ID: 915266517

View in Genome Browser
Species Human (GRCh38)
Location 1:154722059-154722081
Sequence TTGTTTGTAGGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 506}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915266517_915266523 -3 Left 915266517 1:154722059-154722081 CCCTCTTCCCTCCCTACAAACAA 0: 1
1: 0
2: 6
3: 33
4: 506
Right 915266523 1:154722079-154722101 CAAATAAATAAAAATAGTGCTGG 0: 1
1: 0
2: 12
3: 214
4: 1856
915266517_915266524 6 Left 915266517 1:154722059-154722081 CCCTCTTCCCTCCCTACAAACAA 0: 1
1: 0
2: 6
3: 33
4: 506
Right 915266524 1:154722088-154722110 AAAAATAGTGCTGGCTCTCATGG 0: 1
1: 0
2: 0
3: 19
4: 300
915266517_915266525 12 Left 915266517 1:154722059-154722081 CCCTCTTCCCTCCCTACAAACAA 0: 1
1: 0
2: 6
3: 33
4: 506
Right 915266525 1:154722094-154722116 AGTGCTGGCTCTCATGGCAAAGG 0: 1
1: 0
2: 2
3: 14
4: 175
915266517_915266526 17 Left 915266517 1:154722059-154722081 CCCTCTTCCCTCCCTACAAACAA 0: 1
1: 0
2: 6
3: 33
4: 506
Right 915266526 1:154722099-154722121 TGGCTCTCATGGCAAAGGCTAGG 0: 1
1: 0
2: 0
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915266517 Original CRISPR TTGTTTGTAGGGAGGGAAGA GGG (reversed) Intronic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
902436883 1:16403894-16403916 TTGGTTGCGGGGAGAGAAGAGGG - Intronic
902824288 1:18962357-18962379 TTGTTTTTTGGGAGGAGAGATGG - Intergenic
903214370 1:21835344-21835366 ATATTTCAAGGGAGGGAAGAAGG - Intronic
903448546 1:23437469-23437491 TTGTCTGTCGGGAGAGAAGGGGG + Exonic
903825118 1:26139056-26139078 GTGTTTGTAGGGCGTGAAGAGGG - Intergenic
903867437 1:26409891-26409913 AGGTTTGGAGGGAGGAAAGAAGG + Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904175417 1:28624944-28624966 ATGTTTGTGGGTAGGGGAGAAGG - Intronic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
904889917 1:33772073-33772095 TTGGATTTAGGGAGGGAAAAGGG - Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905393974 1:37655666-37655688 GGGTTTTGAGGGAGGGAAGAGGG - Intergenic
905400358 1:37697756-37697778 TTGTTTCTAGAGATGGCAGAAGG + Intronic
905583457 1:39099591-39099613 TCATGTGTAGGGAGGAAAGAGGG - Intronic
905811305 1:40915407-40915429 TGGTTTGGAGGGAGGGCTGATGG - Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906751860 1:48270738-48270760 TTTTTTGTGGAGTGGGAAGATGG - Intergenic
906901232 1:49838349-49838371 GTGTCTGTAGGGCAGGAAGAAGG - Intronic
906950443 1:50330969-50330991 TTTTTTATAGAGTGGGAAGACGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908223033 1:62027564-62027586 TTGTTGGTAGGGATGTAAAATGG - Intronic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
909203897 1:72728158-72728180 TGGTTTGTTGGGAGGGACAAAGG + Intergenic
909523123 1:76592255-76592277 AGGTTTGGAGGGAAGGAAGATGG + Intronic
909901238 1:81138373-81138395 TTGTTTGTAGGAGGGCAGGAAGG - Intergenic
910503202 1:87918452-87918474 TTTTCTCTGGGGAGGGAAGAGGG + Intergenic
911821440 1:102428853-102428875 TTGATTAAAGGGAGGAAAGAAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912707878 1:111928382-111928404 TTTTTTGTGGGAAGGTAAGAAGG - Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
913417837 1:118631525-118631547 TTGTTTGCAGGGGGGAAAAAGGG + Intergenic
914863560 1:151406387-151406409 TTGTTAGTGGGGAAGGAAGGAGG + Exonic
914876683 1:151517477-151517499 TTGGTGGGAGGAAGGGAAGAAGG + Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915491806 1:156254246-156254268 TTGGTTGTAGGTGGAGAAGAGGG - Intronic
915945667 1:160149753-160149775 GAGTTTGGAGGGAGGGAAGGTGG + Intergenic
916000688 1:160612396-160612418 TTTTTTTTAAGGTGGGAAGAGGG - Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
916929435 1:169560102-169560124 TTGTTTGTAAGAAAGGAAGCTGG + Intronic
918458497 1:184752303-184752325 TTGTTGGTGGGGAGGGAAAGGGG + Intronic
918535082 1:185565031-185565053 TTCTTTGTATGAAGGCAAGAGGG + Intergenic
918781828 1:188709366-188709388 TTGTTTGTGGGGAGAGGAGGAGG + Intergenic
919119629 1:193322891-193322913 TTGCTTGTAGGAATGGAAAATGG - Intergenic
919404106 1:197154670-197154692 TTGTTTGTTTTGAGGGTAGAGGG - Exonic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
920395851 1:205645479-205645501 TTGCTTGAATGGAGGGAAGCAGG + Intergenic
920433744 1:205935320-205935342 TTTTTTGTAAGGAGGGAACAGGG + Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921542429 1:216432529-216432551 ATGTTTGTGGGTATGGAAGAAGG - Intergenic
921582063 1:216906537-216906559 TGGCTGGTAGGGAGGGAAGTAGG - Intronic
