ID: 915269646

View in Genome Browser
Species Human (GRCh38)
Location 1:154744647-154744669
Sequence ACCTGGACAAAGGCAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 475}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915269646_915269654 26 Left 915269646 1:154744647-154744669 CCCAGCTCTGCCTTTGTCCAGGT 0: 1
1: 0
2: 3
3: 48
4: 475
Right 915269654 1:154744696-154744718 CAAGTACCTTCAGCATGCTAGGG 0: 1
1: 0
2: 0
3: 11
4: 91
915269646_915269653 25 Left 915269646 1:154744647-154744669 CCCAGCTCTGCCTTTGTCCAGGT 0: 1
1: 0
2: 3
3: 48
4: 475
Right 915269653 1:154744695-154744717 TCAAGTACCTTCAGCATGCTAGG 0: 1
1: 0
2: 2
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915269646 Original CRISPR ACCTGGACAAAGGCAGAGCT GGG (reversed) Intronic
900658118 1:3770223-3770245 AGCTGGACAAAGCCGGGGCTGGG - Intronic
900930858 1:5736471-5736493 AGATAGACAAAGGCATAGCTAGG + Intergenic
900965683 1:5956630-5956652 GCCTGGACAAAAACACAGCTGGG + Intronic
901514548 1:9736240-9736262 GCCTGGAGAAAGGGAGAGTTGGG + Intronic
901759597 1:11462092-11462114 TCCTCGACAAAGGCCCAGCTTGG - Intergenic
901797781 1:11690841-11690863 ACCCGGACAAAGCCAGCGCTGGG - Intronic
902248839 1:15140153-15140175 ACCTGGACAAAGCCATTTCTCGG - Intergenic
902329259 1:15723066-15723088 ACCTGGAGGAAGGCAGGACTTGG + Intronic
902619668 1:17643606-17643628 AGCTGGTCAGTGGCAGAGCTGGG - Intronic
902634280 1:17725025-17725047 ACCTGGAAACGGGTAGAGCTGGG - Intergenic
903024004 1:20413965-20413987 AGCTGGCCAGTGGCAGAGCTGGG - Intergenic
903223786 1:21883777-21883799 ACGTGGAAAACGACAGAGCTGGG + Intronic
903370614 1:22832847-22832869 ACCTGTACAAAGGGACAGATAGG + Intronic
903418322 1:23200128-23200150 AGCTGGTCAGTGGCAGAGCTGGG - Intergenic
903588739 1:24438273-24438295 ACCTGGAAAAGGTCAGAGCTGGG - Intronic
903705273 1:25280943-25280965 GCCTGGATAAGGGCAGAGTTGGG - Intronic
903721953 1:25412387-25412409 GCCTGGATAAGGGCAGAGTTGGG + Intronic
904036239 1:27560525-27560547 ACCCAGAGAAAGGCAGAGGTGGG - Intronic
904252079 1:29232161-29232183 GGCTGGAAAATGGCAGAGCTAGG - Intergenic
904911892 1:33940610-33940632 AACTAGAAAATGGCAGAGCTAGG + Intronic
905453135 1:38069923-38069945 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
906689647 1:47784178-47784200 ACCTGGTAAAAGGCAAAGCTTGG + Intronic
907406841 1:54258939-54258961 AACTGGTCAGTGGCAGAGCTGGG + Intronic
907753232 1:57283820-57283842 CCCTGGGCAATGGCAGAGCCAGG - Intronic
907766541 1:57417955-57417977 ACCTGGAGAAAGGAAAGGCTGGG - Intronic
907814054 1:57900765-57900787 AGCAGGAAACAGGCAGAGCTGGG - Intronic
910240611 1:85081929-85081951 AACTGGGCAAAGGCGGAGCACGG - Intronic
911168464 1:94745845-94745867 AGCTGGTCCATGGCAGAGCTGGG + Intergenic
912673057 1:111649276-111649298 ACCTGGACAGAGTGAGAGCCTGG - Intronic
912679935 1:111722583-111722605 AGGTGGAGAAAGGCTGAGCTTGG - Exonic
914085308 1:144448856-144448878 ACCTGGAGAAACTCAGATCTTGG - Exonic
914191197 1:145412830-145412852 ACCTGGAGAAACTCAGATCTTGG - Intergenic
914417613 1:147498397-147498419 ACCTAGACAGTGACAGAGCTAGG + Intergenic
915130717 1:153693676-153693698 ACCTGGACTCAGGCCGGGCTGGG + Exonic
915269646 1:154744647-154744669 ACCTGGACAAAGGCAGAGCTGGG - Intronic
915594422 1:156888082-156888104 GGCAGGCCAAAGGCAGAGCTGGG + Intergenic
915637267 1:157195595-157195617 ACCTGGCCAAAGGCGCAGCCGGG + Intergenic
915677789 1:157547749-157547771 ACCAGGACAAAGTTACAGCTGGG + Intronic
915733627 1:158071045-158071067 ACCAGGAGAAAGACAGAGGTGGG - Intronic
917245543 1:172996852-172996874 AAATGGACAAAGGTACAGCTTGG + Intergenic
917442131 1:175077569-175077591 ACCTGAACCAAGGCAGACTTGGG - Exonic
917444418 1:175095026-175095048 AGCTAGTCAATGGCAGAGCTGGG - Intronic
918103486 1:181396992-181397014 ACCTGGCCAATGGAACAGCTGGG + Intergenic
920666083 1:207963809-207963831 ACCTGGAAAAACACAGCGCTTGG - Intergenic
921911082 1:220549772-220549794 ACCTTGTAAAAGGCTGAGCTCGG - Intronic
922361766 1:224829150-224829172 ACCTGAACAAAGGCGAAGATGGG + Intergenic
922603640 1:226875175-226875197 CCCTGGCCTAAGCCAGAGCTGGG - Intronic
922726831 1:227926650-227926672 ACCTGGACAGGGCCAGGGCTTGG + Intronic
922901533 1:229140812-229140834 AGCTGCTCAATGGCAGAGCTGGG - Intergenic
922990795 1:229909469-229909491 AACTGGACAATGGCAGTGCTTGG + Intergenic
923779895 1:237012844-237012866 TCCGGGACAAAGTCTGAGCTAGG - Intergenic
1062834240 10:625476-625498 GCCTGCAGAAAGGCAGAGCCCGG - Intronic
1063127567 10:3149137-3149159 ACCTCGGCCACGGCAGAGCTGGG + Intronic
1065562801 10:26980524-26980546 ACCTGGTCAAAGGCTGAGCTAGG - Intergenic
1065703261 10:28445833-28445855 ACAGGAACAAAGGCAGAGGTGGG - Intergenic
1066495473 10:35937900-35937922 ACATGGAGAAAGGCAGAGGGAGG - Intergenic
1066756859 10:38720433-38720455 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
