ID: 915259153

View in Genome Browser
Species Human (GRCh38)
Location 1:154663643-154663665
Sequence TGAACAGCAGGCAACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915259153_915259156 17 Left 915259153 1:154663643-154663665 CCTTCCTTGTTGCCTGCTGTTCA No data
Right 915259156 1:154663683-154663705 ACAAATAGCACACCACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915259153 Original CRISPR TGAACAGCAGGCAACAAGGA AGG (reversed) Intergenic