922184237 1:223259838-223259860 TGGTTTGAAGGGTGGGAATATGG - Intronic
922272766 1:224049441-224049463 TTGCTTCTAGGGAAGGAAGCTGG + Intergenic
922579874 1:226688899-226688921 TTGTTTGTTGGGGGGGAAAATGG - Intronic
923143750 1:231183605-231183627 TTGTTGGGAGGGAGGGATGGGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923466641 1:234253550-234253572 CTGTTAGTAGGATGGGAAGAGGG + Intronic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
924953293 1:248905711-248905733 TTCTTTGTTGAGAGGGAAGGAGG - Intergenic
1063640984 10:7830323-7830345 ATTTTTGGAGGGAGGGAGGAAGG - Intronic
1064588845 10:16867379-16867401 TTGTTTGTAGTGAGGAGAGGGGG - Intronic
1064977942 10:21137759-21137781 TTTTTTGTAGAGATGGCAGAGGG - Intronic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065233282 10:23621090-23621112 GTGCATGTAGGGAGGGAAAAAGG + Intergenic
1065957083 10:30703503-30703525 TTTTCTGTAGGGTGGGAAGGGGG - Intergenic
1067073824 10:43160948-43160970 TTGTTAGCAGGGGGAGAAGAAGG - Intronic
1067094766 10:43293135-43293157 ATGTTTTTAGGGACAGAAGAGGG - Intergenic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1067817832 10:49496082-49496104 TCGATTGGAGGAAGGGAAGACGG - Intronic
1067903479 10:50266237-50266259 TTTGTTGTTGGGAGTGAAGAAGG + Intergenic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1068506231 10:57902973-57902995 TTGTTGGCAGGAAGGTAAGATGG + Intergenic
1069002755 10:63284028-63284050 TTGTTTTTTGGGAGGGGGGACGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1071529586 10:86378524-86378546 TTGTTTGTGGGAACGTAAGAGGG + Intergenic
1071791975 10:88964569-88964591 TTCTTGGTAGAGAGGGAAGGAGG + Intronic
1073127960 10:101163668-101163690 TTGTATGTAGGGAGAAAGGAGGG - Intergenic
1073703825 10:105959957-105959979 TCCTTTGTAGGCAGGGATGACGG - Intergenic
1073951039 10:108809677-108809699 TTGTTTGTAAGAAAGGAACAGGG - Intergenic
1074360464 10:112821174-112821196 TTGTTTGGATGAAGGGAAGGAGG - Intergenic
1074645052 10:115440224-115440246 TTGATTTCAGGGATGGAAGAGGG - Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075549905 10:123384475-123384497 TTCTTTGTAGGGGTGGAACAAGG + Intergenic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1076023252 10:127091595-127091617 TTGTTTAGAGGGAGGGAGAAGGG + Intronic
1076225091 10:128768185-128768207 TTCTTTGAGGGGAGGGAAGCTGG + Intergenic
1078052131 11:7974957-7974979 AGCTTTGCAGGGAGGGAAGAAGG + Intronic
1079264695 11:18920027-18920049 ATGTTTCTCGGGAGGGAAAAGGG + Intergenic
1079640602 11:22800208-22800230 TTGTTCTTATGGAGGGATGAGGG + Intronic
1079828411 11:25229787-25229809 TGGGGTGGAGGGAGGGAAGAGGG - Intergenic
1081279285 11:41188146-41188168 TTGTGTGTTGGGTGGGAGGAGGG - Intronic
1081408243 11:42723400-42723422 TTGTTTATAGGTAGTGTAGATGG - Intergenic
1082131056 11:48489803-48489825 TTCTTTGAAGAAAGGGAAGATGG - Intergenic
1083313963 11:61802755-61802777 TGGCTAGTAGGGAGGGAAGAGGG - Intronic
1084242865 11:67834510-67834532 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1084830134 11:71762465-71762487 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
1085119571 11:73958520-73958542 TAGATTCTAGGCAGGGAAGAAGG - Intronic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1088209991 11:107444105-107444127 TTTTTTTTAAGGAGGGAAGGGGG + Intronic
1088477351 11:110256024-110256046 TTGTGTGTAGGGTGGTAAAACGG - Intronic
1088587553 11:111372834-111372856 TTGTGTGTTGGGAGGGAGAAGGG + Intronic
1089005339 11:115086167-115086189 TTGTTTCCAGGGAGGGAGGGTGG - Intergenic
1089052482 11:115557717-115557739 TGGTTTGGAGGGAGGGAGAAAGG - Intergenic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1090283934 11:125482396-125482418 TTGTTTTTAGTGGGGAAAGATGG + Intronic
1090299481 11:125623124-125623146 CTGTTTGTAGGGGGTGTAGATGG + Intronic
1091404901 12:203234-203256 TTTTTTGTAGAGACGGGAGAAGG + Intronic
1091686965 12:2569462-2569484 TTGGTTGCTGGGAGGGAAGATGG - Intronic
1092413105 12:8269219-8269241 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1092910488 12:13140968-13140990 TTGGATGTAGGGCGGGATGAGGG - Intronic
1093010358 12:14100982-14101004 TTGTTTGAGTGGAGGGCAGAGGG + Intergenic
1093019641 12:14191462-14191484 GAGTTTGGAGGGAGGGAGGAGGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094641817 12:32283113-32283135 AGGTTTTCAGGGAGGGAAGATGG + Intronic
1094739110 12:33268422-33268444 TGGTTAGGAGGGAGGGAAAAAGG + Intergenic
1097756015 12:63407472-63407494 TAGTTTGAAGTGAGGGAATAGGG + Intergenic