1067222322 10:44353078-44353100 ACGGGGACAGAGGCAGGGCTGGG + Intergenic
1067525595 10:47036500-47036522 AGATGGGAAAAGGCAGAGCTGGG - Intergenic
1067741532 10:48899186-48899208 CCCAGGAGAAAGGCAGAGCTTGG + Intronic
1067831859 10:49615099-49615121 AGCTTGAAGAAGGCAGAGCTGGG - Intronic
1068682352 10:59833902-59833924 AGCTGGAAAGTGGCAGAGCTTGG + Intronic
1069789191 10:71008801-71008823 AAGTGGCCAGAGGCAGAGCTAGG + Intergenic
1069926120 10:71851807-71851829 ACCTGGTCAAAGGCAAGTCTGGG + Intergenic
1070405298 10:76089236-76089258 AGCTGGTAAATGGCAGAGCTGGG + Intronic
1070652569 10:78248422-78248444 ACTTGGACTCAGGCAGACCTCGG - Intergenic
1070679536 10:78438910-78438932 ACCTGGAAAGGGACAGAGCTGGG - Intergenic
1070695507 10:78560425-78560447 AGCTGGGAAATGGCAGAGCTAGG - Intergenic
1071291293 10:84191059-84191081 TCCTGGCCCAAGGCAGAGTTTGG - Intergenic
1071346965 10:84702163-84702185 CTCCAGACAAAGGCAGAGCTTGG - Intergenic
1071807972 10:89145174-89145196 TGCTGGAAAATGGCAGAGCTAGG - Intergenic
1071991214 10:91102339-91102361 CCCTAGCCAAAGGCAGAGCAAGG + Intergenic
1072439673 10:95442942-95442964 TCCTGGAAAAAGGGAGAGATAGG - Intronic
1072566734 10:96622580-96622602 GCCTTGACAAGGGCAGACCTGGG - Intronic
1073053123 10:100682186-100682208 ACCTGGTTAAGGGCAGAGCTAGG + Intergenic
1073208810 10:101782447-101782469 ACCACCACCAAGGCAGAGCTGGG + Intronic
1074126060 10:110529928-110529950 AGCTGGCAAGAGGCAGAGCTGGG - Intergenic
1075421802 10:122307003-122307025 AACTGGGAAATGGCAGAGCTAGG - Intronic
1076220245 10:128728028-128728050 ACCTGGAAAGAGGCAGGGCAAGG + Intergenic
1078084417 11:8225110-8225132 AGATGGAGAAAGGCAGAGATGGG + Intronic
1078359612 11:10658166-10658188 GCCTGGCCAACTGCAGAGCTGGG + Intronic
1078529803 11:12128443-12128465 AGCTGGTAAATGGCAGAGCTGGG + Intronic
1079566448 11:21888845-21888867 ACATGGACATAGGAAAAGCTGGG + Intergenic
1080355083 11:31434105-31434127 GCCTGTACAAAGGCAGAACAGGG - Intronic
1081583438 11:44367874-44367896 ACCTGGCGAATGGCAGAACTGGG + Intergenic
1081668015 11:44927781-44927803 ATTTGGAGAGAGGCAGAGCTGGG - Intronic
1081932525 11:46881902-46881924 ACCTGGGCAAAGGCAAGGCAAGG + Exonic
1082099274 11:48158512-48158534 ACCTGGTAAGAGGCTGAGCTGGG + Intronic
1082851930 11:57773012-57773034 ACCTGAACAAAGGAGGAGATGGG - Intronic
1083175864 11:60950167-60950189 AGCTAGTGAAAGGCAGAGCTGGG + Intronic
1085133903 11:74067341-74067363 ACCTGGAAAAAGGCTGAACCTGG + Intronic
1086971285 11:93083790-93083812 AGCTAGAAAATGGCAGAGCTGGG + Intergenic
1087079260 11:94153967-94153989 AGCTAGACAGTGGCAGAGCTAGG + Intronic
1087922087 11:103877848-103877870 AGCTGGGAAAAGGCAGAGCTTGG - Intergenic
1088429583 11:109744438-109744460 AACTAGAAAATGGCAGAGCTGGG + Intergenic
1088433873 11:109789160-109789182 ACCTTGACAATGGCACAGCCTGG - Intergenic
1088961455 11:114670024-114670046 AACTGCACAAAGACATAGCTAGG + Intergenic
1089278800 11:117358036-117358058 AACTGGATAAAGCCACAGCTGGG - Intronic
1089849410 11:121483318-121483340 GCCTGGAAAAAGGCAGGACTGGG - Intronic
1090094640 11:123730573-123730595 ACCTGGAGAACTACAGAGCTGGG - Exonic
1090261351 11:125322989-125323011 CACTGGACCAAGGCAGAGCAAGG + Intronic
1090283856 11:125481683-125481705 GCCTGGAGGAAGGAAGAGCTGGG + Intronic
1090696103 11:129243720-129243742 ACATGAACAAAGACAGAGATGGG - Intronic
1091311884 11:134580631-134580653 ACCAGGACAGAGACAGGGCTGGG - Intergenic
1091772150 12:3159244-3159266 AGCTGGTGAGAGGCAGAGCTGGG - Intronic
1091776708 12:3189421-3189443 TACTGGCCCAAGGCAGAGCTTGG - Intronic
1091777938 12:3196905-3196927 GCCTGGACAAAGTGTGAGCTGGG + Intronic
1091829579 12:3540182-3540204 AGCTGGGAAATGGCAGAGCTGGG + Intronic
1092725740 12:11483959-11483981 AGCCGGACAGAAGCAGAGCTGGG + Intronic
1093934004 12:24982068-24982090 ACTTGGCCAAAGGCAAAGTTTGG + Intergenic
1095832552 12:46603470-46603492 AGCTGATCAAAGGCTGAGCTGGG - Intergenic
1096080443 12:48829038-48829060 AAGGGGACAAAGGCAGAGCTGGG + Intergenic
1096416588 12:51419704-51419726 ATTTGGACAGAGGCAGAGGTAGG - Intronic
1097168782 12:57100394-57100416 AGCTGGTAAGAGGCAGAGCTAGG + Intronic
1097990971 12:65833574-65833596 ACATGGACAAGAGCAGAGGTTGG - Intronic
1098040194 12:66346266-66346288 ACCAGGCCAAAGGAAGAGCTAGG - Exonic
1098504771 12:71236896-71236918 AGCTGGTAAGAGGCAGAGCTGGG + Intronic
1099248457 12:80222097-80222119 ACATGGGCAACGGCAGAGATGGG + Exonic
1099610799 12:84866623-84866645 ACCTGGACAGCAGCAGACCTGGG - Intronic
1100349669 12:93767645-93767667 ACCTAGTAAATGGCAGAGCTGGG + Intronic
1101065287 12:101014532-101014554 ACATGCACACAGGCAGACCTGGG + Intronic
1101223909 12:102668431-102668453 ATCTGAAAAAAGGCAGAGCCAGG + Intergenic
1101608849 12:106271801-106271823 AGCTTGACAAAGGCAAAACTTGG - Intronic
1102202410 12:111066787-111066809 AGCTTGTAAAAGGCAGAGCTGGG - Intronic
