ID: 915254600

View in Genome Browser
Species Human (GRCh38)
Location 1:154616787-154616809
Sequence CTGGGTACACAGATCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915254600_915254603 -7 Left 915254600 1:154616787-154616809 CCCAGATAGATCTGTGTACCCAG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 915254603 1:154616803-154616825 TACCCAGAACGAAGGTTAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915254600 Original CRISPR CTGGGTACACAGATCTATCT GGG (reversed) Intronic
903739134 1:25548141-25548163 ATGGGAACACTGATCTATCCTGG + Intronic
904445694 1:30571552-30571574 CTGGGGAAACGGAGCTATCTGGG + Intergenic
905246111 1:36615117-36615139 CTTTGTACACACATCTATGTCGG - Intergenic
905879292 1:41453192-41453214 CTGGTAACCCAGATCTATCTGGG + Intergenic
906132539 1:43469163-43469185 CTGGGTCCACAGCTATAGCTTGG + Intergenic
906792590 1:48671862-48671884 CTGGGCACTCAGTTCTAGCTGGG - Intronic
915254600 1:154616787-154616809 CTGGGTACACAGATCTATCTGGG - Intronic
915934375 1:160082146-160082168 CTGGGCAGAGAGATCTGTCTAGG + Intronic
917833153 1:178914594-178914616 CTAGATACTCAGATCTCTCTTGG + Intronic
918708739 1:187701570-187701592 CAGGGTAAACAGATCTACCCTGG - Intergenic
921516824 1:216103235-216103257 CTGGGTACACAAGGCTATCCGGG + Intronic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1069345809 10:67468535-67468557 CAGGGTACAGAGATGTAGCTTGG + Intronic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1077925951 11:6682340-6682362 CTCGGTACAAAGATCAAACTGGG - Exonic
1078315311 11:10289342-10289364 CTGGGTCCACAGCTCTGACTTGG + Intronic
1078428793 11:11271538-11271560 CTAGGTAGACAGAACTACCTAGG - Intronic
1078526424 11:12104915-12104937 CTGCCTCCCCAGATCTATCTGGG - Intronic
1079593715 11:22214334-22214356 CTGGGTACACAGTTGATTCTAGG - Intronic
1082962193 11:58928917-58928939 TAGGGTAAACAGATCTAACTGGG + Intronic
1083207596 11:61161775-61161797 CTCTGTACACAGCTCGATCTTGG + Intergenic
1085253974 11:75161948-75161970 CTGAGGACACAGAGCTGTCTTGG - Intronic
1086382788 11:86274913-86274935 GTGGGTCCACAGATTTTTCTAGG + Intronic
1087489833 11:98811040-98811062 CTGGGTTCACAAATGTGTCTGGG + Intergenic
1089665192 11:120013793-120013815 CTGGGGACGCAGAACTATCTAGG - Intergenic
1092995154 12:13942818-13942840 CTGGGTACACAGCACTATATGGG + Intronic
1094173274 12:27516939-27516961 CTGGGTATACAGAGCCATTTCGG + Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1095968751 12:47886910-47886932 ATGGCTACAAAGAGCTATCTAGG - Intronic
1103408818 12:120695911-120695933 CTGGGAACCCAGAACTCTCTGGG + Intronic
1107757798 13:43644340-43644362 AGGCGTACACAGAGCTATCTAGG - Intronic
1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG + Intergenic
1112361119 13:98719529-98719551 CTGGGAACACCCATCTATTTAGG - Intronic
1114358802 14:21946506-21946528 CTGGGTACACAATTCTAGGTTGG - Intergenic
1117014466 14:51504677-51504699 CTGGTAACACAGCTCTGTCTGGG + Intronic
1119719571 14:76882008-76882030 CTGGGTGCAGGGCTCTATCTGGG + Intergenic
1119943687 14:78668979-78669001 CTAGGTAGACAGATAGATCTAGG - Intronic
1123675530 15:22707682-22707704 ATGGCAACACAGATATATCTTGG + Intergenic