1098100227 12:67007472-67007494 TTGTTTTTTGGGGGGGATGAGGG - Intergenic
1098369860 12:69746481-69746503 AGGGTTGTGGGGAGGGAAGAGGG - Intronic
1101018247 12:100524823-100524845 ATGTTTGTTGGGAGGGAAGATGG - Intronic
1101175793 12:102150550-102150572 TCGTAAGTAGGGAGTGAAGAGGG - Intronic
1101406429 12:104433132-104433154 GTGTTTTTAGGGAAGGAAGGCGG - Intergenic
1102262789 12:111454929-111454951 TTGATAGTGGGGAGGGAAGCCGG - Intronic
1102416918 12:112771486-112771508 TTGTTTGTAGTGACATAAGAAGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1105256954 13:18750096-18750118 TTGTTAGTAGGGTGGTGAGAGGG - Intergenic
1105259635 13:18769471-18769493 TTGTTAGTAGGGTGGTGAGAGGG - Intergenic
1105262311 13:18788788-18788810 TTGTTAGTAGGGTGGTGAGAGGG - Intergenic
1105336997 13:19481598-19481620 TTGTTTGGAGTGGGGAAAGAAGG + Intronic
1105433210 13:20356390-20356412 CTGTTTGGAGGCAGGGAAGGAGG - Intergenic
1105836723 13:24218319-24218341 TAATCTGTAGGGAAGGAAGAGGG + Intronic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1109714962 13:66209464-66209486 TTGTTAGTACTGAGGGAAAATGG - Intergenic
1110215658 13:73021832-73021854 TTTTTTGAAAGGAGGAAAGAGGG + Intergenic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1111809826 13:93085983-93086005 TTGTTGGTAGGGATGTAAGATGG + Intergenic
1111896627 13:94150163-94150185 ATTTGTGTAGGAAGGGAAGAGGG - Intronic
1112864007 13:103871538-103871560 TTGTTTATAGCAAGGCAAGAAGG - Intergenic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1114638771 14:24205103-24205125 TTGTATGTAGGGATTGAGGAAGG + Intronic
1115372915 14:32638723-32638745 TTGGTTGTTGGTAGGGTAGAGGG + Intronic
1116623577 14:47237814-47237836 TTGTGTCTAGGGAGAGATGATGG - Intronic
1116782278 14:49250078-49250100 TTTTTTGCGGGGAGGCAAGATGG + Intergenic
1117002979 14:51390537-51390559 TTGTTTGAATGGAGAGTAGAAGG - Intergenic
1117697663 14:58382572-58382594 TTTTTTGGTGGGGGGGAAGATGG + Intergenic
1117928194 14:60807391-60807413 TTGTTTGTAGGGCAAGAAGCAGG + Intronic
1118113839 14:62752052-62752074 TTGTTGGTTGGAAGGGATGAAGG - Intronic
1118659380 14:67990917-67990939 TTCTTTTTAGAGAGGGTAGAAGG + Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1121893204 14:97618066-97618088 TTGTTGGTGGGAATGGAAGATGG + Intergenic
1121916237 14:97838986-97839008 TTGTTTTTCGGGAGGGAAAGAGG - Intergenic
1122961927 14:105097875-105097897 TTGCTTATGGGGAGGGCAGAGGG + Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1124856412 15:33393527-33393549 TTATTGATAGGGAGGGAAGCAGG + Intronic
1124911427 15:33924985-33925007 TTGTTTGTAGGTAAGGCAAAAGG - Intronic
1125021680 15:34992574-34992596 TTTTTTGGGGGGAGGGGAGATGG + Intergenic
1125177070 15:36836189-36836211 TTGTTAGTGGGGAGGTAAAACGG + Intergenic
1126336814 15:47594204-47594226 TTGTTTGTACCTAGGGAAAATGG - Intronic
1126442774 15:48709384-48709406 TTTTTTGTAGAGATGGAAGCGGG + Intergenic
1127371874 15:58349056-58349078 TTGTTTTGATGGAGGGAACAAGG + Intronic
1127485958 15:59417912-59417934 TGGGTTGTGGGGAGGGAGGAGGG - Intronic
1127603837 15:60566392-60566414 TTGGTCATAGGCAGGGAAGAGGG + Intronic
1127930238 15:63591506-63591528 TTGTTTGCGGGGAGGTAAGATGG + Intronic
1128406803 15:67349912-67349934 TTGTTGGTAGGGATGCAAAATGG + Intronic
1129022172 15:72530384-72530406 TTGTTAGTAGAGGGGGAAGTTGG + Intronic
1129506044 15:76082388-76082410 GTGGTAGAAGGGAGGGAAGAAGG + Intronic
1129762026 15:78134748-78134770 GTGTTTGCTGGGAGGGAGGATGG + Intronic
1129946623 15:79543946-79543968 TTGGTTTTAGTGAGGGAGGATGG - Intergenic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131515625 15:93074378-93074400 AAGTTTGAAGGGAGGGGAGAAGG + Intronic
1131865572 15:96705095-96705117 TTGTCTGTAGGGATGAAAGCTGG + Intergenic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1134185198 16:12079532-12079554 TTGTTGCTAAGGAAGGAAGAAGG + Intronic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1138412327 16:56850447-56850469 TTCTTTGCAGGGAGTGGAGAAGG - Intergenic
1138578424 16:57923525-57923547 TTGCCTGGAGGGAGGGAAAACGG + Intronic
1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG + Intergenic
1139420720 16:66848052-66848074 GTATTTGTGGGGAGGGGAGAAGG - Intronic
1139711553 16:68780158-68780180 TTGCTGGAAGGGAGGGAAGGAGG - Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141767544 16:86068396-86068418 TCGTTTGTGGGGTGGGAACAGGG + Intergenic
1141767559 16:86068521-86068543 TCGTTTGTGGGGTGGGAACAGGG + Intergenic
1146730155 17:35186280-35186302 TTGTCTGGAGGCAGGGAAAAAGG - Exonic
