ID: 915253868

View in Genome Browser
Species Human (GRCh38)
Location 1:154610492-154610514
Sequence ATGCAGAGCATACTATAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915253868_915253871 -2 Left 915253868 1:154610492-154610514 CCAAACTATAGTATGCTCTGCAT 0: 1
1: 0
2: 0
3: 14
4: 127
Right 915253871 1:154610513-154610535 ATAAAAGACAAAATGAGGCCGGG 0: 1
1: 4
2: 32
3: 375
4: 3015
915253868_915253872 6 Left 915253868 1:154610492-154610514 CCAAACTATAGTATGCTCTGCAT 0: 1
1: 0
2: 0
3: 14
4: 127
Right 915253872 1:154610521-154610543 CAAAATGAGGCCGGGCGCAGTGG 0: 1
1: 64
2: 671
3: 4015
4: 15369
915253868_915253870 -3 Left 915253868 1:154610492-154610514 CCAAACTATAGTATGCTCTGCAT 0: 1
1: 0
2: 0
3: 14
4: 127
Right 915253870 1:154610512-154610534 CATAAAAGACAAAATGAGGCCGG 0: 1
1: 0
2: 13
3: 126
4: 1917
915253868_915253869 -7 Left 915253868 1:154610492-154610514 CCAAACTATAGTATGCTCTGCAT 0: 1
1: 0
2: 0
3: 14
4: 127
Right 915253869 1:154610508-154610530 TCTGCATAAAAGACAAAATGAGG 0: 1
1: 0
2: 5
3: 46
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915253868 Original CRISPR ATGCAGAGCATACTATAGTT TGG (reversed) Intronic
904231178 1:29074271-29074293 CTGCAGAGAATGCTATAGTTTGG - Intronic
906845683 1:49189171-49189193 ATGGAGAGCAAACCATAGTCTGG + Intronic
907261746 1:53223338-53223360 ATGCAGAGCATTGAATAATTAGG - Intergenic
910210214 1:84784581-84784603 ATTGAGAGCTTACTATAGGTAGG - Intergenic
910754671 1:90674956-90674978 ATGTGGTGTATACTATAGTTCGG - Intergenic
912061005 1:105670144-105670166 ATGTAGAGCCTACTACACTTGGG - Intergenic
915253868 1:154610492-154610514 ATGCAGAGCATACTATAGTTTGG - Intronic
916422415 1:164649395-164649417 ATGTAGAGAATACTTTTGTTGGG + Intronic
922369785 1:224897802-224897824 ATTCAGAGATTACTATAGTGAGG + Intronic
1064472828 10:15654336-15654358 ATGAAGATTATACTAGAGTTAGG - Intronic
1066338968 10:34510359-34510381 ATTCAGAGCTTGCTGTAGTTAGG - Intronic
1067465277 10:46493554-46493576 AGGCTGTGAATACTATAGTTTGG - Intergenic
1067621910 10:47891047-47891069 AGGCTGTGAATACTATAGTTTGG + Intergenic
1068953236 10:62799054-62799076 ATGCAGAGCATAGTTGAGGTGGG - Intergenic
1079569400 11:21923575-21923597 ATTCAGAGCTTACTAAAGTAAGG - Intergenic
1080152517 11:29070443-29070465 TTGGAGAGCAGACTATAGCTAGG + Intergenic
1083653488 11:64217955-64217977 ATGGAGAGCAAACTGTAGATGGG - Intronic
1085547696 11:77335396-77335418 GTGAAGAGCATACTTAAGTTGGG - Intronic
1085719332 11:78899248-78899270 AGGGAGAGGATGCTATAGTTTGG + Intronic
1085849417 11:80102535-80102557 ATGCAGTGCATACTATTTGTGGG - Intergenic
1089648610 11:119896829-119896851 AGGCTGAGCATATTAGAGTTGGG + Intergenic
1096000575 12:48126375-48126397 ATGAAGAGCATCCTAAAGTTTGG + Intronic
1097123397 12:56753438-56753460 ATTCAGAGCTTACTATAGCAAGG + Intronic
