ID: 915262681

View in Genome Browser
Species Human (GRCh38)
Location 1:154689398-154689420
Sequence CAGCCCCCTGCCGTAGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915262673_915262681 27 Left 915262673 1:154689348-154689370 CCTGGCTTATTACTGGCTGTTGG No data
Right 915262681 1:154689398-154689420 CAGCCCCCTGCCGTAGGCCTTGG No data
915262672_915262681 28 Left 915262672 1:154689347-154689369 CCCTGGCTTATTACTGGCTGTTG No data
Right 915262681 1:154689398-154689420 CAGCCCCCTGCCGTAGGCCTTGG No data
915262677_915262681 -8 Left 915262677 1:154689383-154689405 CCTAGTGGCTGCCCACAGCCCCC No data
Right 915262681 1:154689398-154689420 CAGCCCCCTGCCGTAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915262681 Original CRISPR CAGCCCCCTGCCGTAGGCCT TGG Intergenic
No off target data available for this crispr