1147394491 17:40131135-40131157 TAGTTTGTTTGGAGGGAGGAGGG + Intronic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1147421864 17:40325955-40325977 TTGGATTTAGGGAGGGGAGAAGG - Intronic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148468289 17:47877892-47877914 GTCTTAGGAGGGAGGGAAGAGGG - Intergenic
1149083866 17:52691016-52691038 CTGTTTGGAGGTAGGGAAGGAGG + Intergenic
1149998969 17:61420341-61420363 TTGTTTGTATGGAGGGAGGTGGG - Intergenic
1150059989 17:62059363-62059385 TTCTTGGTAGTGAGGGAAGAGGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152788015 17:82261890-82261912 ATGGTTTGAGGGAGGGAAGAGGG - Intronic
1153190578 18:2533389-2533411 TTGGCTCTAGGGAGGGAAGAAGG + Intergenic
1154208178 18:12355466-12355488 TTGCTGGTAGGGATGGAAAATGG + Intronic
1154426392 18:14275330-14275352 TTGTTAGTAGGGTGGTGAGAGGG + Intergenic
1154429132 18:14294926-14294948 TTGTTAGTAGGGTGGTGAGAGGG + Intergenic
1154431404 18:14311270-14311292 TTGTTAGTAGGGTGGTGAGAGGG + Intergenic
1154434082 18:14330574-14330596 TTGTTAGTAGGGTGGTGAGAGGG + Intergenic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1156771700 18:40735565-40735587 TGGGGTGAAGGGAGGGAAGAGGG - Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158048026 18:53180269-53180291 TTAATTGAAGGGACGGAAGAGGG + Intronic
1158184997 18:54761516-54761538 TTGTATGTAAGCAGGGAAGTAGG - Intronic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158722745 18:59940244-59940266 TTGTATGTAGAGAAGGAATAAGG - Intergenic
1159120188 18:64159851-64159873 TTGTTTTTCAGGAGCGAAGAGGG + Intergenic
1159255608 18:65941336-65941358 TTTTTTTTAGTGAGGAAAGAGGG - Intergenic
1160191837 18:76721338-76721360 CTGTTTGTGGGGAGGAAAGGAGG - Intergenic
1161186431 19:2924449-2924471 TTGTATGATGGGAGGGAAGCTGG - Intergenic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162789875 19:13057291-13057313 GTGCTTGGAGGGAGGGAAGCAGG + Intronic
1163278323 19:16299888-16299910 TTTTTGGTGGGGAGGGCAGAGGG - Intergenic
1163736240 19:18982786-18982808 TTGTTTACAGGCAGGCAAGATGG - Intergenic
1164411681 19:28011387-28011409 TTGTGTGTAGAGAGGAATGAAGG + Intergenic
1164830462 19:31316191-31316213 TTGTTTTCAGGGAGGGAGGCAGG + Intronic
1165251561 19:34540671-34540693 TGGTTTGTAAGTAGGGAGGATGG - Intergenic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1166187985 19:41154390-41154412 TGGTTTGGTGGGAGGGTAGAAGG + Intergenic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
1168464384 19:56589923-56589945 TTGGTTCTAGGGAGGGCACAAGG - Intergenic
925085527 2:1104917-1104939 TTCTTTTTAGGTAGGAAAGAAGG + Intronic
925691684 2:6530734-6530756 TTGTTTGCAGGGAAGGCAGAAGG - Intergenic
926688082 2:15714100-15714122 TTGTTATTAGGAAGGGGAGATGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928535122 2:32232666-32232688 ATGTTTGCAGGGATGGAAGATGG + Intronic
928849255 2:35723218-35723240 TTGTTTGTAGTCAGCAAAGATGG - Intergenic
929294153 2:40227557-40227579 TCTTTTGGAGGGTGGGAAGAGGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929941155 2:46335069-46335091 TTTTTAATAGGGAGGGGAGAAGG + Intronic
930238696 2:48912899-48912921 TTGTTTATTGGGAGCCAAGAGGG + Intergenic
931208378 2:60169341-60169363 TTGAATGTATGGAGGAAAGAAGG - Intergenic
931805779 2:65802655-65802677 TCGTTTCTTGGGAGGGCAGAGGG + Intergenic
932029857 2:68172280-68172302 GGGTTTTTAGGGAGGCAAGAGGG + Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932894701 2:75627868-75627890 TTGGTTGTAGGGATGGAGGTGGG + Intergenic
934492013 2:94767928-94767950 TTGTTAGTAGGGTGGTGAGAGGG - Intergenic
934545348 2:95209808-95209830 TTGTTTGTACAGAACGAAGATGG + Intronic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
935208509 2:100918789-100918811 TTGCTGGTAGGGAGGTAAAATGG + Intronic
935313642 2:101809730-101809752 TTGTTTGTTTGGGAGGAAGATGG + Intronic
936667671 2:114615730-114615752 GTACTTGTAGGGAGGGAAAAGGG + Intronic
938309781 2:130281697-130281719 TTGTTTGTAGGGATGAAGCAGGG - Intergenic
939514029 2:143143907-143143929 GAGTTTGGAGGGTGGGAAGAGGG - Intronic
939796371 2:146649815-146649837 TTGTTTATAGAGAGAGAAAAAGG + Intergenic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
940788960 2:158011661-158011683 TTGTCTGGAGGGAGGGAGGGAGG + Intronic
940811540 2:158248228-158248250 TTGTCTCTGGGGAGGAAAGAAGG + Intronic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941986012 2:171512376-171512398 TACTTTGTAGGGAGGGAGGAGGG - Intergenic
942008062 2:171728798-171728820 TTTGTTGTTGGGAGTGAAGAAGG + Exonic
