronic
959981652 3:112524348-112524370 TCAGCTGTGTCACCACCCCCAGG - Intergenic
961594424 3:128005835-128005857 TTTTCTGTGTCCCCACTCCCTGG - Intergenic
964735202 3:159910307-159910329 TTTGCTGTGTCTCCAATACTTGG - Intergenic
965666732 3:171102139-171102161 TTTGGTGTGTCATCATTCCCTGG + Intronic
966949651 3:184804616-184804638 TTTGCTCTGTCACCCAGGCCGGG + Intergenic
969683380 4:8655732-8655754 TTTGCTGTATCACCAGCCTCTGG - Intergenic
969789742 4:9484549-9484571 TCAGCTGTGTCACCACCCCCAGG + Intergenic
969848495 4:9938230-9938252 TTTTCTGTGTCTCCAACCCATGG + Intronic
972968890 4:44548072-44548094 TTAGCTGTGCCACCATACTCAGG - Intergenic
973719013 4:53704869-53704891 CTTGCTGGGTCACCACAGCCTGG - Intronic
975576584 4:75868980-75869002 CTTGCTCTGTCACCAAGGCCAGG - Intronic
976287082 4:83381263-83381285 TTTGCTGTGCCAGGCAACCCCGG + Intergenic
978381247 4:108131355-108131377 CTTGCTCTGTCACCTCACCCAGG - Intronic
980603286 4:135054707-135054729 TTTTCTGTGTCTTCAAACCAAGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982766024 4:159349526-159349548 AGTGCTGTGTCACAAAACCTTGG - Intronic
983281203 4:165682570-165682592 CTTGCTCTGTCACCCAGCCCAGG - Intergenic
984187417 4:176562802-176562824 ATTGCTGTGGCACCAAAGCGTGG + Intergenic
986217816 5:5737404-5737426 GTGGCTGTGTCAGCAAAACCAGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
989781483 5:45270185-45270207 TTTGCTGTCTCCCCAAACTTTGG - Intronic
990043578 5:51400355-51400377 TTTTCGCTGTCACCAAACCTGGG - Intergenic
994868233 5:105307316-105307338 TTTGCTTTGTCTCCAGAGCCTGG - Intergenic
996754752 5:126923880-126923902 TTTGCTTTGTCAACCAACTCTGG - Intronic
1001397197 5:171425933-171425955 CTTGCTATGTGACCAAACGCAGG - Intronic
1001819925 5:174702482-174702504 TTTGCTCTGTCACCCAAGCTGGG + Intergenic
1003146050 6:3511616-3511638 GTTGCTGTGTGCCCAAGCCCCGG + Intergenic
1005454745 6:26008483-26008505 TTTCCTCTGTCCCCAAACTCTGG - Intergenic
1007308448 6:40925637-40925659 TATCCTGTGTCACCCACCCCAGG + Intergenic
1008446364 6:51596837-51596859 TTTCCTGTGTAATAAAACCCAGG - Intergenic
1010146826 6:72680010-72680032 CTTGCTCTGTCACCCAGCCCAGG - Intronic
1011241882 6:85280592-85280614 CTTGCTGTGTCACCCAAGCTGGG + Intergenic
1013879086 6:114872274-114872296 ATTGCTGTGTCACCCAGCCTGGG + Intergenic
1015006334 6:128286043-128286065 TTGTCTCTGTAACCAAACCCAGG + Intronic
1015398710 6:132764157-132764179 GTGGTTATGTCACCAAACCCTGG - Intergenic
1015912582 6:138183585-138183607 TTGGCTCTGACTCCAAACCCAGG - Intronic
1016887447 6:148971160-148971182 TATGCAGTGGCACCAAACCATGG + Intronic
1018285761 6:162236087-162236109 TTAGATGTGTCACCTAACACTGG + Intronic
1019034054 6:169040067-169040089 TTTGCTGTGGCACCAAATGGCGG - Intergenic
1019332471 7:467164-467186 TTTCCTGTGTCAACAAAGGCTGG - Intergenic
1020610914 7:10396762-10396784 TTTGCTAAGTCAGGAAACCCAGG - Intergenic
1021626524 7:22598931-22598953 CTGGCTGTGTAACCAAACTCAGG - Intronic
1023941896 7:44773943-44773965 TTTGCTCTGTCACCAAGGCTGGG + Intergenic
1026915546 7:74117962-74117984 GTAGCTGTGCCACCACACCCGGG - Intronic
1027133455 7:75607800-75607822 TTTGCAGTGTGACCAAGCTCAGG + Intronic
1028173954 7:87631329-87631351 TTTCCAGAGTCACCAAACCCTGG + Intronic
1030110321 7:106021347-106021369 CTGGCTGTGTCACAAAACCCAGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036647784 8:10622947-10622969 TGCGCTCTGTCACCACACCCCGG - Exonic
1037967165 8:23144221-23144243 CTTGCTGTGTCCCCAGAGCCTGG - Intronic
1038908464 8:31934975-31934997 ATTGCTCTGTCACCCCACCCAGG + Intronic
1040414175 8:47182313-47182335 TTTATTGTGTCCCCAAATCCAGG + Intergenic
1040520177 8:48169662-48169684 GGTGCGGTGTCACCTAACCCAGG - Intergenic
1043668365 8:82847747-82847769 TTTGCTGTTTCCTCAACCCCAGG - Intergenic
1048778918 8:137979760-137979782 ATTGCAGTGTGACCCAACCCTGG + Intergenic
1049061756 8:140281639-140281661 TTTGATGTGACACCAAAAGCAGG - Intronic
1049310387 8:141931058-141931080 TTCTCTGTGTCAGGAAACCCTGG - Intergenic
1053086734 9:35230438-35230460 CTTGCTGTGTCACCCAGACCAGG - Intronic
1058155136 9:101506449-101506471 TTTGCTGTGTAACACAACTCTGG + Intronic
1060427868 9:123521649-123521671 TTCTCTGTGTCACCAAAGGCTGG + Intronic
1186498169 X:10029082-10029104 TTTGCTGTGTCTCCTAAGGCAGG + Intronic
1187107724 X:16261358-16261380 TTTGCTGTCTTAGCAAATCCAGG - Intergenic
1188282943 X:28292861-28292883 TTTTCTGTGTTTCCAAAGCCTGG + Intergenic
1189261693 X:39683559-39683581 TTTACTGTGATACCAAACCAGGG + Intergenic
1194250073 X:91563359-91563381 TATGGTGTGTCACCAGTCCCAGG + Intergenic
1196659720 X:118257124-118257146 TTTGCTCTGTCACCCAAAACAGG + Intergenic
1198106031 X:133462154-133462176 TTTAGTGTGTCACGATACCCCGG + Intergenic
1200569034 Y:4804608-4804630 TATGGTGTGTCACCAGTCCCAGG + Intergenic
1200969169 Y:9131819-9131841 ATAGCTGTTTCACCAAACCTTGG + Intergenic
1201343262 Y:12956312-12956334 TTTGCTGTAAGACCAAACCAAGG - Intergenic
1202141660 Y:21730679-21730701 ATAGCTGTTTCACCAAACCTTGG - Intergenic
1202145205 Y:21773123-21773145 ATAGCTGTTTCACCAAACCTTGG + Intergenic