ID: 915253483

View in Genome Browser
Species Human (GRCh38)
Location 1:154607953-154607975
Sequence TTGGACCTTCGCCGCCGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915253483_915253495 21 Left 915253483 1:154607953-154607975 CCCAGACGGCGGCGAAGGTCCAA 0: 1
1: 0
2: 0
3: 0
4: 17
Right 915253495 1:154607997-154608019 GCGGATTCATTGCGCCCGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 57
915253483_915253490 2 Left 915253483 1:154607953-154607975 CCCAGACGGCGGCGAAGGTCCAA 0: 1
1: 0
2: 0
3: 0
4: 17
Right 915253490 1:154607978-154608000 CCGGCCCGGCTTACCTGCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915253483 Original CRISPR TTGGACCTTCGCCGCCGTCT GGG (reversed) Intronic
907337635 1:53710714-53710736 TTGGAGCTTCGCAGCCACCTGGG - Intronic
915253483 1:154607953-154607975 TTGGACCTTCGCCGCCGTCTGGG - Intronic
1064673610 10:17740067-17740089 TTGGCCCTTGGCTGGCGTCTGGG + Intergenic
1075087492 10:119423206-119423228 TAGGAGCTTCTCCTCCGTCTGGG - Exonic
1075797431 10:125130714-125130736 TTGTACCTTCCCCACCATCTGGG - Intronic
1099767889 12:87012749-87012771 TTGGACCTTGGCTGGCATCTTGG + Intergenic
1104547530 12:129725819-129725841 TTGGCCCTTGGCTGACGTCTGGG + Intronic
1131820219 15:96264870-96264892 TTGAACCTTTGCCGGCCTCTGGG + Intergenic
1145993386 17:29092331-29092353 TTGGCCCCTCACCGCTGTCTTGG + Exonic
1167709813 19:51103791-51103813 TTGGGTCTTGGCCACCGTCTTGG - Intronic
936682678 2:114792524-114792546 TTGGCCCTTGGCTGCCATCTGGG + Intronic
942044466 2:172091235-172091257 TTGGGCCCTAGCTGCCGTCTGGG - Intergenic
965973936 3:174597463-174597485 TTGGCCCTTTGCTGACGTCTAGG - Intronic
969471754 4:7393185-7393207 TTGGACATTCCTGGCCGTCTGGG + Intronic
1019199908 6:170306207-170306229 TTCGACCCTCGCCTCCGTATCGG - Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1187173013 X:16870068-16870090 TTCGCCCCTCGCCGCCGCCTCGG + Intronic