942337812 2:174909275-174909297 TTGTTTTAAGTGAAGGAAGAAGG - Intronic
943678568 2:190742977-190742999 GTGTTCCTAGGGAAGGAAGAAGG + Intergenic
946943726 2:224797727-224797749 TTCTCAGTAGGGAGGGAAGAAGG - Intronic
947489682 2:230582846-230582868 GTGTTTTTTGGGAGGGAAGGAGG - Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948851672 2:240711349-240711371 TGGTTGGTAGGGAGAGGAGAAGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169992457 20:11518483-11518505 TTGAATGTAGGGTGGGATGATGG + Intergenic
1170121139 20:12913552-12913574 TTGTTTCTTGGGAGGGAGGTGGG - Intergenic
1170816724 20:19720483-19720505 GTGTTTTTAGGGAGGAGAGAAGG + Intronic
1170845623 20:19959564-19959586 TTATTTGGGGGGTGGGAAGATGG - Intronic
1172421770 20:34824889-34824911 TTCTTTGCTGGGAGGGAAGGAGG - Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172599505 20:36174031-36174053 TTTTCTGGAGGGAGGAAAGAAGG + Intronic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1173291966 20:41723184-41723206 TTGTAAGTAGCTAGGGAAGAGGG - Intergenic
1174299021 20:49568515-49568537 TTATATGCGGGGAGGGAAGAGGG + Intergenic
1174570436 20:51497526-51497548 TTGTTTGCAGGGATTGAACAAGG - Intronic
1176319512 21:5296562-5296584 TGGGTTGTGGGGAGGCAAGAGGG + Intergenic
1176669202 21:9716609-9716631 TTGCTTGTAGGAATGCAAGATGG - Intergenic
1176736562 21:10553572-10553594 TTGTTTGGAGTGGGGAAAGAAGG - Intronic
1176845641 21:13874494-13874516 TTGTTAGTAGGGTGGTGAGAGGG - Intergenic
1176848373 21:13894048-13894070 TTGTTAGTAGGGTGGTGAGAGGG - Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1178524998 21:33320247-33320269 TTTTTGGTGGGGAGGGGAGAGGG - Intergenic
1178811956 21:35892538-35892560 TTCTTTGTAGTGGGGGAAAATGG - Intronic
1179364484 21:40744106-40744128 TGGTTTCTAAGGTGGGAAGATGG + Intronic
1181855950 22:25781715-25781737 TTGTCTGCAGGGAGAGAAGAGGG - Exonic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182819562 22:33203578-33203600 TTGTTTATAGTGAGGGGAGAGGG + Intronic
1183240237 22:36652413-36652435 ATGTTTGCAGGGTGAGAAGAAGG - Intronic
1183374835 22:37457170-37457192 TTCTTTGTAGGGAGAGGAGTGGG - Intergenic
1183532573 22:38369104-38369126 TTGTTTGGAGTCAGGAAAGAAGG + Intronic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1183913570 22:41098140-41098162 TTTTTAGCAGGGAGGGGAGAGGG - Intronic
1184048911 22:41989899-41989921 AGGTTTGGAGGGTGGGAAGAAGG - Intronic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1184165396 22:42724303-42724325 GTGCTAGGAGGGAGGGAAGAGGG - Intergenic
1184476441 22:44724613-44724635 AGGTATGTAGGGAGGGAAGGAGG + Intronic
949397075 3:3626101-3626123 TTGATTGTAGGGTGGGAGGTGGG - Intergenic
949408420 3:3738860-3738882 ATGTCTGTAGGCAGGAAAGATGG - Intronic
949847283 3:8384662-8384684 TTGTTTCTAAGGAAAGAAGAAGG + Intergenic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
951896986 3:27618906-27618928 AGGTTGGTAGGGAGGGAAGGTGG - Intergenic
952404762 3:32995662-32995684 TTGTTTTTAAGGAGGGAGAAAGG - Intergenic
952995755 3:38880605-38880627 CTGTTTGTAGGGATAGATGAGGG - Intronic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
955190419 3:56756481-56756503 TTGTTTGAAGGGAGTACAGAGGG - Intronic
955232364 3:57110386-57110408 TGGTGTGTAGGTAGAGAAGATGG - Intronic
955342478 3:58135814-58135836 TTTTTGGTAGGGAGAGTAGAGGG - Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
958795547 3:98703050-98703072 GTGGTTGTAGTGAGGCAAGATGG - Intergenic
958851789 3:99335898-99335920 TTGCTTATAGGGAGAGCAGAGGG + Intergenic
959116134 3:102180840-102180862 TTGTTTGTGGAGTGGGTAGAGGG - Intronic
960140015 3:114142605-114142627 TTGTTTCTAGGGAGGGAGATGGG + Intronic
961229527 3:125291097-125291119 TTGTTTGGAAGGTGGGGAGAGGG - Intronic
961890663 3:130127868-130127890 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
961941326 3:130640041-130640063 TTGTTGCTAGGGTGGGAAAAGGG + Intronic
962132788 3:132699772-132699794 TTATTTCTAGGGAGGTAACATGG - Intronic
962458977 3:135591495-135591517 TTGATTGGAGGGTGGGTAGAGGG - Intergenic
962735907 3:138325088-138325110 TTTTTTCTGGGTAGGGAAGAAGG - Intronic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963781836 3:149494212-149494234 GAGTTTGAAGGGAGAGAAGAAGG + Intronic
965562620 3:170076111-170076133 TTGTATCTAGGGAGGGAAACTGG + Intronic
965573331 3:170192906-170192928 TTTTTTGCAGGGAGGGGACAGGG + Intergenic
965958422 3:174399543-174399565 TTCTTCGTAGTGAGGGAAAATGG + Intergenic
