ID: 915269845

View in Genome Browser
Species Human (GRCh38)
Location 1:154746271-154746293
Sequence GGGGCACGGGGCCACTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915269837_915269845 10 Left 915269837 1:154746238-154746260 CCGCGTTACAATGGAGACAAGTG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG 0: 1
1: 0
2: 0
3: 18
4: 170
915269835_915269845 26 Left 915269835 1:154746222-154746244 CCAAGGCAAAAAAGGGCCGCGTT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG 0: 1
1: 0
2: 0
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915269845 Original CRISPR GGGGCACGGGGCCACTGCGC AGG Intronic
900180363 1:1308505-1308527 GTGGCGCGGTGCCACCGCGCAGG + Intronic
900207981 1:1439727-1439749 GGGGCACGGGGCGTGGGCGCGGG - Exonic
900255033 1:1693435-1693457 GGGGGGCGGGGCCGCCGCGCGGG + Intronic
900263776 1:1746701-1746723 GGGGGGCGGGGCCGCCGCGCGGG + Intergenic
900289966 1:1919642-1919664 TGGGCATGGGGCCAGTGGGCGGG - Intergenic
900584391 1:3425477-3425499 GGGGCACGGGGCAGGGGCGCGGG + Intronic
900924214 1:5692822-5692844 GGGCCACGGGGCTACTGCTAGGG - Intergenic
904587697 1:31589041-31589063 GGGTCCCGGGGCCACTGAGCGGG - Intergenic
905684880 1:39901267-39901289 GGGGGCCGGGTCCCCTGCGCCGG + Exonic
905870249 1:41399441-41399463 GGGGCACGGGGGGTCTGCGATGG - Intergenic
915247684 1:154568050-154568072 GCGCCACGGGGCCGCAGCGCCGG - Exonic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
916797337 1:168179192-168179214 GGGGCACGGGGTCTGGGCGCTGG + Intronic
917803421 1:178591834-178591856 GGGGCAGGGGGCCACTCAGTGGG + Intergenic
919930225 1:202216574-202216596 GCGGCTAGTGGCCACTGCGCTGG + Intronic
920009707 1:202858994-202859016 TGGGCATGGTGCCACTGGGCTGG + Intergenic
920250226 1:204618276-204618298 GGGCCAGGGGGCCACAGCTCTGG - Exonic
921562978 1:216680546-216680568 GGGTGAAGGGGCCACTGCGCTGG + Intronic
922785413 1:228280099-228280121 GGGGCATGGGGCTACTGAGAGGG + Intronic
1062961406 10:1576020-1576042 GGGGCCCAGGGCCACTCGGCGGG + Intronic
1064205587 10:13321122-13321144 GGGGCAAGGGACCACAGTGCTGG - Intronic
1066565252 10:36715443-36715465 CAGGCATGAGGCCACTGCGCAGG - Intergenic
1071847545 10:89535756-89535778 CCGGGAAGGGGCCACTGCGCAGG - Intronic
1072755386 10:98017380-98017402 GGGGCACAGGGCCAGAGCGCAGG + Intronic
1075005014 10:118823829-118823851 TGGGCAAGGGACCACTGCGTAGG + Intergenic
1075989857 10:126826320-126826342 GGGGAACAGGGCCATTGGGCAGG - Intergenic
1076753773 10:132557386-132557408 GCAGCACGGTGACACTGCGCAGG - Intronic
1076861586 10:133140472-133140494 GGGGCACGGGCTCACAGCCCTGG - Intergenic
1080385970 11:31811490-31811512 CGGGCTCGGGGGCCCTGCGCCGG - Intronic
1081713679 11:45233917-45233939 GGGCCACGGGGCCTCTGTGAGGG - Intronic
1083572667 11:63768656-63768678 GGGGCGCGGGGCCGCGGGGCCGG + Exonic