1098029616 12:66240481-66240503 ATGCAGTGCACACTTAAGTTGGG + Intronic
1106060875 13:26290434-26290456 ATACAAAGCATACTATAATCAGG - Intronic
1106690461 13:32109698-32109720 AAGCAGAGGAAACTATACTTGGG + Intronic
1112387502 13:98953795-98953817 ATGCAAAGCATGGTATTGTTTGG + Intronic
1112400800 13:99076903-99076925 AGGCAGTGCATGCTTTAGTTTGG + Intronic
1114879073 14:26761370-26761392 ATGCAGTACATAATATAGTCAGG - Intergenic
1115249534 14:31330910-31330932 AAGCAGAGCATATAAAAGTTTGG - Intronic
1115300223 14:31877082-31877104 ATGCACAGCATAATGTAATTGGG - Intergenic
1116999528 14:51358117-51358139 GTGCAGATCATTCTTTAGTTTGG + Intergenic
1117063819 14:51989301-51989323 ATGCAGAGAATAGTATATGTAGG - Intergenic
1125832268 15:42725405-42725427 ATGCAGAGCAGCTCATAGTTTGG + Intronic
1126332112 15:47544268-47544290 ATTCAGAGCACACTTTATTTTGG - Intronic
1126737599 15:51747717-51747739 ATGTAGAGCTTCCTATATTTTGG + Intronic
1127744097 15:61946713-61946735 ATGCAGAGGATATTTAAGTTTGG - Intronic
1137748884 16:50843449-50843471 ATGCAGAGCACAGTATTTTTAGG - Intergenic
1137915289 16:52423529-52423551 ATGTAGAGCATATTCTAGTATGG + Intergenic
1138822146 16:60273865-60273887 ATGAAGAACATTCTGTAGTTGGG - Intergenic
1144091143 17:11857631-11857653 ATGCAGGACATTATATAGTTTGG + Intronic
1146003025 17:29142691-29142713 ATTCACAGCATACCATGGTTAGG + Intronic
1146692647 17:34887320-34887342 ATGCAGAGCAAACTAGAGAGTGG - Intergenic
1156484296 18:37455267-37455289 GTGCAGAGCATCCAATATTTGGG + Intronic
1156665725 18:39403855-39403877 ATGCAATGACTACTATAGTTTGG - Intergenic
1156747528 18:40410551-40410573 CAGCAGAGCAGACGATAGTTTGG - Intergenic
1158302747 18:56070460-56070482 AGGCTGAGCATATTATAATTAGG - Intergenic
1158318096 18:56234664-56234686 AAGAAGAGTATAATATAGTTGGG + Intergenic
1160102952 18:75940243-75940265 ATGCAGAGTATACCTGAGTTTGG + Intergenic
1168541927 19:57220048-57220070 TTGCAGAGCAGAATATAGATAGG + Exonic
930329174 2:49960898-49960920 ATCCATAGCATACTATAATTGGG + Intronic
930636028 2:53806520-53806542 ACACAGAGCCTACTATATTTTGG - Intronic
932907405 2:75768680-75768702 ATTCAGAGCTTGCTATAGTAAGG - Intergenic
944769426 2:202898669-202898691 ATGCATAGCATACTATTTTAGGG - Intronic
944899476 2:204199575-204199597 ATGCAACGCATACTGTAGTTGGG - Intergenic
1169438931 20:5617972-5617994 AGGTAGTGCATACTATAGTTTGG - Intergenic
1171424062 20:25038723-25038745 ATGCAGAGCCTCCTACAGTTGGG + Intronic
1171505499 20:25629794-25629816 CTGCAGATCTTACTAGAGTTAGG + Intergenic
1174751042 20:53111867-53111889 ATGCAGAGCTTACAATCCTTGGG + Intronic
1174870798 20:54179951-54179973 GAGCAGAGCAAACTATACTTTGG - Intergenic
1175504733 20:59473519-59473541 ATTCAGAGCTTGCTATAGCTAGG + Intergenic
1176688370 21:9875162-9875184 ATGGACAGAATAATATAGTTTGG - Intergenic