967648333 3:191953906-191953928 ATATTTATAGGGAGTGAAGATGG - Intergenic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
967948970 3:194825591-194825613 TGGCTTGTTGGGAGGGAACAAGG + Intergenic
969002046 4:3990285-3990307 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
969751957 4:9118224-9118246 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
969811869 4:9654524-9654546 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
970138246 4:12950306-12950328 TTGTTTTATGGGAGGGAGGAGGG + Intergenic
970289013 4:14551513-14551535 TTGTTTGTAGCAAGGGAAGAAGG - Intergenic
971843328 4:31884127-31884149 TTATTTGTAAGAAGGTAAGAAGG + Intergenic
972357797 4:38297318-38297340 TGATTTTCAGGGAGGGAAGAAGG - Intergenic
973293659 4:48492227-48492249 TTGCTTACTGGGAGGGAAGAAGG + Intronic
973322721 4:48826294-48826316 TGGGTTGTGGGGAGGGAGGAGGG - Intronic
975229391 4:71913647-71913669 TTGTGTGTAGTGAGTGAGGAGGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977064679 4:92299789-92299811 ATTTTAGAAGGGAGGGAAGAGGG + Intronic
977177964 4:93838780-93838802 TTGTTTGTGGGGTGGGGAGGGGG + Intergenic
977544848 4:98365442-98365464 TTTTTTGTAGAGAGGGGATAGGG - Intronic
977687181 4:99860270-99860292 TTGTTTGGGTGGAGGTAAGATGG + Intronic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978490240 4:109303724-109303746 TTTTTTATAGGGAGATAAGAAGG - Intergenic
978779817 4:112539677-112539699 TTTTTTTAAGGAAGGGAAGATGG - Exonic
979034511 4:115697574-115697596 TTGTTATTAGGAAAGGAAGAGGG + Intergenic
979621554 4:122804181-122804203 TTGATTGTAGGGATGGGAAAAGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
981060895 4:140424642-140424664 TAATTTATAAGGAGGGAAGAGGG - Intronic
982413479 4:155105639-155105661 TAGCTTGTATGGAGGGTAGATGG + Intergenic
982951497 4:161702811-161702833 TTGTTTTTTGAGTGGGAAGAGGG - Intronic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
983557348 4:169070270-169070292 TTCCTTGTAGAGAGGGGAGAGGG - Intergenic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984210347 4:176839809-176839831 TGACTTTTAGGGAGGGAAGAAGG - Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985405575 4:189634907-189634929 TTGCTTGTAGGAATGCAAGATGG + Intergenic
985909133 5:2865244-2865266 TTGTTTGTAGAGAGAAAACAGGG - Intergenic
985932132 5:3067027-3067049 TGGTTTGTTAGGAGGGAAGATGG + Intergenic
985956708 5:3271114-3271136 GTGCTTGAAGGGAGGGAAGGGGG - Intergenic
987124709 5:14801282-14801304 TTGTTTTTAGGGAGGTCATAGGG - Intronic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
988809796 5:34773228-34773250 TTGTATATAGGGAGAGAGGAGGG - Intronic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991448621 5:66727683-66727705 TTTTTTGGAGGGAGGGGAGAGGG + Intronic
991551636 5:67843280-67843302 TTCTTTGGTGGCAGGGAAGATGG + Intergenic
991951271 5:71948697-71948719 GTTTTTTTTGGGAGGGAAGAGGG + Intergenic
992034522 5:72759444-72759466 TTGTTTCTTGGGAGCAAAGAGGG - Intergenic
992215411 5:74520170-74520192 TTGCTTAGAGGTAGGGAAGATGG + Intergenic
993338877 5:86696942-86696964 TTGTTTGAAGGGAGTAAGGAGGG + Intergenic
993621768 5:90177097-90177119 TTTTTGGTGGGGAGGGGAGATGG - Intergenic
993956828 5:94244337-94244359 TTTTTTGTGGGGAGGGAACAGGG + Intronic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996564155 5:124862445-124862467 TGGGTTGTAGGGAGGAAAGAAGG + Intergenic
997411676 5:133695766-133695788 TGGTTTGCAGGGAGGGGAGGGGG - Intergenic
997430197 5:133832625-133832647 ATGTATGTAGGGAGGAAAGCTGG - Intergenic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
998586885 5:143436629-143436651 TTTTTTTTAGGGTGGGAATAGGG + Intergenic
999730647 5:154474614-154474636 GTGTTTATTGGGAGGGAAGGGGG - Intergenic
1000252198 5:159506346-159506368 TTTTGTGGAGGGAGGGAAGGGGG + Intergenic
1000281160 5:159783490-159783512 TAGTTTTTAGGAAGGTAAGATGG - Intergenic
1000580221 5:163027036-163027058 TTGTTTGTTTGGAGGGCTGAAGG + Intergenic
1000938481 5:167331584-167331606 TTCTTTGTTGGGCGCGAAGAAGG + Intronic
1001742104 5:174061924-174061946 TTTTTTTTAGGCAGGGAAGTTGG + Intronic
1001894244 5:175364743-175364765 TGGTTGCCAGGGAGGGAAGAGGG - Intergenic
1002809847 6:616916-616938 TTTTTAGTAGAGAGGGAGGAGGG + Intronic
1003911919 6:10750863-10750885 TTCTGTCTAAGGAGGGAAGATGG + Intronic
1004015151 6:11725574-11725596 TTGTTGGTAGGAATGGAAGATGG + Intronic