1124327520 15:28780622-28780644 ATGGCAACACAGATATATCTTGG + Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1124529531 15:30492630-30492652 ATGGCAACACAGATATATCTTGG + Intergenic
1125187261 15:36945260-36945282 CTGGGCACCCAAATCTATCTGGG + Intronic
1126954144 15:53913815-53913837 CTTGGTACACAGATATGTGTAGG + Intergenic
1128568699 15:68718051-68718073 CTAGGAGCACAGCTCTATCTAGG - Intronic
1128636668 15:69306803-69306825 CTGGGTACAGAGTTTCATCTGGG - Intronic
1128840366 15:70845774-70845796 CTGTGTACATAGAGCCATCTAGG - Intronic
1130072927 15:80664315-80664337 CTGGTTTCACAAGTCTATCTAGG - Intergenic
1133679330 16:8106166-8106188 CTAGGTAAACAGAGCAATCTAGG - Intergenic
1136627001 16:31467387-31467409 CTGGACACACAGATCTTGCTTGG + Intergenic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1138687220 16:58735930-58735952 CAAGGTACACAGTTCTATCTCGG - Intergenic
1138980767 16:62265355-62265377 TTGGGTACACATATATATGTAGG - Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1143173456 17:4943421-4943443 CTGGATACAACGAGCTATCTGGG - Exonic
1145995416 17:29102253-29102275 CTGGGTTCCCAGGCCTATCTTGG - Intronic
1146595213 17:34162452-34162474 CTGGGTGCACAGATTCCTCTTGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149167061 17:53764785-53764807 CTGGTTACAGAGACCTCTCTTGG - Intergenic
1150443687 17:65211964-65211986 CTGGGTCCACTCATCTGTCTAGG + Intronic
1156474552 18:37397442-37397464 CTGGGTACCCAGGACCATCTGGG + Intronic
1159199259 18:65162634-65162656 CTTGTTACAGAAATCTATCTAGG - Intergenic
1159626730 18:70703745-70703767 CTGTGTACACAGATCTTTTGAGG + Intergenic
1160092872 18:75843592-75843614 CTGGGGTCATGGATCTATCTGGG - Intergenic
1160693297 19:470170-470192 CTGGGAACTCAGATCGGTCTGGG + Intronic
1163785342 19:19272299-19272321 CTGTGTACAAAGATTTGTCTTGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926222417 2:10944877-10944899 CTGGGTCCCCAGATCCATGTGGG - Intergenic
928111809 2:28516706-28516728 CTGGGCACACAGATATGGCTAGG + Intronic
932385052 2:71324252-71324274 CTGTGTACACAGTGCTATCAGGG + Intronic
933512911 2:83263664-83263686 CTGGGTAGACATATAAATCTAGG + Intergenic
936151620 2:110025074-110025096 CTGGGCACTCAGATCCAGCTGGG + Intergenic
936193054 2:110346295-110346317 CTGGGCACTCAGATCCAGCTGGG - Intergenic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
942215623 2:173716661-173716683 CTGGATACACAGATTTTTCGTGG - Intergenic
943458292 2:188136265-188136287 CTGGATAAACAGAACTATATGGG + Intergenic
945724459 2:213458675-213458697 CTGTGTACACAGTTGTATATTGG + Intronic
948036419 2:234861858-234861880 CTGGGTATACAGTTCTTACTTGG + Intergenic
1169976139 20:11330336-11330358 CTGGGCACACTGATTTATTTTGG + Intergenic
1170664900 20:18378365-18378387 CTGGGCCCACAGAGCCATCTGGG - Intergenic
1174041056 20:47699822-47699844 CTGGGCCCACAGTTCTACCTGGG + Intronic
1175370585 20:58486691-58486713 ATGGGTACACAAATCTAGGTTGG - Intronic
1177399681 21:20586806-20586828 CTGGGTATATATATATATCTGGG - Intergenic
1177399683 21:20586824-20586846 CTGGGTATATATATATATCTGGG - Intergenic
1178165911 21:29976632-29976654 CTGGATACTCAGATGTATATAGG - Intergenic
1178373262 21:32045256-32045278 CTGGGTACAGAGGTCTAAGTTGG - Intergenic
1181871486 22:25902745-25902767 TGGGGGACACAGAGCTATCTTGG + Intronic
1203292563 22_KI270736v1_random:9576-9598 CTGGGTCCACAAATCTAACATGG - Intergenic