1177242473 21:18477348-18477370 ATGCAGAACAGCCTAGAGTTCGG - Intronic
1182823423 22:33239842-33239864 ATGCAAAGCATATAATAGTAAGG - Intronic
949167821 3:962050-962072 ATGCAGAGAACATTTTAGTTTGG - Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
953642526 3:44722612-44722634 ATGCAGAGCCTACTTGAGGTGGG + Exonic
955208575 3:56919490-56919512 CTGCAGAGCATGCTATGGTATGG + Intronic
958800080 3:98744946-98744968 ATGCAGAGCATACTAGACATGGG + Intronic
959203189 3:103274004-103274026 ATGCAGAGAATTCTACAGCTGGG + Intergenic
959435083 3:106305122-106305144 ATGCAAAGCATATTATGTTTGGG + Intergenic
959537898 3:107507866-107507888 ATGCAGAGCTCAGTATACTTGGG - Intergenic
960694637 3:120384089-120384111 TTGCAGAGCATACTAGAATGTGG + Intergenic
965404964 3:168256716-168256738 AGGCAGAGCTTAGAATAGTTTGG - Intergenic
965678983 3:171230935-171230957 AGGCAGAGCAGACTAGAGTTGGG - Intronic
967492277 3:190106845-190106867 ATGAAGAATATACTAGAGTTTGG + Intronic
971631235 4:28996389-28996411 ATACACAGCATACTATACTTGGG + Intergenic
972024566 4:34361168-34361190 TTGCAGAGCAGCCAATAGTTGGG + Intergenic
972720853 4:41696573-41696595 ATCCAGAGCATGCAATATTTGGG - Intronic
978767175 4:112416088-112416110 ATTCAGAGCACACTGAAGTTTGG - Intronic
983766641 4:171492101-171492123 ATTCAGAGCATACTACAGCAAGG - Intergenic
985111018 4:186546500-186546522 ATGAAGAGGGTATTATAGTTTGG - Intronic
987480743 5:18454296-18454318 ATGCAGATCATACAAAAGTAAGG + Intergenic
988788274 5:34584131-34584153 GTGCAGGGCATCATATAGTTGGG + Intergenic
992282059 5:75188817-75188839 ATGTAGATAATATTATAGTTGGG - Intronic
996493797 5:124129799-124129821 ATGCAGAGCAAACTATTCTGAGG + Intergenic
996676626 5:126182682-126182704 GTGGAGTGCATATTATAGTTGGG - Intergenic
996892323 5:128436457-128436479 AGGCAGAGCATAGAGTAGTTTGG - Intronic
998652408 5:144135612-144135634 AACCAGAGCCTATTATAGTTTGG - Intergenic
999971888 5:156872566-156872588 ATGGAGGGCATACCAGAGTTGGG + Intergenic
1001885980 5:175290668-175290690 CTGCAGGGCAGAATATAGTTTGG + Intergenic
1003535689 6:6973479-6973501 ATGCTGTGCACACTATAGTTCGG - Intergenic
1007051731 6:38838129-38838151 ATGCAGAGGACACTACAGCTTGG + Intronic
1008559070 6:52705497-52705519 ATGCAGATGAGACTATAGTGTGG + Intergenic
1009427779 6:63533542-63533564 AAACAACGCATACTATAGTTTGG - Intronic
1010306244 6:74326216-74326238 ATGAAGAGCATTCTAAACTTTGG + Intergenic
1010445501 6:75944327-75944349 ATGCATAGCGTAGTATAATTAGG + Intronic
1011893660 6:92197687-92197709 ATTCAGAGCTTGCTATAGCTAGG + Intergenic
1014148889 6:118030510-118030532 AAGTAGAGCATACTACAGATTGG + Intronic
1015458190 6:133454364-133454386 ATGCAGAGTATAATCTAGATGGG - Intronic
1020464962 7:8466957-8466979 ATGCAGAAACTACTATGGTTTGG - Intronic
1024510676 7:50202219-50202241 ATGCAGAGCATGCTGCAGTTTGG + Intergenic
