ID: 915261059

View in Genome Browser
Species Human (GRCh38)
Location 1:154677345-154677367
Sequence CTCCTCACTGCTGCGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915261054_915261059 -7 Left 915261054 1:154677329-154677351 CCACCGAGGCCTAGACCTCCTCA 0: 33
1: 73
2: 49
3: 59
4: 139
Right 915261059 1:154677345-154677367 CTCCTCACTGCTGCGAAAGGAGG No data
915261053_915261059 -1 Left 915261053 1:154677323-154677345 CCAAAACCACCGAGGCCTAGACC 0: 15
1: 58
2: 86
3: 132
4: 145
Right 915261059 1:154677345-154677367 CTCCTCACTGCTGCGAAAGGAGG No data
915261051_915261059 29 Left 915261051 1:154677293-154677315 CCAAATAGACTCTTTGGCAGCAG 0: 145
1: 83
2: 41
3: 17
4: 172
Right 915261059 1:154677345-154677367 CTCCTCACTGCTGCGAAAGGAGG No data
915261055_915261059 -10 Left 915261055 1:154677332-154677354 CCGAGGCCTAGACCTCCTCACTG 0: 82
1: 44
2: 29
3: 77
4: 278
Right 915261059 1:154677345-154677367 CTCCTCACTGCTGCGAAAGGAGG No data
915261050_915261059 30 Left 915261050 1:154677292-154677314 CCCAAATAGACTCTTTGGCAGCA 0: 147
1: 88
2: 34
3: 16
4: 211
Right 915261059 1:154677345-154677367 CTCCTCACTGCTGCGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915261059 Original CRISPR CTCCTCACTGCTGCGAAAGG AGG Intergenic
No off target data available for this crispr