1102399124 12:112613400-112613422 AGCTGGTCAGAGGCAGAGCCAGG - Intronic
1102717332 12:114985798-114985820 ACATGGTCGATGGCAGAGCTGGG + Intergenic
1102731010 12:115109739-115109761 AGCTGGGAAGAGGCAGAGCTGGG + Intergenic
1102950144 12:117025941-117025963 ACAGGGACAGAGGCAGTGCTGGG - Intronic
1103174024 12:118846052-118846074 AGCTGGCAAGAGGCAGAGCTAGG + Intergenic
1103336105 12:120190945-120190967 AGCTAGTAAAAGGCAGAGCTGGG - Intronic
1103920038 12:124394608-124394630 ACAAAGACAAAGGCAGAGCCTGG + Intronic
1105404216 13:20119998-20120020 AGCTAGTAAAAGGCAGAGCTGGG - Intergenic
1106449388 13:29866156-29866178 ACGTGGACAATGACAGTGCTGGG - Intergenic
1108343279 13:49518700-49518722 AGCTGGTCAGTGGCAGAGCTGGG + Intronic
1108642530 13:52395951-52395973 GGCTGGATACAGGCAGAGCTGGG + Intronic
1111201664 13:84945775-84945797 AGCTGGACAGAGGCAGAGCTGGG + Intergenic
1112882259 13:104122554-104122576 AACTGGGTAAAGGCAGGGCTTGG + Intergenic
1113472498 13:110556942-110556964 AACTGGGCAATGGCAGATCTGGG + Intronic
1113766525 13:112884349-112884371 ATCTCCACACAGGCAGAGCTGGG - Exonic
1115337698 14:32258356-32258378 AGCTGGAAAATGGCAGAACTGGG + Intergenic
1115755548 14:36523826-36523848 AGCTGGAAAAAGGCAAAGCCAGG - Intergenic
1115811471 14:37113415-37113437 AACTGGACAAATACAGACCTTGG + Intronic
1115981438 14:39056191-39056213 CCCTGAACAAAGACAGGGCTTGG - Intronic
1116478961 14:45374485-45374507 AAGTGTACAGAGGCAGAGCTGGG - Intergenic
1116884786 14:50209207-50209229 AGCTTGACAAATGCAGATCTTGG + Intronic
1118272543 14:64356947-64356969 AGCTGGCAAATGGCAGAGCTAGG + Intergenic
1118697405 14:68398171-68398193 ACCTGGTCAGAGGGAGAGCTGGG - Intronic
1119086808 14:71746660-71746682 AGCTGGTGAATGGCAGAGCTGGG + Intergenic
1119892874 14:78196179-78196201 ACATGGACAAAGGCAGTACTCGG - Intergenic
1121276350 14:92670658-92670680 AGCTGGTCAATAGCAGAGCTGGG - Intronic
1121604665 14:95231689-95231711 AGCTGAAGAGAGGCAGAGCTGGG + Intronic
1121615430 14:95310791-95310813 TCGTGGACAAAGGCACAGCAAGG + Intronic
1121698356 14:95931521-95931543 AGCTGGTGAATGGCAGAGCTGGG + Intergenic
1122154136 14:99740251-99740273 AGCTGGTCAATGGCAGAGCAGGG + Intronic
1122190392 14:100037980-100038002 ACCTAGACAGGGTCAGAGCTTGG + Intronic
1122250872 14:100438870-100438892 AGCTGGTAAGAGGCAGAGCTGGG + Intronic
1122842132 14:104471139-104471161 TGCTGAACAAAGGCTGAGCTTGG - Intergenic
1123441136 15:20292695-20292717 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
1123497953 15:20849240-20849262 CCCTGAACAAAGACAGGGCTTGG - Intronic
1123555184 15:21422867-21422889 CCCTGAACAAAGACAGGGCTTGG - Intronic
1123591429 15:21860199-21860221 CCCTGAACAAAGACAGGGCTTGG - Intergenic
1124600266 15:31128003-31128025 AGCTGGTCCAAGGCAGAGCCAGG + Intronic
1125315685 15:38428826-38428848 ACATGGATTAAAGCAGAGCTGGG - Intergenic
1128341724 15:66826932-66826954 ACCTGACCAAAGGCCCAGCTGGG - Intergenic
1128911779 15:71522162-71522184 ACCTGGAAAATGGCAAAGCCTGG + Intronic
1129041030 15:72686331-72686353 TCCTGGAGAGAGGCGGAGCTGGG + Intronic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1130014572 15:80176607-80176629 ACCTGGCTAATGGCAGGGCTGGG + Intronic
1130542895 15:84834815-84834837 ACATGCACAAATGCACAGCTGGG + Intronic
1130610758 15:85358901-85358923 ACCTGGAAAAAGGCCGAGCGTGG + Intergenic
1130617636 15:85427288-85427310 ACCTGGACAAATTAAGAGCAAGG - Intronic
1131642537 15:94307815-94307837 ACCAGGACAAAGTCAGAGACTGG - Intronic
1131698265 15:94903783-94903805 AGCTGGATAGTGGCAGAGCTGGG - Intergenic
1131712674 15:95073174-95073196 ATCTGCAGAAAGGCTGAGCTCGG - Intergenic
1202963530 15_KI270727v1_random:150077-150099 CCCTGAACAAAGACAGGGCTTGG - Intergenic
1132666826 16:1084812-1084834 ACTGGGACAAAGGCAGATCCTGG - Intergenic
1134465327 16:14471122-14471144 ACTTTGACAAAAGCACAGCTGGG - Intronic
1134604171 16:15556996-15557018 ACCACGACAAAGGCAGAGGTAGG - Intronic
1136725720 16:32355697-32355719 AGCTGGTAAATGGCAGAGCTGGG - Intergenic
1136773255 16:32858750-32858772 GCCAGGACAAAGGCAGAGGAGGG - Intergenic
1136776380 16:32874001-32874023 AGCTGGCCCAGGGCAGAGCTAGG + Intergenic
1136844053 16:33561748-33561770 AGCTGGTAAATGGCAGAGCTGGG - Intergenic
1136894235 16:33987511-33987533 AGCTGGCCCAGGGCAGAGCTAGG - Intergenic
1136897360 16:34002769-34002791 GCCAGGACAAAGGCAGAGGAGGG + Intergenic
1138500677 16:57441663-57441685 ACATGGATAAAGTGAGAGCTGGG + Intronic
1140036006 16:71371790-71371812 ACCTGGTCAGAGGCAGAACTGGG - Intronic
1140408911 16:74729719-74729741 AGCTGGTCAAAGGCACAGCCAGG - Intronic
1140464941 16:75173937-75173959 ACCAGGAGGAAGGCAGAGCGTGG + Intergenic
1140473960 16:75229388-75229410 ACCAGGACCGACGCAGAGCTGGG + Exonic
1140871499 16:79110797-79110819 AGCTGATAAAAGGCAGAGCTGGG - Intronic
1140959534 16:79898850-79898872 AGCCGGTAAAAGGCAGAGCTAGG - Intergenic
1141426361 16:83947049-83947071 TCATGGTCAATGGCAGAGCTGGG - Intronic
1141817918 16:86425476-86425498 ACATGGACAAAGCCAGAGGCAGG + Intergenic
1142177621 16:88652204-88652226 AACTGGGCATAGCCAGAGCTGGG + Exonic
1203000710 16_KI270728v1_random:162057-162079 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
1203075677 16_KI270728v1_random:1120860-1120882 GCCAGGACAAAGGCAGAGGAGGG - Intergenic
1203078795 16_KI270728v1_random:1136110-1136132 AGCTGGCCCAGGGCAGAGCTAGG + Intergenic
1203132313 16_KI270728v1_random:1698462-1698484 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
1203154218 16_KI270728v1_random:1862047-1862069 AGCTGGTAAATGGCAGAGCTGGG - Intergenic
1142489236 17:267130-267152 ATCTGGACAAAGGGAGAGGATGG - Intronic
1142831474 17:2552354-2552376 ACCTTGAGAAGGGCAGGGCTCGG + Intergenic
1143762969 17:9118034-9118056 ACCTGGAAAATGGGAGAGCCTGG - Intronic
1145177693 17:20715680-20715702 GTCTGGACAAAGGAAGATCTGGG - Intergenic
1145217304 17:21061690-21061712 ACCGAGCCAAAGGCACAGCTGGG - Intergenic
1146572534 17:33965253-33965275 AGCTGGTAAATGGCAGAGCTAGG + Intronic
1147244216 17:39109706-39109728 ACCAGGACCAAGGCTGAGCTTGG + Intronic
1147252577 17:39162046-39162068 TCCTGGACCGAGACAGAGCTGGG - Intronic
1148188927 17:45665390-45665412 TCCTGGAGAAAGACAGAACTGGG + Intergenic
1148245539 17:46027573-46027595 ACATGGGCAAAGGGAGATCTTGG + Exonic
1148327084 17:46789647-46789669 AACTGGACAAATTCAGAGCAGGG + Intronic
1148813770 17:50312316-50312338 CCCTGGTCACAGGCAGTGCTGGG + Intergenic
1149038993 17:52165067-52165089 ACTTGGAGAGAGGCAGATCTTGG + Intergenic
1149256086 17:54828444-54828466 ACCGGAACAAAGGGAGCGCTTGG - Intergenic
1149485225 17:57037277-57037299 ACCTAGTAAATGGCAGAGCTAGG - Intergenic
1149547086 17:57511624-57511646 AGCAGGCCAGAGGCAGAGCTGGG - Intronic
1149565976 17:57640900-57640922 ACCTGTAAAATGGAAGAGCTTGG - Intronic
1150468743 17:65417676-65417698 AGCTGGTCAGTGGCAGAGCTGGG + Intergenic
1150624715 17:66834566-66834588 AGCTGGAAAATGGCAGAGCCAGG - Intergenic
1150651004 17:67010158-67010180 ATGGGGACAAAGGCAGAGCTTGG - Intronic
1151293809 17:73168914-73168936 AACTGCAGAAAGGCAGAGCTTGG - Intronic
1151989444 17:77564803-77564825 CCCTGGAGAAAGACAGACCTGGG - Intergenic
1152109836 17:78351859-78351881 ACCTTGACTAAGCCAAAGCTGGG - Intergenic
1152135094 17:78499125-78499147 AGATGGAGAAAGGAAGAGCTGGG + Intronic
1152374991 17:79914370-79914392 AGCTGGAAAGGGGCAGAGCTGGG + Intergenic
1152723413 17:81933813-81933835 AGCTGGTCAAAGGCAGAGCCAGG - Intronic
1152734946 17:81992667-81992689 ACCCGGACAGAGGCAGAGAGAGG - Intronic
1152743570 17:82029207-82029229 CCCAGGACTAAGGCAGAGCTTGG - Intronic
1152939595 17:83161217-83161239 AGCTGGACAGTGGCTGAGCTAGG + Intergenic
1154415558 18:14173747-14173769 GCCTGGATAAGGGCAGAGCCAGG + Intergenic
1154455950 18:14525661-14525683 CCCTGAACAAAGACAGGGCTTGG - Intronic
1154490699 18:14919853-14919875 ACCTGGACTTAGGCCAAGCTGGG + Intergenic
1156457221 18:37301570-37301592 ACCTGGAGCAGGGCTGAGCTGGG - Intronic
1156617359 18:38803123-38803145 ACAAGGACAAGGGCAGAGCCTGG + Intergenic
1157285354 18:46373816-46373838 AGCCAGAGAAAGGCAGAGCTGGG + Intronic
1157484117 18:48074859-48074881 ACCTGGACAGCAGGAGAGCTGGG - Intronic
1157516100 18:48312548-48312570 AGCTGGAAAGCGGCAGAGCTGGG - Intronic
1159686667 18:71430296-71430318 AACTGGACAAACACAGAGCCTGG - Intergenic
1160833514 19:1113976-1113998 CACTGGTCAGAGGCAGAGCTGGG - Intronic
1161337704 19:3723022-3723044 ACCTGGACAGGGGCAGGGCTGGG + Intronic
1161500262 19:4610488-4610510 ACCTGGACCCAGGAAGAGGTGGG + Intergenic
1162430676 19:10626193-10626215 ACCTGAACCAAGACAGGGCTGGG - Intronic
1163249190 19:16116132-16116154 ACCTGAACAAAGGGATAGCCAGG + Intronic
1164792799 19:31002485-31002507 TCCTGGAAAAGGGCAGAACTGGG - Intergenic
1164939682 19:32243091-32243113 ACATGGACTAATGCAGAGCTGGG + Intergenic
1165411892 19:35667032-35667054 AGCTGGGGAGAGGCAGAGCTGGG - Intronic
1165868943 19:38957073-38957095 ACCTGGAGAAAAGCACAGCTTGG - Intronic
1165929912 19:39350777-39350799 ACCTGGAGAAAGGCTGGGCACGG - Intronic
1166085567 19:40472586-40472608 GCCTGGACATAGGGAGAGGTAGG - Exonic
1166103150 19:40583245-40583267 ACAGGGACAAAGGCAGGCCTGGG + Intronic
1166332849 19:42088729-42088751 ACATGGACAAACTCAGAGGTAGG + Intronic
1166391144 19:42409607-42409629 CCCTGCACCAAGGCAGAGCTGGG + Intronic
1166544444 19:43625781-43625803 ACCTGGACAAACAGGGAGCTAGG - Intronic
1167093490 19:47360502-47360524 ACCTGGAGAAAGACAGCTCTCGG - Intronic
1167451336 19:49571581-49571603 AGCTGGGAAATGGCAGAGCTGGG + Intronic
1167453879 19:49588384-49588406 ACCCGGAAGCAGGCAGAGCTGGG - Intronic
1167640737 19:50679914-50679936 ACAGAGACAAAGGCAGAGATAGG + Intronic
1167904427 19:52646977-52646999 CCCAGAACAAAGACAGAGCTGGG - Intronic
925589013 2:5491844-5491866 CTCTGGAGTAAGGCAGAGCTGGG + Intergenic
925612405 2:5712757-5712779 AGCTAGTCAATGGCAGAGCTGGG + Intergenic
926012835 2:9422613-9422635 CGCTGGTCAAAGGCGGAGCTCGG + Exonic
926104363 2:10141235-10141257 AACTGGTCAACAGCAGAGCTGGG - Intergenic
926698393 2:15786217-15786239 AGCTCGTCAATGGCAGAGCTGGG - Intergenic
927215157 2:20664278-20664300 ACCTGGAGAGTGGCAGAGCATGG - Intergenic
927311950 2:21641481-21641503 TGCTTGACAAAAGCAGAGCTTGG + Intergenic
928664041 2:33532587-33532609 TCCTGTAAAAAGGCAGAGCCTGG + Intronic
929990831 2:46784779-46784801 AGCTGGTCACAGGCAGAGCTGGG - Intergenic
930438393 2:51376319-51376341 ATCTGGGTAAAGGCAGAGGTTGG + Intergenic
931300336 2:60973176-60973198 ACCCGGCCAAAGGCACAGCCGGG + Intronic
932230947 2:70083888-70083910 AGCTAGACAGGGGCAGAGCTAGG + Intergenic
932846570 2:75141604-75141626 GGGTGGACAAAGGCATAGCTTGG - Intronic
933051204 2:77604887-77604909 TCCTGGAAAATGGAAGAGCTTGG - Intergenic
934320164 2:91964877-91964899 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
934553324 2:95275193-95275215 GCCTGGGCAAAGGCAGAGAAGGG - Intronic
934558060 2:95297756-95297778 AGCTGGACAGAGGAGGAGCTTGG + Intronic
935948845 2:108311073-108311095 ACCTGGTAACAGGCAGAGGTTGG + Intergenic
936605553 2:113949085-113949107 AACTGGAAAAAGGCAGGGCGTGG + Intronic
937871827 2:126791699-126791721 AAGGGGACAGAGGCAGAGCTGGG + Intergenic
938085281 2:128395878-128395900 GGCTGGAGAAAGGCAGGGCTGGG - Intergenic
938284786 2:130102856-130102878 CCCTGAACAAAGACAGGGCTTGG - Intronic
938335427 2:130491416-130491438 CCCTGAACAAAGACAGGGCTTGG - Intronic
938354397 2:130629251-130629273 CCCTGAACAAAGACAGGGCTTGG + Intronic
938764297 2:134450119-134450141 ACTTATACAAAGGCAGAGCATGG - Exonic
939627496 2:144495897-144495919 TCCTGCACAATGGCAGAGGTGGG - Intronic
939883437 2:147655785-147655807 ACCTTGACCAAGGGAGAGGTTGG + Intergenic
941031064 2:160512233-160512255 ACAAAGACAAGGGCAGAGCTTGG - Intergenic
942117658 2:172743852-172743874 AGGTGGACAAAGTCAGAACTGGG - Intronic
942251522 2:174051353-174051375 AGCTGAAAAGAGGCAGAGCTAGG - Intergenic
942998257 2:182291750-182291772 TCCTGGATAAAGACAGAGCTGGG + Intronic
945445890 2:209938080-209938102 CCCTGGTCAGAGGCAGAACTGGG - Intronic
945832726 2:214806442-214806464 ACCAGGGCAAAGGCAGAGGTAGG + Intronic
946012197 2:216574213-216574235 ACATGAACACAGGCAGAGATAGG + Intronic
946070773 2:217032632-217032654 AGCTGGACACAGGCTCAGCTTGG - Intergenic
946675908 2:222158963-222158985 AGCTGGTAAGAGGCAGAGCTGGG - Intergenic
946703079 2:222431909-222431931 CCCTGGAGAAAGGCAGAGAGTGG + Intronic
947091860 2:226521014-226521036 AGCTGGACAAAGGGAGGGTTTGG + Intergenic
947537051 2:230946725-230946747 ACCTGGACCAGGCCATAGCTGGG + Intronic
947658965 2:231852522-231852544 TTCTGGGCAAAGGCAGAGCCTGG + Intergenic
947734373 2:232447086-232447108 CCCTGGATCAGGGCAGAGCTGGG - Intergenic
948689210 2:239691400-239691422 ACCTGCACACAGGCTGGGCTGGG + Intergenic
948704574 2:239780868-239780890 ATTTGGACACAGGCAGATCTGGG - Intronic
948783855 2:240340774-240340796 ACTTGGACAATGCCAGGGCTCGG - Intergenic
948863049 2:240762168-240762190 ACCTGGCCAGAGGCTGAGATGGG + Intronic
949061095 2:241957834-241957856 ACATGAACAGAGGCAGAGATGGG - Intergenic
1168933769 20:1645712-1645734 AGCTAGAAAATGGCAGAGCTGGG + Intronic
1168982979 20:2023830-2023852 AGCTGGTCAAGGGCAGAGCCAGG + Intergenic
1169017747 20:2305445-2305467 ACCTGGAAATTGGCAGAGCCAGG - Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1169210615 20:3764437-3764459 ACCTGGGCAAAGGCAGGGCGGGG - Intronic
1170127810 20:12985449-12985471 AACTGGCTAATGGCAGAGCTGGG - Intergenic
1170420617 20:16189423-16189445 ATCCAGAGAAAGGCAGAGCTAGG - Intergenic
1171362996 20:24603374-24603396 CCCTGCTCAATGGCAGAGCTTGG - Intronic
1171985017 20:31654105-31654127 ATCTACACTAAGGCAGAGCTTGG + Intergenic
1172028661 20:31967051-31967073 ATCTGATCAAAGGCAGAGATGGG + Intergenic
1172205416 20:33159812-33159834 AGCTGGAAGGAGGCAGAGCTGGG + Intergenic
1172467303 20:35165799-35165821 AGCTAGTAAAAGGCAGAGCTGGG - Intergenic
1172740170 20:37160366-37160388 ACCTGGTAAGAGGCAGAGCCAGG - Intronic
1172884654 20:38222976-38222998 AGCTGGACCAAGGAAGAGTTGGG - Intronic
1172896234 20:38302186-38302208 ACTTGGAAAAAGGGAGAGCTGGG + Intronic
1172935395 20:38616417-38616439 AGCTGATCAGAGGCAGAGCTGGG + Intronic
1172973254 20:38888626-38888648 ACCCTGCCAAAGCCAGAGCTGGG + Intronic
1173281885 20:41635810-41635832 ACCAGGAGAAAGGCATATCTGGG + Intergenic
1173472598 20:43335396-43335418 AGAAAGACAAAGGCAGAGCTAGG + Intergenic
1173618957 20:44422089-44422111 AACCGGAAAATGGCAGAGCTTGG + Intronic
1173818681 20:46006990-46007012 AGCTGGAAAATGGCAGAGCCGGG + Intergenic
1174038986 20:47685956-47685978 AACTGGCCAAAGACAGAACTGGG - Intronic
1174053449 20:47783001-47783023 AGCTGGTCACAGGTAGAGCTGGG - Intronic
1174696492 20:52564912-52564934 AGCTAGAAAAAGGCAGAGCTGGG - Intergenic
1175159075 20:56994627-56994649 AGCTGGAAAAAGGTAAAGCTGGG - Intergenic
1175529983 20:59668012-59668034 ACCTGTACCGAGGCAGAGGTGGG + Intronic
1175804030 20:61817382-61817404 ACTGGGAACAAGGCAGAGCTCGG - Intronic
1176818212 21:13627682-13627704 CCCTGAACAAAGACAGGGCTTGG + Intronic
1176857761 21:13985519-13985541 ACCTGGATAAGGGCAGAGCCAGG - Intergenic
1177044966 21:16157996-16158018 ACCTGGATAGATGCAGGGCTAGG + Intergenic
1178244215 21:30936023-30936045 ACCCGGCCAAAGGCACAGCCAGG + Intergenic
1179318692 21:40269717-40269739 AGCTGGGCAAAGACAGAGATTGG - Intronic
1180231386 21:46428752-46428774 CCCTGGAGACAGGCAGCGCTGGG + Intronic
1180308416 22:11148931-11148953 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
1180546893 22:16510744-16510766 AGCTGGTAAATGGCAGAGCTGGG + Intergenic
1181442082 22:22941897-22941919 ACCTGGGCCAGTGCAGAGCTGGG - Intergenic
1181630358 22:24147948-24147970 GCCTGGGCAAAGGCAGAGTCTGG + Intronic
1181763993 22:25078072-25078094 AGCTGGCCAGGGGCAGAGCTGGG + Intronic
1181769409 22:25114431-25114453 AGCAGGATAAAGGCAGAGTTAGG + Intronic
1182052373 22:27323490-27323512 ACATGGGCAAAGGGAGAACTGGG - Intergenic
1182212288 22:28686611-28686633 AGCTGGTAAATGGCAGAGCTGGG - Intergenic
1182800711 22:33029762-33029784 GCCTGGACTCAGTCAGAGCTGGG - Intronic
1182953665 22:34400738-34400760 AGCTGGCAAAAGGCAGAGCATGG - Intergenic
1183272222 22:36869402-36869424 AGCTGGTGACAGGCAGAGCTGGG + Intronic
1183947340 22:41334055-41334077 ACCAACACCAAGGCAGAGCTGGG + Intronic
1184277914 22:43420744-43420766 ACCTGGAAAAAGACAGAACAGGG - Intronic
1184655037 22:45936829-45936851 TCCTGAACAAAGCCAGGGCTTGG + Intronic
1184681468 22:46074480-46074502 ACATGGACAAAGGCAGGACAGGG - Intronic
1185037646 22:48488378-48488400 ACCTGCAGGAAGGCAGAGCTTGG + Intergenic
1185050778 22:48552974-48552996 ACCTGGTCACAGGCAGAGATTGG + Intronic
1185118494 22:48951753-48951775 ACCAAGACAAAGGCAGAGATTGG + Intergenic
1185193239 22:49452003-49452025 GCCTGGACAAAGGAACAACTGGG - Intronic
1185394144 22:50578254-50578276 GCCTGGACAGAGGCAGGGTTCGG + Intronic
949881520 3:8664645-8664667 ACCTGGAGGACAGCAGAGCTGGG + Intronic
950126101 3:10510709-10510731 TCCTGGAAGAACGCAGAGCTTGG + Intronic
950194796 3:11001509-11001531 ACCAGGAAAGAGCCAGAGCTGGG + Intronic
950549214 3:13656023-13656045 GCCTGGAAAATGGCAGAGCTGGG - Intergenic
950590797 3:13934780-13934802 GCCTGGACAATGGCAGGCCTTGG + Intergenic
952022373 3:29039466-29039488 ACCTGGTAACAGGCAGAGATGGG + Intergenic
952860340 3:37807521-37807543 ACCAGGACAAAGGGGGAGCATGG + Intronic
952971085 3:38650635-38650657 ACCTTGACACATGCAGAGCCTGG + Intergenic
954036948 3:47855983-47856005 ACATGGACCAAGGCAGGCCTGGG + Intronic
954845510 3:53552104-53552126 CCCTGGAAAATGGCAGACCTGGG + Intronic
956475746 3:69618418-69618440 AGCTGAAAAAAGGCAGACCTAGG + Intergenic
956534443 3:70260243-70260265 ACGATGACAAAGGCAGAGATTGG - Intergenic
956674372 3:71720746-71720768 GCCTGGAAAGGGGCAGAGCTTGG + Intronic
958180758 3:90057661-90057683 ACCAGGACAAAGGAAGATGTTGG - Intergenic
958712027 3:97728718-97728740 ACTTGCCCAAAGGCAGAGCTTGG + Intronic
959526610 3:107384276-107384298 TCCTAGACAGAGGCAGAGGTGGG + Intergenic
959549367 3:107637540-107637562 ACCAAGACAGAGGCAGAGGTAGG - Intronic
960040390 3:113144468-113144490 ACATGAACAATGGTAGAGCTGGG - Intergenic
960086964 3:113601824-113601846 AACTGGAGAAAGTTAGAGCTGGG - Intronic
960837346 3:121920256-121920278 ACCTGGACAAAGGAAAATTTTGG - Intronic
961105797 3:124240300-124240322 AGCTGCAGAAAGGTAGAGCTGGG - Intronic
961670379 3:128524198-128524220 GCCTGGAGAAGGGCAGTGCTGGG + Intergenic
962748377 3:138414426-138414448 AGCTGGGCAAGAGCAGAGCTTGG - Intergenic
962823071 3:139071475-139071497 CCCTGGAAAAAGTCAGATCTAGG - Intronic
962960117 3:140303404-140303426 ACTTGGGCAGACGCAGAGCTGGG - Intronic
963157633 3:142116425-142116447 TCCTAGACAGAGGCAGAGATTGG + Intronic
963571194 3:146998507-146998529 ACTTGGACAAGCGCAGAGCCAGG + Intergenic
963662292 3:148142167-148142189 ACCTGGACACAGGGAGGGCAAGG + Intergenic
963924682 3:150938876-150938898 GCCTGGCCAAAGGCAGAGATAGG + Intronic
964713647 3:159698500-159698522 TCCTGGCCAAAGGCAGACATGGG + Intronic
965305643 3:167060059-167060081 ACTTGGAAACAGGCAGAGGTTGG - Intergenic
965398900 3:168194556-168194578 ACCTGGCATATGGCAGAGCTGGG + Intergenic
966111653 3:176409431-176409453 AGCTGGAAAATGGCAGAGCTGGG + Intergenic
966567159 3:181396322-181396344 CCCTGGACAACAGCAGAGCAAGG + Intergenic
966876353 3:184324083-184324105 AGCTGGAAGGAGGCAGAGCTGGG + Intronic
967215216 3:187203909-187203931 ACCTTGAGAAAGTCAGAGCAAGG - Intergenic
967865543 3:194187073-194187095 CCCTGCACACAGGCGGAGCTGGG + Intergenic
968554256 4:1239304-1239326 AGCTGGGCAGAGGCGGAGCTGGG + Intronic
969461785 4:7332881-7332903 ATCTGGTAAAAGGCTGAGCTGGG - Intronic
970138815 4:12957419-12957441 ACCTAGCAAATGGCAGAGCTAGG - Intergenic
970163609 4:13213850-13213872 ATCTGAACAATGGCAGGGCTTGG - Intergenic
970250981 4:14115795-14115817 AGCTGGCCAGTGGCAGAGCTGGG + Intergenic
970303280 4:14703689-14703711 CCCTGAAAAAAGGCAGAGCTTGG + Intergenic
970545239 4:17122687-17122709 ACCTCGGCAACTGCAGAGCTTGG - Intergenic
972361164 4:38326751-38326773 ACTTGGACACAGGTAGAACTGGG - Intergenic
973945082 4:55947578-55947600 CCCTGAACAAAGACAGAGCTTGG - Intergenic
974700341 4:65435492-65435514 ACAAGGACAAGGGGAGAGCTAGG + Intronic
979268645 4:118733179-118733201 ACCTGCTAAAAGACAGAGCTGGG - Intronic
979598678 4:122562345-122562367 ACATGGCTAAAGGCAAAGCTTGG + Intergenic
980582025 4:134768039-134768061 AGCTTGACAAATGCAGATCTTGG - Intergenic
982959040 4:161812431-161812453 AACTGAACAATGGCAGAGATGGG - Intronic
985230296 4:187809074-187809096 AACTGAACAAAAGGAGAGCTAGG - Intergenic
987674957 5:21062779-21062801 AACTGGGTAAAGGCAGAGGTTGG + Intergenic
988845109 5:35119820-35119842 ACCAGGACAAGGGCTGTGCTGGG + Intronic
988916687 5:35901452-35901474 AGCTTTTCAAAGGCAGAGCTGGG - Intergenic
989800553 5:45533486-45533508 TCCTTGACAAAGGAAGAGCTGGG - Intronic
990514743 5:56520643-56520665 AGGTGGAAAAAGGCAGAACTTGG - Intronic
991000231 5:61775383-61775405 ACATAGAGAAAGTCAGAGCTGGG + Intergenic
991485494 5:67131446-67131468 AGCTGGTAAGAGGCAGAGCTAGG + Intronic
991771063 5:70041660-70041682 ACAAAGACAAAGGCAGAGATAGG - Exonic
991850355 5:70917077-70917099 ACAAAGACAAAGGCAGAGATAGG - Exonic
991995491 5:72382383-72382405 ACCTGGACTAAGGCATGGCCTGG + Intergenic
992863659 5:80937117-80937139 GGCTGGACCCAGGCAGAGCTGGG - Intergenic
993314160 5:86377835-86377857 AGCTGGTAAAAGGCAGAGCCAGG + Intergenic
993972852 5:94441416-94441438 ACCTGTGCAAAGGCAGAGGCAGG - Intronic
994812093 5:104532938-104532960 ACTTGGAGGAAGGCAGAGCGGGG + Intergenic
995444370 5:112226297-112226319 TCCTGGACAAACTCAGAGATTGG + Intronic
995571633 5:113488005-113488027 GCCTAGACAAAGACAGCGCTGGG + Intronic
997255597 5:132425526-132425548 ACAAGCAAAAAGGCAGAGCTGGG - Intronic
999094150 5:148963237-148963259 ACCTGGTAAGAGACAGAGCTAGG - Intronic
999175753 5:149630631-149630653 ACCGGGGCAGAGGCTGAGCTGGG - Intronic
999232057 5:150067363-150067385 AGCTGGTCAAAGGCAGAGTCTGG - Intronic
999477588 5:151915024-151915046 AACTAGTAAAAGGCAGAGCTAGG - Intronic
999637224 5:153635463-153635485 GGCTGCACAAAGGCAGAGCTAGG + Intronic
1001426389 5:171625408-171625430 ACCTGGAGAAAGGGAGAGCTGGG + Intergenic
1001529990 5:172454684-172454706 ACCGGGACAAAGGCCGGGCGGGG - Intergenic
1001926376 5:175640098-175640120 ACCTGGACACAGAGAGGGCTAGG - Intergenic
1002168744 5:177363458-177363480 AACTGGAAAAAGTCAGGGCTGGG + Intronic
1002466313 5:179410596-179410618 ACCTGGACAAAGCCTGAGATGGG + Intergenic
1002708595 5:181180185-181180207 GCCTGGACAGAGGCAGCCCTGGG - Intergenic
1003459439 6:6316940-6316962 ACCTCTACAAAGGCAGTGCAGGG - Intronic
1003527137 6:6907854-6907876 AGCTGGTCAGTGGCAGAGCTGGG + Intergenic
1004635867 6:17467198-17467220 TTCTGGGCCAAGGCAGAGCTAGG - Intronic
1004641076 6:17515929-17515951 TCCTGAACAAAGCCAGTGCTTGG + Intronic
1004771153 6:18783866-18783888 AGCTTCACAAAGACAGAGCTTGG + Intergenic
1005098827 6:22147100-22147122 AGCTGGAGAAAGGCGGAGCGAGG + Intergenic
1005919195 6:30383741-30383763 ACCTGCCCAAAGGCTGTGCTGGG - Intergenic
1006576909 6:35053276-35053298 ACCTGGCCAGGGGCAGAACTAGG - Intronic
1006671940 6:35735149-35735171 CCCTGGAGAAGGGCAGAGCAAGG + Intergenic
1007169454 6:39852425-39852447 GCCTAGAGGAAGGCAGAGCTGGG + Intronic
1007292459 6:40797959-40797981 AGCTGGAAATTGGCAGAGCTGGG - Intergenic
1007389125 6:41540043-41540065 ACCTGGAAAGAGGCAGAAGTGGG + Intergenic
1007560599 6:42805247-42805269 ACCTGGACAAAGACAGATGCTGG + Intronic
1013401614 6:109802181-109802203 ATCTGGAAAAAGTCAGAGATGGG - Intronic
1013583930 6:111561896-111561918 CCCTGGGCAAAGGCAGCGCAGGG + Intronic
1013705772 6:112832319-112832341 ACCTGAAGAAAGGCAGAGGAGGG + Intergenic
1014779834 6:125551471-125551493 AGGTGGAAAAAGGCAGACCTAGG - Intergenic
1014824830 6:126037211-126037233 ACCTGGTAAGTGGCAGAGCTAGG - Intronic
1017081840 6:150677034-150677056 GCCTGGATAAAGGCAGCGCAGGG - Intronic
1018280674 6:162182133-162182155 CCCTGGACAAAGACAGGGGTTGG + Intronic
1019392284 7:795107-795129 ACCTGGACCCAGGCAGGGCAGGG + Intergenic
1019967399 7:4510957-4510979 ACCTGCACAAAGGCTTTGCTGGG + Intergenic
1021250612 7:18320832-18320854 AGCTGGCCACAGGCAGAGCAGGG - Intronic
1022553914 7:31272455-31272477 AACAGGAAAGAGGCAGAGCTGGG - Intergenic
1024169676 7:46770866-46770888 ACCTTGACATACACAGAGCTTGG - Intergenic
1024249555 7:47495956-47495978 ACCTGGACAGAGCCAGAGGCAGG + Intronic
1026376254 7:69754024-69754046 ACCTTTATGAAGGCAGAGCTTGG + Intronic
1026827167 7:73591658-73591680 AGTTGGAAGAAGGCAGAGCTGGG - Intergenic
1029283501 7:99451304-99451326 ACCTGGTCAAAGGCAAGTCTGGG + Intronic
1030830635 7:114215986-114216008 ACCTAGCCACTGGCAGAGCTGGG + Intronic
1031072325 7:117175574-117175596 AGTTGGTGAAAGGCAGAGCTGGG - Intronic
1031552270 7:123129749-123129771 ACTTGGAAAAAGGAAGAGATTGG - Intronic
1034013143 7:147552803-147552825 ACCTAGAAAAAGGCAGAGCCAGG - Intronic
1035788076 8:2278249-2278271 ACATGGGCACAGGAAGAGCTGGG + Intergenic
1035804731 8:2443464-2443486 ACATGGGCACAGGAAGAGCTGGG - Intergenic
1036610716 8:10347534-10347556 ACCAGAACAAAGGCTGAGGTGGG - Intronic
1037877025 8:22553366-22553388 TCCTGGGCAGTGGCAGAGCTTGG + Intronic
1040388540 8:46931180-46931202 AGCTGAACAGAGGCAGGGCTGGG - Intergenic
1042234294 8:66593118-66593140 ACCTGAATAAAGGCAGAAGTAGG + Exonic
1042877427 8:73452019-73452041 GCCTGGAGCAAGGCAGAGCAAGG + Intronic
1043763869 8:84104580-84104602 AGGGGGAAAAAGGCAGAGCTAGG + Intergenic
1044173184 8:89082288-89082310 ACCTGGCCAAGGGGATAGCTTGG - Intergenic
1045379004 8:101604316-101604338 ACTTAGAGAAAGGCAGTGCTCGG - Intronic
1047053362 8:121138040-121138062 AACTGGGTAAAGGCAGAGGTTGG + Intergenic
1048070375 8:131014665-131014687 AACTAGTAAAAGGCAGAGCTGGG - Intronic
1048096545 8:131301385-131301407 ACCAGGAAAAAGGCAGAGGTTGG - Intergenic
1048539183 8:135327018-135327040 ACCTGAACAATTACAGAGCTAGG + Intergenic
1048594811 8:135855118-135855140 TCCTGGGCATAGCCAGAGCTTGG - Intergenic
1049254212 8:141605271-141605293 GCCTGGAGAAAGCCAGAGCCCGG + Intergenic
1049962298 9:748342-748364 ACTGGGACAAAGGCTGAGGTGGG + Intergenic
1050003094 9:1099296-1099318 CCCTGGACAGAGGCAGTGCCTGG + Intergenic
1050065950 9:1759638-1759660 ATCTGAACAGAGGGAGAGCTGGG - Intergenic
1051220544 9:14843917-14843939 ACCTAGAAAATGGCAGAACTGGG - Intronic
1051242698 9:15076793-15076815 ATCTGGACCAAGGGAGAGCACGG + Intergenic
1052035843 9:23679872-23679894 ACCTGGAAAAAAGCCTAGCTGGG - Intergenic
1052637876 9:31125785-31125807 TTCTGGAAAGAGGCAGAGCTTGG + Intergenic
1053414742 9:37940088-37940110 AACTTGTCAGAGGCAGAGCTAGG + Intronic
1053425869 9:38009508-38009530 ACCTGCCCAAGGGCAGAGCCAGG + Intronic
1054710991 9:68510476-68510498 AACTGGAAAATGGCAGAACTAGG - Intronic
1055004609 9:71491303-71491325 ACCTGTAGAAAGTTAGAGCTGGG - Intergenic
1055891381 9:81127821-81127843 ACCTGGATAAAGCCAGCTCTAGG + Intergenic
1057428748 9:94975801-94975823 TCCTTGACAAAGGCAGGGCCCGG + Intronic
1058292329 9:103257695-103257717 ACCTGGTAACAGGCAGAGGTTGG - Intergenic
1058950554 9:109899721-109899743 AACGGGACACAGACAGAGCTTGG - Intronic
1060202007 9:121656857-121656879 ACCTGGAGGTGGGCAGAGCTGGG - Intronic
1060435207 9:123586898-123586920 AGCTGCCCAAAGTCAGAGCTAGG + Intronic
1060563937 9:124572140-124572162 ACGAGGCAAAAGGCAGAGCTGGG + Intronic
1060787870 9:126464795-126464817 AGCTGGTCAAGGGCAGAGCTGGG - Intronic
1060789180 9:126474195-126474217 AGCTGGATGGAGGCAGAGCTGGG - Intronic
1062218984 9:135404231-135404253 ACCTGGGCAAAGGCCAACCTTGG + Intergenic
1062322331 9:135996524-135996546 CCCTGGGCAAAGGCAGTGCCTGG - Intergenic
1062443009 9:136579447-136579469 GCCTGGCCGAAGGCAGAGCTGGG - Intergenic
1062547304 9:137069571-137069593 ACCTGTACCAAGCCTGAGCTTGG - Intronic
1062669114 9:137695934-137695956 AACTGGACAAAGGCAGTAGTAGG + Intronic
1203529147 Un_GL000213v1:121821-121843 CCCTGAACAAAGACAGGGCTTGG - Intergenic
1185678388 X:1867474-1867496 CCCTGAACAAAGACAGAGCGGGG - Intergenic
1192234968 X:69289855-69289877 GCCTGGACATAGGCAGAGATGGG + Intergenic
1193929993 X:87541786-87541808 ACTTGGTAACAGGCAGAGCTTGG + Intronic
1195140840 X:101957974-101957996 ACTTGGAGAAAGGCAGATCAGGG + Intergenic
1195404230 X:104495219-104495241 ACCTGGGAAGTGGCAGAGCTAGG + Intergenic
1195746805 X:108126839-108126861 ACCCAGATAAAGCCAGAGCTTGG + Intronic
1197026722 X:121759539-121759561 CTCTGGAGTAAGGCAGAGCTGGG + Intergenic
1198031938 X:132761513-132761535 ACCTGGGAAATGGCAGGGCTTGG - Intronic
1198177023 X:134166672-134166694 AGGTGAACAAAGGCGGAGCTGGG + Intergenic
1198200021 X:134407085-134407107 AGCTAGAGAATGGCAGAGCTGGG - Intronic
1198762485 X:140047399-140047421 ACCTGGAGAGTGACAGAGCTAGG - Intergenic
1198831150 X:140752040-140752062 AACTGGAAGAAGCCAGAGCTAGG - Intergenic
1199323331 X:146467486-146467508 TCCTGGACAAAAGCAGAGAGAGG + Intergenic
1199863845 X:151825555-151825577 ACCTGGAAAGAGGAAGAGCTGGG + Intergenic
1200103488 X:153700044-153700066 AGCTGGCCCAGGGCAGAGCTAGG - Intergenic
1201187688 Y:11419985-11420007 AGCTGGTAAAGGGCAGAGCTGGG + Intergenic