1026368574 7:69674916-69674938 GTGCACAGCATCCTATAATTTGG + Intronic
1027867537 7:83666687-83666709 ACGTAGAGCAGACAATAGTTGGG - Intergenic
1029602263 7:101574429-101574451 ATGCAGAGAATGTTATGGTTTGG - Intergenic
1029955926 7:104639691-104639713 ATGCAATGCAGACTATGGTTTGG + Intronic
1030745051 7:113155080-113155102 ATGCAGAGTATAAAGTAGTTAGG - Intergenic
1030895515 7:115054767-115054789 GAGCAGAGTCTACTATAGTTAGG - Intergenic
1040053527 8:43037752-43037774 AACCAGATCATAATATAGTTTGG - Intronic
1043686225 8:83090000-83090022 AGGCAGAGCATATAATATTTGGG + Intergenic
1044305128 8:90630972-90630994 ATGCAGATTGTAATATAGTTTGG - Intronic
1048669716 8:136704526-136704548 ATGCATAGCATACTTTGGGTTGG + Intergenic
1051760366 9:20457147-20457169 ATGCAGATAATACTCTTGTTAGG - Intronic
1053780970 9:41606739-41606761 ATGGACAGAATAATATAGTTTGG + Intergenic
1054168913 9:61816896-61816918 ATGGACAGAATAATATAGTTTGG + Intergenic
1054668617 9:67763915-67763937 ATGGACAGAATAATATAGTTTGG - Intergenic
1054697870 9:68378840-68378862 ATTCACAGCAATCTATAGTTTGG + Intronic
1054989705 9:71309525-71309547 TTGCAGAGCATACTTTATTTTGG - Intronic
1055145558 9:72930210-72930232 AGTCAGAGCATAATATAGTTGGG - Intronic
1055671385 9:78609923-78609945 ATGCAGAGGATATTAAAGTCGGG + Intergenic
1056432009 9:86537048-86537070 ATGCACAGCATATGATATTTTGG + Intergenic
1057062580 9:92018844-92018866 TTGCAGAGTATTCTGTAGTTTGG - Intergenic
1060630973 9:125158349-125158371 AGACAGAGGTTACTATAGTTTGG - Exonic
1186375958 X:9001728-9001750 ATGCAGAGCTTATTACATTTAGG + Intergenic
1190341637 X:49301262-49301284 ATGTAAAGCATACTACAGTTTGG - Intronic
1190343826 X:49319639-49319661 ATACAAAGCACACTACAGTTTGG - Intronic
1190344921 X:49329182-49329204 ATACAAAGCACACTACAGTTTGG - Intronic
1190346015 X:49338747-49338769 ATACAAAGCACACTACAGTTTGG - Intronic
1190347267 X:49529780-49529802 ATACAAAGCACACTACAGTTTGG - Intergenic
1190349467 X:49548892-49548914 ATACAAAGCACACTACAGTTTGG - Intronic
1190350571 X:49558444-49558466 ATACAAAGCACACTACAGTTTGG - Intronic
1190351673 X:49568003-49568025 ATACAAAGCACACTACAGTTTGG - Intronic
1190352773 X:49577552-49577574 ATACAAAGCACACTACAGTTTGG - Intronic
1190353874 X:49587099-49587121 ATACAAAGCACACTACAGTTTGG - Intronic
1190354976 X:49596622-49596644 ATACAAAGCACACTACAGTTTGG - Intronic
1190356008 X:49605575-49605597 ATACAAAGCACACTACAGTTTGG - Intronic
1192501247 X:71654053-71654075 ATTCTGAGCAAACTATAGTAAGG - Intergenic
1192988143 X:76422519-76422541 ATTCAGAGCTTGCTATAGTAAGG + Intergenic
1193734204 X:85137184-85137206 ATGCAGAGAAGTTTATAGTTGGG + Intergenic
1193820592 X:86159534-86159556 ATGCAAAGCATACAATCTTTAGG + Intronic
1194041982 X:88952436-88952458 ATACTGAGCATACTATAGCAAGG + Intergenic
1198673993 X:139112316-139112338 ATGGAGAGCCTACTATATGTTGG - Intronic