1083869363 11:65477488-65477510 GGGGGACGTGGCCCCGGCGCGGG + Intergenic
1083995029 11:66267555-66267577 GGGCCACGGGGCGATGGCGCGGG - Exonic
1084482577 11:69430350-69430372 AGGGAACGGGGCCACAGCCCAGG + Intergenic
1084524389 11:69686730-69686752 GGGGCCCTGGCCCACTGCCCGGG + Intergenic
1086429991 11:86727456-86727478 GGAGCACTGGCCCACTGCTCAGG - Intergenic
1088776633 11:113091281-113091303 GGAGCAGGGAGCCACTGAGCTGG - Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1091279957 11:134376154-134376176 GGGGGCGGGGGCCACTGAGCTGG - Exonic
1091616391 12:2053704-2053726 GCGGCCCCGGGCCACTCCGCAGG - Intronic
1100260557 12:92928973-92928995 GGAGCTCGGGGCCGCGGCGCGGG - Intronic
1102953428 12:117045049-117045071 GGGGCAAGGGGCAGCTGCGTCGG - Intronic
1103944788 12:124520027-124520049 GGGGCCCGTGGCCACTGGACTGG + Intronic
1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG + Intergenic
1107838531 13:44432755-44432777 TGGGCAGGGGGCCACTGCTGAGG + Intronic
1108522941 13:51261261-51261283 GGGGCACGGGGCTAGTGCAGAGG + Intronic
1113584809 13:111457960-111457982 GAGGCACGGGCCCACAGCACGGG + Intergenic
1113917348 13:113882489-113882511 GGAACACGGGGCCATTGTGCTGG - Intergenic
1118776599 14:68977935-68977957 GGGGCACAGGCTCACCGCGCAGG + Intronic
1122369451 14:101221292-101221314 GGGGCATGTGGCCACACCGCTGG - Intergenic
1122864887 14:104599268-104599290 AGGGCACGGGGCCATTGCCATGG - Intronic
1202899781 14_GL000194v1_random:28370-28392 GGGGCGGGGGGCCACAGCGCCGG - Intergenic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1128707256 15:69845690-69845712 AGGGCACAGGGCTGCTGCGCTGG - Intergenic
1128978222 15:72168424-72168446 GGGGCCAGGGGCCTCTGCTCTGG - Intronic
1130520608 15:84658257-84658279 GGGGCACGGCTCCGCTGCTCAGG - Exonic
1132546126 16:534260-534282 GGGGGCCGGGGCCACAGCACAGG - Intronic
1132690277 16:1178942-1178964 GGGGCACGGGGCCAGCCTGCTGG - Intronic
1132893389 16:2215313-2215335 GGGACACGGGGCCACCACGTGGG + Intergenic
1132924676 16:2422864-2422886 TGGGCATGAGGTCACTGCGCAGG + Intergenic
1133103801 16:3494410-3494432 GGGGCATGGTGCCACTGTGGAGG + Intronic
1134492102 16:14703167-14703189 GGAGCCCAGGGCCACTGCCCGGG - Intergenic
1134497483 16:14742289-14742311 GGAGCCCAGGGCCACTGCCCGGG - Intronic
1137708009 16:50548592-50548614 GGGGCCCGGGGCGAGCGCGCGGG - Intronic
1137979104 16:53054941-53054963 TGGGCGCGGGGCGGCTGCGCAGG - Intergenic
1138180393 16:54937089-54937111 GGGTCACGGGATCACTGCGTGGG + Intergenic
1141135001 16:81459360-81459382 ACGGCACGGGGTCACAGCGCAGG - Intronic
1141198702 16:81881064-81881086 GGGGCAGGGGGCCCCTGCTGGGG + Intronic
1141538474 16:84699962-84699984 GCGGCGCGCGGCCAGTGCGCAGG + Intronic
1141694750 16:85614063-85614085 GGGGCAGGGAGCCGCTCCGCCGG - Intronic