950851226 3:16063982-16064004 CTGGGTACCCAGATCTGGATGGG + Intergenic
968981953 4:3855032-3855054 CTGGGCACACATTTCTATTTTGG - Intergenic
971881052 4:32372728-32372750 CTGGGAACACAAAGCTGTCTTGG - Intergenic
972027682 4:34406007-34406029 CTGTGTGCACAGATATATGTGGG + Intergenic
972358402 4:38303796-38303818 CTGGGTTCACAGCCATATCTTGG + Intergenic
975818680 4:78247109-78247131 CTGGGACCACAGATCTGCCTTGG + Intronic
978130938 4:105196426-105196448 CTGGGTTCACAGAGCTATTCAGG - Intronic
980059783 4:128116777-128116799 GTGGGTATACAGATCTTTGTTGG + Intronic
980593787 4:134926701-134926723 CTGGGTACATATATATATATAGG + Intergenic
980722074 4:136711341-136711363 CTGTCTTCTCAGATCTATCTAGG + Intergenic
982307302 4:153946056-153946078 ATGGGCACACAGATCAATGTGGG - Intergenic
985334264 4:188874479-188874501 CTGGGACCACAGATCTGTATTGG - Intergenic
985334287 4:188874739-188874761 CTGGGACCACAGATCTGTATTGG - Intergenic
985334296 4:188874906-188874928 CTGGGACCACAGATCTGTATTGG - Intergenic
985826339 5:2194306-2194328 CTTTGTACCCAGAACTATCTAGG + Intergenic
988225614 5:28408112-28408134 CTGGTTACATAGATATAACTAGG - Intergenic
989487354 5:42007562-42007584 CTGGGTACTCAGATTAATCAAGG - Intergenic
992628528 5:78657908-78657930 ATGGGTACCCAGTTCTTTCTAGG + Intronic
997447732 5:133953706-133953728 CTGGGTACACAGATGAATGCGGG - Intergenic
998800515 5:145864352-145864374 CAGGCTACACAGAGCTTTCTGGG + Intronic
1006702970 6:35991916-35991938 CTGGGTACAAAGGTCTTTATGGG + Intronic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1013558600 6:111282692-111282714 CTGGTTAAACAGTTCTAACTTGG + Intergenic
1015968284 6:138717030-138717052 CTTGGTGCACAGGTTTATCTAGG - Intergenic
1016285447 6:142467929-142467951 CTGGGTAGACAGGACTCTCTAGG + Intergenic
1017615251 6:156240404-156240426 GTGGGCACAGAGATCAATCTGGG + Intergenic
1017727677 6:157286961-157286983 CAGGGCACACAGAAATATCTTGG - Intergenic
1018328737 6:162704420-162704442 CTGGCTTCACTGTTCTATCTTGG + Intronic
1019906929 7:4071879-4071901 CTGTGTACACACATCTACCAAGG - Intronic
1021474322 7:21043454-21043476 CTGAGTACACAGACCCTTCTAGG + Intergenic
1024830334 7:53446704-53446726 CAAGGTAAACAGATTTATCTTGG - Intergenic
1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG + Intergenic
1028968093 7:96825406-96825428 CTGGGTACACAGATGTCTTCTGG + Intergenic
1031501176 7:122518747-122518769 CTGGGAACACACATTTAACTGGG + Intronic
1034564487 7:151902276-151902298 CTGGCTCCACGGATCTATCTTGG - Intergenic
1043640592 8:82445295-82445317 CTGAGTTCAAAGACCTATCTAGG - Intergenic
1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG + Intergenic
1050035369 9:1430013-1430035 CTGGGTACACAAATGTAACCTGG - Intergenic
1052730865 9:32283697-32283719 CTGGGGACACAGAGTTCTCTTGG - Intergenic
1057929386 9:99180434-99180456 TTGAGCAAACAGATCTATCTAGG + Intergenic
1061768127 9:132895595-132895617 CTGTTTACACAGAACTTTCTAGG + Exonic
1062324075 9:136004167-136004189 CTGTGTGCTCAGATCTATGTGGG + Intergenic
1187268589 X:17759721-17759743 CTGGGTACACAGACTTTTCCTGG - Intergenic
1193005376 X:76612476-76612498 ATGGGAACACAGATATCTCTTGG - Intergenic
1197715019 X:129700365-129700387 CTAGGTACAAAGATATGTCTTGG - Intergenic