1004141968 6:13026546-13026568 TGGCTTGTAGAGAGGGAGGAAGG + Intronic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1007762208 6:44139689-44139711 TTCTCTGTGGGGTGGGAAGAGGG - Exonic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008457743 6:51730925-51730947 GAGGTTGAAGGGAGGGAAGAGGG + Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009796766 6:68479432-68479454 TTTTTGGTAGAGAGGGCAGATGG - Intergenic
1009816246 6:68739441-68739463 TTGTCTTTAGGTAGGTAAGAGGG + Intronic
1010089627 6:71965300-71965322 TTTTTGGGAGGGAGGGTAGAAGG + Intronic
1010473061 6:76252547-76252569 TGGTTTGTAGGGAGGAGTGATGG - Intergenic
1011211929 6:84964718-84964740 TTGTTGTTAGGTAGGGTAGAAGG + Intergenic
1012150533 6:95745102-95745124 ATGATTTTAGGGAGAGAAGAAGG - Intergenic
1012939266 6:105400434-105400456 TTGTTTGTAGGGTGGCAAGAAGG - Intronic
1013165933 6:107592009-107592031 TTGTTTCTAGCCAGAGAAGAAGG - Intronic
1013386500 6:109637001-109637023 TTGTTTGTGGGGATGTAAAATGG - Intronic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1013806479 6:114001605-114001627 TTATTTTATGGGAGGGAAGATGG + Intronic
1014808608 6:125859962-125859984 TTGTTTTTTGAGAGGGAAGTAGG + Intronic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1016751732 6:147637489-147637511 TTATTTGATGGGAGGGATGAAGG + Intronic
1017195118 6:151692231-151692253 GTGTTTGAAGGGAAGGTAGATGG - Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018123562 6:160660219-160660241 ATGCTGATAGGGAGGGAAGAGGG - Intronic
1018136353 6:160781640-160781662 ATGCTGATAGGGAGGGAAGAGGG + Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1019012558 6:168853576-168853598 TTGTATGTTGGGAGGGCACAGGG + Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1021159501 7:17254563-17254585 TGGTTTTCAGGGAAGGAAGAAGG + Intergenic
1023082014 7:36534551-36534573 TGGTTTCGAGGAAGGGAAGAGGG + Intronic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1024483954 7:49894937-49894959 TTTTTTTAAGGGATGGAAGATGG + Intronic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1027185487 7:75968430-75968452 TTATTTATAGGCAGAGAAGAGGG - Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028668799 7:93377143-93377165 TTGTTTGGAGTGAAGGGAGAAGG + Intergenic
1028725909 7:94087790-94087812 TTGTTTGTTTGGAGTGAAGGAGG + Intergenic
1029162111 7:98559926-98559948 TTGTATCTTGGGAGGTAAGAGGG + Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029816087 7:103096572-103096594 TTTTTTGTCGGGGGTGAAGATGG + Intronic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031672735 7:124569796-124569818 TGTGTTGAAGGGAGGGAAGAAGG - Intergenic
1032412820 7:131711312-131711334 TTGATTGTAGGGTGGGAGGTGGG + Intergenic
1033201159 7:139371526-139371548 TTGTTTGTATGGGAGGGAGAGGG + Intronic
1035287941 7:157818287-157818309 TTGGTCATAGGGAGGGAAGGTGG + Intronic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1036375171 8:8193656-8193678 TTGTTTGCAGTGGGGCAAGAAGG + Intergenic
1036854368 8:12229492-12229514 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1036875728 8:12471992-12472014 TTGTTTGCAGTGGGGCAAGAAGG - Intergenic
1037012317 8:13858968-13858990 TTGTTTGGAGAGAGGAAAGGAGG - Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037607371 8:20449078-20449100 GCTTTTGAAGGGAGGGAAGAAGG - Intergenic
1037835458 8:22212591-22212613 TGTTTGGTGGGGAGGGAAGAAGG + Intergenic
1037870096 8:22486216-22486238 TTGTTTGTAAGGAAGACAGAGGG - Intronic
1037874367 8:22533158-22533180 TTTTCTGTATGGAGGGAAGTAGG - Intronic
1038197264 8:25379814-25379836 TTGTTTGTGGAGATGGAAAAAGG - Intronic
1038440812 8:27569760-27569782 TTGGTTGAAGGGATGGATGAAGG + Intergenic
1038440837 8:27569860-27569882 TTGGTTGGAGGGATGGATGAAGG + Intergenic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1039954671 8:42197738-42197760 TGGTTTTTATGGAGGGAAGATGG - Intronic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1041008496 8:53518728-53518750 TTATTTTCAGGGAGGGGAGAAGG + Intergenic
1041039569 8:53833760-53833782 TGATTGGGAGGGAGGGAAGATGG - Intronic
1042190839 8:66185595-66185617 GTCTTTGTAGGCAGAGAAGATGG - Intergenic
1042455227 8:68994010-68994032 TTGTTTGTAGGGATGCAGAAGGG - Intergenic
1042716702 8:71780969-71780991 TTTTTTTTAGGGAAGGAAGAAGG + Intergenic
1044757805 8:95483914-95483936 TGGTTTCTAGGGAAGGGAGATGG - Intergenic
1044948297 8:97411983-97412005 TTATTTGAAGGGAGAGAAAATGG - Intergenic
1045179808 8:99768254-99768276 TTGTTTCCAGGGAAAGAAGAAGG - Intronic
1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG + Intergenic
1046719167 8:117599551-117599573 TTTTTGTGAGGGAGGGAAGAAGG - Intergenic
