ID: 915262211

View in Genome Browser
Species Human (GRCh38)
Location 1:154685136-154685158
Sequence TAGCGGGTTAGGTGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915262197_915262211 20 Left 915262197 1:154685093-154685115 CCAGTCCCCACTCGGTGGAAGAT No data
Right 915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG No data
915262200_915262211 14 Left 915262200 1:154685099-154685121 CCCACTCGGTGGAAGATGGCAGA No data
Right 915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG No data
915262199_915262211 15 Left 915262199 1:154685098-154685120 CCCCACTCGGTGGAAGATGGCAG No data
Right 915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG No data
915262201_915262211 13 Left 915262201 1:154685100-154685122 CCACTCGGTGGAAGATGGCAGAG No data
Right 915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915262211 Original CRISPR TAGCGGGTTAGGTGGGCAGA AGG Intergenic
No off target data available for this crispr