1142136265 16:88453295-88453317 GGAGCAGGCGGCCACTGCGAGGG - Exonic
1142271921 16:89094188-89094210 GGGGAGCGGGGCCCCCGCGCGGG + Intronic
1145787428 17:27603292-27603314 AGGGCTCGGGGCCTCTGTGCTGG + Intronic
1145794978 17:27650209-27650231 GGGGCAGGGGGGCGGTGCGCGGG - Intergenic
1146058695 17:29593538-29593560 GGGGCCCGGGGCCGCGGGGCGGG - Exonic
1147315527 17:39618276-39618298 GGGGCACCGGGGCACCTCGCTGG - Intergenic
1148166940 17:45490441-45490463 AGGGGACGGGGCCACAGCGGCGG + Intronic
1148262361 17:46194066-46194088 GGTGCACGTAGTCACTGCGCAGG + Intronic
1148867236 17:50634992-50635014 GGGCTCCGGGGTCACTGCGCGGG + Intronic
1150398119 17:64836845-64836867 AGGGGACGGGGCCACAGCGGCGG + Intergenic
1150837836 17:68580563-68580585 GGGGCATGGGGCTTCTGAGCTGG + Intronic
1151657432 17:75502463-75502485 GGGGCGGGGGGCCTTTGCGCCGG + Exonic
1151785822 17:76274400-76274422 GGGGCCGGGGGGCACGGCGCAGG + Intronic
1151889979 17:76946201-76946223 GGGGAACGGGGACTCTGAGCTGG + Intronic
1152693358 17:81731927-81731949 GGAGCAGGGGGCGACTGGGCTGG - Intergenic
1156361807 18:36390220-36390242 GGGGGACGTGTCCACTGGGCAGG + Intronic
1158931054 18:62325345-62325367 GGCGCGCGGGGCCATGGCGCGGG - Exonic
1160242421 18:77132967-77132989 GGCGCACGGGGCCCACGCGCAGG + Intronic
1160427890 18:78790751-78790773 GGGCCACAGGGGCACAGCGCTGG + Intergenic
1160499795 18:79396020-79396042 AGGGCTCGGAGCCACCGCGCAGG + Intronic
1160990488 19:1858364-1858386 GGGGCACCAGGCCACTGTGAGGG - Intronic
1162111980 19:8404364-8404386 CGGGGACGGGGCAACAGCGCAGG - Exonic
1165784474 19:38453070-38453092 GAGGGGCGGGGCCACGGCGCTGG + Intronic
1166449315 19:42884633-42884655 GGGTCACGTGTCCACTGCACAGG + Intronic
1166699551 19:44874350-44874372 GGAGCCCTGGGCCACTGCGGAGG - Exonic
1167331472 19:48859056-48859078 GGGGCAGGGGGTCGCCGCGCAGG + Exonic
927569463 2:24145277-24145299 GGGGGATGGGGACACTGGGCAGG - Intronic
927920755 2:26970630-26970652 GGGGGACGAGGGCACTGCGCAGG - Exonic
928266369 2:29815472-29815494 GAGGCACTGGGACTCTGCGCCGG + Intronic
928366484 2:30706890-30706912 GGGGCACCTGCCCACTGCGCTGG - Intergenic
928415109 2:31085465-31085487 GAGGCACAGGGCCACAGGGCAGG + Intronic
936516762 2:113185913-113185935 GGGGCAGGGGGCCAAGGTGCAGG - Exonic
938909955 2:135876634-135876656 GGGCCACGGCTACACTGCGCAGG - Intergenic
940954525 2:159712812-159712834 GGGCCAAGGGGCCACAGCGCAGG + Intronic
942054805 2:172172601-172172623 GGGCCGCGGGGAAACTGCGCCGG - Intergenic
945119363 2:206442879-206442901 GGGGCAGAGCGCCCCTGCGCGGG + Intergenic
948048969 2:234964989-234965011 GGGTCACGGGAGCACTGGGCTGG - Intronic
948498481 2:238371614-238371636 TGGGCGAGTGGCCACTGCGCTGG - Intronic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948835161 2:240622861-240622883 TGGGCACGGGGGCACTGCCCGGG - Intronic
1170410299 20:16082201-16082223 TGGGCACAGGGCCACTGGGCAGG - Intergenic
1171425968 20:25048864-25048886 GCAGCACGGGGCCCCTCCGCTGG + Intronic
1171963696 20:31514267-31514289 GGGGCTCTGGGCCACTGCGGTGG - Intergenic
1174581356 20:51574052-51574074 GTGGCTCTGGGCCACTGAGCAGG + Intergenic
1176035311 20:63033525-63033547 GGGGGAGGGGCCCACAGCGCTGG - Intergenic
1176088745 20:63309714-63309736 GGGGCAGGTGGTCACTGCACGGG - Intronic
1176100292 20:63361512-63361534 GGGGGACGGGGAGGCTGCGCTGG + Intronic
1176619156 21:9043144-9043166 GGGGCGGGGGGCCACAGCGCCGG - Intergenic
1178680402 21:34669224-34669246 GGGGCACTGGGGCCTTGCGCAGG - Intergenic
1181514408 22:23402810-23402832 GCGGCGCGGGTGCACTGCGCTGG - Intergenic
1182356325 22:29723763-29723785 GGGGCACGGGGCCAGTGCCACGG + Intronic
1184062122 22:42089883-42089905 GGAGCACGGTGCCACTCCTCAGG - Intronic
1184769095 22:46587594-46587616 GGGGCGGGGGGCCAGTGGGCTGG + Intronic
1184803510 22:46776829-46776851 GGGGCAGGAGGACACTGCACAGG + Intronic
1185362057 22:50414320-50414342 GGGGGGGGGGGCCACTGCACAGG - Intronic
1185388881 22:50548488-50548510 GGGCCAGGCGGCCTCTGCGCGGG - Exonic
950172897 3:10851778-10851800 GGGGCCCTTGGCCACTGGGCAGG + Intronic
952867223 3:37862107-37862129 GGGGCGCGGGGGCGCGGCGCGGG - Intronic
953549943 3:43894346-43894368 TGGGCTTGGGGCCCCTGCGCCGG - Intergenic
954107834 3:48418872-48418894 TGGGCACGGGTGCACTGCACTGG - Intronic
954683892 3:52360256-52360278 GGGGCAATGGGCCACTGGGCAGG - Intronic
961457902 3:127033319-127033341 GGAGCACGGGGCCAGAGGGCAGG + Intronic
962677573 3:137768193-137768215 GGGGCACGTGGCGAGTGCGAGGG + Intergenic
962855233 3:139339254-139339276 GTGTCATGGGGCCACTGCTCTGG + Intronic
964269479 3:154939915-154939937 GGGTTACAGGGCCACTGGGCAGG - Intergenic
966246398 3:177812800-177812822 GGGGCACCTTGCCACTGGGCAGG + Intergenic
966593028 3:181702231-181702253 GCGGCACTGAGCCGCTGCGCAGG + Intergenic
966861561 3:184233534-184233556 GGGTCACTGGGCCACTGTGAAGG - Intronic
966874526 3:184314772-184314794 GGGCCGCGGGGCCAGGGCGCCGG - Intronic
968554961 4:1242191-1242213 GGGGCAGGGGGCCCCTGAGAGGG + Intronic
968573955 4:1356332-1356354 GGGACGCGGGGCCACTGACCTGG - Intronic
968603671 4:1521492-1521514 GGGCCACGGGGCCCCGGCGGGGG - Intergenic
969616476 4:8255846-8255868 GGGGCACGGGGCCACAGAGAAGG + Intergenic
978374328 4:108059245-108059267 GCTGCATGCGGCCACTGCGCTGG + Intronic
981079218 4:140622393-140622415 AGGGCACGGCGGCACTGCCCCGG - Exonic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
985527909 5:416357-416379 AGACCACGGGGCCACTGAGCAGG + Intronic
985566106 5:618530-618552 TGGGCCTGGGGCCACTGCGCTGG + Intronic
985743503 5:1633751-1633773 GGGGTCCGGGGCGGCTGCGCGGG + Intergenic
985965909 5:3338643-3338665 GGGGCCAGGGGCGACTGGGCAGG - Intergenic
986799858 5:11247402-11247424 GGGGCCTGGGCCCACTACGCAGG + Intronic
989565352 5:42895977-42895999 GGGGCAGTGGACCACTGTGCTGG - Intergenic
1019309654 7:353800-353822 GGGGTACAGGGACACTGGGCGGG + Intergenic
1019321026 7:415320-415342 GGGTCACGCGGCCAGTTCGCGGG + Intergenic
1019776245 7:2913524-2913546 GGAGGACGGGGCCCCTGGGCTGG + Intronic
1020101986 7:5399100-5399122 GGGGCAGGGGGGCACTGTGGGGG - Intronic
1024253875 7:47525310-47525332 GGGCCACGGGGCCACCACACTGG + Intronic
1029338043 7:99919152-99919174 GGGGCACGGGGCCCAGGCGCCGG + Exonic
1030014300 7:105203275-105203297 GGAGCACTGGGCCAGTGCGGTGG - Intronic
1034429652 7:151034826-151034848 GGGCCACTGGGCCACTGACCTGG - Exonic
1034439940 7:151081346-151081368 GGGGCTCGGGGCCACCTCCCGGG - Exonic
1035855753 8:2974450-2974472 GGGGCACTGCCCCACTGCACAGG - Exonic
1036733140 8:11284039-11284061 GGGACACAGGGCCACTCCACAGG - Intergenic
1038449961 8:27633702-27633724 GGGGCGCGGGGCCCCCGCGGCGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039845379 8:41321896-41321918 GGGGCACTGGGCTACTTCCCAGG + Intergenic
1040408651 8:47133629-47133651 GGGTCACAGAGCCACTGCCCGGG - Intergenic
1041838978 8:62248237-62248259 GGGGCCCGCGGGCGCTGCGCGGG - Intergenic
1049622057 8:143602887-143602909 GGGGGACGAGGCCACTGCCTTGG + Exonic
1049762162 8:144336581-144336603 GGGGAAGGGGGCCACCGAGCCGG - Intergenic
1051172821 9:14336662-14336684 CAGGCTCTGGGCCACTGCGCAGG - Intronic
1051896789 9:21995832-21995854 GGGGCACCGGGTCAGCGCGCCGG - Intronic
1056763147 9:89428687-89428709 GGGGCCGGGGGCCATTGCCCTGG - Intronic
1057179261 9:93021177-93021199 AGGGCACGGGGGCACTGGGAGGG - Intronic
1058885739 9:109320359-109320381 GGGGCGCGGGGCCGCCGGGCTGG - Exonic
1060724037 9:125995671-125995693 GGGGAAAGGGGCCACTGTCCAGG - Intergenic
1061064233 9:128267426-128267448 GGGTCACTGGGCCACGGCCCAGG + Intronic
1061677789 9:132228138-132228160 GGTGCAGGAGGCCACTGCCCAGG - Intronic
1061766787 9:132886554-132886576 AGGGCACGGAGCCACTGAGCTGG + Intronic
1061933890 9:133846861-133846883 GGGTCACCAGGCCACTGGGCAGG + Intronic
1062339262 9:136086708-136086730 GGGAAACGGGGCCACTGGTCGGG - Intronic
1062589231 9:137266009-137266031 GGGCCATGCGGCCACTCCGCTGG + Intronic
1062609955 9:137369189-137369211 GGGGCACGGGGCCACCACATGGG + Intronic
1190054768 X:47175182-47175204 GGGACACAGGGCCACAGGGCAGG - Intronic
1194119486 X:89943101-89943123 GGGACACGGGGCAAGTGCTCAGG + Intergenic
1199993087 X:153000722-153000744 GGGGGGCGGGGCCATTGCTCTGG - Intergenic
1200074372 X:153543917-153543939 GGGCCCTGGGGCCAGTGCGCGGG + Intronic
1200081421 X:153578638-153578660 GGGGCAGAGGGCCACTGTGCCGG + Intronic
1200472358 Y:3600658-3600680 GGGACACGGGGCAAGTGCTCAGG + Intergenic