1046795310 8:118365154-118365176 TGGTCAGAAGGGAGGGAAGATGG - Intronic
1048033454 8:130654431-130654453 CTGTTTGTAGTGAGGGATGCTGG + Intergenic
1048161084 8:132022718-132022740 TTGATTAAAGGGAGGGAAGAAGG + Intergenic
1048376280 8:133825398-133825420 TTGGTTGGATGGTGGGAAGAAGG - Intergenic
1048505429 8:135016452-135016474 ATGTTTGTAGTGAGGGTATATGG - Intergenic
1048596106 8:135868099-135868121 TTGTTTGAAGGATGGGAAGTTGG - Intergenic
1048849929 8:138635155-138635177 TTGTTAGTAGGGTTGGAAGGTGG - Intronic
1049659154 8:143811950-143811972 TTGTCTGTAGGGAAGACAGATGG - Intronic
1050218017 9:3350458-3350480 TTGTTGGGAGGGATGGAAAATGG + Intronic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1050871283 9:10573478-10573500 TTGTATGGAGGAAGGCAAGATGG + Intronic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1052384501 9:27807761-27807783 TTGTTTGACTGGATGGAAGAGGG + Intergenic
1052808386 9:33034206-33034228 TTGTTTTTAGGCATGAAAGATGG + Exonic
1053518731 9:38754831-38754853 TTGTTTGAATGGAGGGAGGGAGG - Intergenic
1056101278 9:83302606-83302628 TTGATATTAGGGAGGGAGGAAGG - Intronic
1056278609 9:85017917-85017939 TTCTTTATAGGGTAGGAAGAAGG + Intronic
1057070328 9:92092727-92092749 TTTTTTGGGGGGAGGGAGGATGG - Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059291597 9:113230055-113230077 ATTTATGTAGGGAGTGAAGATGG + Intronic
1059326657 9:113507797-113507819 TTCTTGGTAGGGAGGACAGATGG + Intronic
1059627596 9:116084045-116084067 TTGTTTCTAGGGGAGGAAAATGG + Intergenic
1059851728 9:118348893-118348915 TTGTTTGTGGGGTAAGAAGACGG + Intergenic
1060044762 9:120331151-120331173 TGTTGTGTTGGGAGGGAAGATGG - Intergenic
1060336719 9:122730639-122730661 ATGGTTGTTTGGAGGGAAGAAGG - Intergenic
1060371114 9:123072547-123072569 TTGTTTAGAGTGAGGGGAGATGG + Intronic
1060647024 9:125289597-125289619 CTTTTTGTGGGGAGGGAAGCAGG + Intronic
1061623513 9:131826722-131826744 TTGTGTGTAGGGAGGGATGGGGG - Intergenic
1061642839 9:131973205-131973227 TTGTTCATAAGGAGGAAAGAGGG - Intronic
1203656664 Un_KI270753v1:4327-4349 TTGCTTGTAGGAATGCAAGATGG + Intergenic
1185529736 X:807853-807875 TTATTTGTAAGAAAGGAAGAAGG - Intergenic
1187277184 X:17826499-17826521 TTATTTGGAGGGAGGAAGGAAGG + Intronic
1187415871 X:19092880-19092902 TTCTTTGCAGGGAGTGAGGAGGG - Intronic
1187662768 X:21568600-21568622 TTTTTTTGATGGAGGGAAGAGGG + Intronic
1187679606 X:21753750-21753772 TTGTTTGCTGGGAGGGCACATGG + Intronic
1187766152 X:22644551-22644573 TTTTCTGTAGGGAGTGTAGATGG + Intergenic
1188598234 X:31927564-31927586 TTTTATGTATGGAGGGAAGGTGG - Intronic
1189602130 X:42638339-42638361 TTGTTTTTGAGGAGAGAAGAGGG + Intergenic
1189711702 X:43819498-43819520 TTGATTGTTGGAAGGCAAGAAGG - Intronic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1190032096 X:46983642-46983664 ATCTTTGCTGGGAGGGAAGATGG + Intronic
1190133472 X:47772549-47772571 GTGTTTGTGGGCAGGGAACATGG + Intergenic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1192577093 X:72251683-72251705 TTTTTTCGAGGTAGGGAAGAAGG + Intronic
1192801535 X:74469425-74469447 TTGTTTGTAGGAATGTAAAATGG - Intronic
1193074898 X:77345403-77345425 TTATTTGTAGGGAGGAGAAAAGG - Intergenic
1193496681 X:82220831-82220853 TAGATTCAAGGGAGGGAAGATGG - Intergenic
1193609333 X:83610138-83610160 TTGTGTGTAAGGAGTAAAGAAGG + Intergenic
1195637934 X:107139178-107139200 TTGGTAGAAGGGAGGGAAGGTGG + Intronic
1195938380 X:110146366-110146388 TCTTTTGGAGGGAGGAAAGATGG - Intronic
1197265961 X:124371779-124371801 TTGATTGTATGGTGGGAAGTTGG + Exonic
1197404118 X:126029103-126029125 GTGGTTGTATGGAGGAAAGAAGG + Intergenic
1197681115 X:129386463-129386485 ATGTCTTTAGGCAGGGAAGAGGG - Intergenic
1198237826 X:134752250-134752272 TTTTTTTTAGAGAGGGAAGTGGG + Intronic
1198643946 X:138786301-138786323 TTTTTTCTGGGGAGTGAAGATGG - Intronic
1198762280 X:140044917-140044939 TAGTTTGTAGCGGGGGAACAGGG + Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1200354873 X:155538119-155538141 GTGATTGAGGGGAGGGAAGATGG - Intronic
1201438458 Y:13985038-13985060 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438492 Y:13985154-13985176 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438611 Y:13985524-13985546 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201445962 Y:14057184-14057206 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446081 Y:14057554-14057576 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446115 Y:14057670-14057692 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic