ID: 915271442

View in Genome Browser
Species Human (GRCh38)
Location 1:154756485-154756507
Sequence GAGAGTAAACAGATGAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 458}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915271442_915271448 1 Left 915271442 1:154756485-154756507 CCCCCCTTCATCTGTTTACTCTC 0: 1
1: 0
2: 0
3: 25
4: 458
Right 915271448 1:154756509-154756531 TTCCAGTGACTCCTTCCCCCCGG 0: 1
1: 0
2: 3
3: 33
4: 258
915271442_915271454 18 Left 915271442 1:154756485-154756507 CCCCCCTTCATCTGTTTACTCTC 0: 1
1: 0
2: 0
3: 25
4: 458
Right 915271454 1:154756526-154756548 CCCCGGCTCCTTGCCAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 300
915271442_915271458 25 Left 915271442 1:154756485-154756507 CCCCCCTTCATCTGTTTACTCTC 0: 1
1: 0
2: 0
3: 25
4: 458
Right 915271458 1:154756533-154756555 TCCTTGCCAGCTCAGGGCCTTGG 0: 1
1: 0
2: 3
3: 46
4: 358
915271442_915271456 19 Left 915271442 1:154756485-154756507 CCCCCCTTCATCTGTTTACTCTC 0: 1
1: 0
2: 0
3: 25
4: 458
Right 915271456 1:154756527-154756549 CCCGGCTCCTTGCCAGCTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915271442 Original CRISPR GAGAGTAAACAGATGAAGGG GGG (reversed) Intronic
900662096 1:3789873-3789895 GAGATTTCACACATGAAGGGTGG + Intronic
901505851 1:9685182-9685204 GAGAATAAAAATATCAAGGGTGG + Intronic
901684393 1:10935508-10935530 TGGAGCAAACAGATGATGGGTGG + Intergenic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902603924 1:17558309-17558331 GAGATTCAAGAGATGATGGGTGG - Intronic
903135785 1:21308442-21308464 GGGAGTAACAAGAGGAAGGGAGG + Intronic
903517071 1:23918459-23918481 GAAAGTAAACAGAAGCAGGCCGG + Intergenic
903942525 1:26941649-26941671 GAGATTGACCAGGTGAAGGGTGG + Exonic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
906979180 1:50609887-50609909 GGGAGTAAACAGGTGAAACGTGG - Intronic
907249262 1:53127273-53127295 GTGAGAAATCAGATGAAAGGGGG + Intronic
907466631 1:54642072-54642094 GGGAGTGAAAAGATGCAGGGAGG + Intronic
907786827 1:57620714-57620736 GAGAGAACACAGATGCAGAGAGG + Intronic
907807135 1:57832226-57832248 AAGAGTAACTAGATGAAGAGAGG + Intronic
908123039 1:61003865-61003887 GAGAATGAAAAGATGAAGCGAGG - Intronic
908154307 1:61336685-61336707 GAGAGTAAAAAGATCAGTGGTGG - Intronic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909969199 1:81959269-81959291 GACAATAAACACATGAAAGGAGG - Intronic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
911091994 1:94024594-94024616 GAGAGTAAAAATTTGGAGGGAGG - Intronic
911215130 1:95184720-95184742 GAGAGGAAAGAGGGGAAGGGAGG - Intronic
912659695 1:111516467-111516489 GAGAGGAAACAGATGCTGGCTGG - Intronic
913665685 1:121046593-121046615 GAGATTCAACAGATGAACTGAGG + Intergenic
914017082 1:143829868-143829890 GAGATTCAACAGATGAACTGAGG + Intergenic
914160704 1:145131130-145131152 GAGATTCAACAGATGAACTGAGG - Intergenic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914432297 1:147629880-147629902 GAAAGTTAACAGCTGAAGTGGGG - Intronic
914655694 1:149738410-149738432 GAGATTCAACAGATGAACTGAGG + Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
918027587 1:180767391-180767413 GAGAATAAACTGTTGAAGGATGG + Intronic
919535548 1:198783125-198783147 GAGAGGAAGCAGCAGAAGGGGGG + Intergenic
919755295 1:201062585-201062607 GGGAGTGAACAGTGGAAGGGGGG + Intronic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920406030 1:205711905-205711927 GTGGATAAACAGATGAAGAGAGG - Intergenic
921005237 1:211086543-211086565 GAGAGAAAAAAGATAAAGGAGGG + Intronic
921200598 1:212801864-212801886 GAGAGAACAAAGATGAAGGAGGG - Intronic
921232192 1:213084149-213084171 GAGAGGAGACAGAGGAAGAGAGG - Intronic
921237203 1:213145206-213145228 GAGAGGAAACAAATGAAGTTAGG + Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921815129 1:219555023-219555045 GAGAGTTAACTGATGAGAGGTGG - Intergenic
921818688 1:219592423-219592445 GAGAGGAACCAGATGAAATGCGG - Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
923901816 1:238334477-238334499 GAGAGGAAACCATTGAAGGGAGG + Intergenic
924220789 1:241873319-241873341 GACAGTAATCAGATTAAGGCAGG - Intronic
924654915 1:245965693-245965715 GATAGTAAAAAGATCAATGGTGG + Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
1062963869 10:1592835-1592857 GAGAGGAAACCTATGGAGGGTGG - Intronic
1063136693 10:3223316-3223338 GAGGATGAAGAGATGAAGGGTGG - Intergenic
1064157873 10:12918702-12918724 GTGATTAAACAGATGGAAGGGGG + Intronic
1066129221 10:32374439-32374461 TAGAGAAAAGAGATGAAGAGAGG - Intronic
1067857161 10:49804423-49804445 GTGAGTAGACAGGTGAGGGGAGG - Intergenic
1068258873 10:54552192-54552214 GAGAGTACATTCATGAAGGGAGG - Intronic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1069468864 10:68668133-68668155 GAGAGAAAATAGATAAATGGAGG - Intronic
1071406394 10:85337595-85337617 GAGAGGAAAGAGATAAAGTGTGG - Intergenic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071785453 10:88894616-88894638 GAGAGAAAATAGATTAAAGGAGG + Intronic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1073060789 10:100732238-100732260 GGGAGTAAAGAGATCAAGGCAGG - Intergenic
1073074631 10:100816041-100816063 CAGAGGGAAGAGATGAAGGGAGG - Intronic
1073954098 10:108847969-108847991 GAAAGTGAAAAGATGGAGGGAGG + Intergenic
1073959602 10:108911706-108911728 GTGTGTAAACAGATGAAAGATGG - Intergenic
1074576883 10:114677921-114677943 GAGAGGAAACACATGAAAGTTGG + Intronic
1074586180 10:114769013-114769035 GAGAGTGCACAGAGGAAGAGAGG - Intergenic
1074967465 10:118504045-118504067 AAAAGTAAACAGAGGAAGGAAGG + Intergenic
1076242738 10:128922004-128922026 GTGATGAAACAGATGAAGAGAGG + Intergenic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078571870 11:12465551-12465573 GAGAGTAAAAAGATAAATGGGGG - Intronic
1078841500 11:15079786-15079808 GGGAATAAAGAGAAGAAGGGAGG + Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079964384 11:26963153-26963175 GAGAAAAAAGAGAGGAAGGGAGG + Intergenic
1080125873 11:28733011-28733033 GAGGGCCAAGAGATGAAGGGTGG - Intergenic
1081137617 11:39458670-39458692 GAAAGAAAAGAGAGGAAGGGAGG + Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081538328 11:44011842-44011864 GAGAGGAAAAAGAGGAAGAGAGG + Intergenic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1083427024 11:62593507-62593529 AAGAGTAAACAGATAACAGGTGG - Exonic
1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG + Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086743359 11:90395549-90395571 CAGAGTATACACATGAAGGGTGG - Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088388571 11:109288507-109288529 GAAAGAAAAAAGATGAAGGCTGG - Intergenic
1088563913 11:111147215-111147237 AAGAGTAAAGAGATCAAGGCTGG + Intergenic
1088596100 11:111441458-111441480 GAGAGTTGAAAGAAGAAGGGTGG - Intronic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1088973860 11:114797374-114797396 GAGAGAAAATAGAAGAAGGTGGG - Intergenic
1088974157 11:114799931-114799953 GAGAGAAAACGGATGAAGACGGG - Intergenic
1089749788 11:120642785-120642807 GACAGCAAACAGATGAGGTGAGG - Intronic
1089973234 11:122711163-122711185 GAGTGTATAAAGAGGAAGGGTGG - Intronic
1090208243 11:124897321-124897343 AAGAGAAGACAGATGAGGGGTGG - Intronic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1090969245 11:131625518-131625540 GAGACTGAAAAGATGAAGGAGGG + Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1093265160 12:16994650-16994672 GAGAGAAAAAAGAGGTAGGGTGG + Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1094555173 12:31492351-31492373 GAAAGAAAACACATGAAGGGTGG + Intronic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095378165 12:41556807-41556829 GAGAGCAAGCAGGTGAAGGCAGG - Intronic
1095571602 12:43689181-43689203 AAGAGTAAACACATTCAGGGTGG - Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095701686 12:45197009-45197031 GAGTGAAAAGAGATGAAGGCAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1097922434 12:65090622-65090644 GAGGTTAAACAGGTGAAGGAGGG + Intronic
1098482905 12:70986680-70986702 GAGAGAAAAGAGGTGAAGGGAGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099663995 12:85602484-85602506 GAGAGTAAAGGCAGGAAGGGAGG + Intergenic
1099815563 12:87642764-87642786 AAGAGTAAACAAATTAAGTGTGG - Intergenic
1099952952 12:89324335-89324357 GAGAGAAAGCAGATGAGGAGTGG - Intergenic
1099971904 12:89509174-89509196 ATGAGTAAACAGATAAATGGAGG - Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101606187 12:106248508-106248530 GAGAGGAGAGAAATGAAGGGGGG + Intronic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1105636903 13:22224404-22224426 GACAGTGACCAGATGCAGGGAGG + Intergenic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1106910990 13:34463636-34463658 GGTAGGAAACAGCTGAAGGGAGG - Intergenic
1107014903 13:35700486-35700508 GAGAGAGAACAGAGGAAGGCAGG + Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1107746363 13:43514557-43514579 GGGAGGAAACAGAGGAAGGCTGG - Intronic
1108415901 13:50198007-50198029 GAGAGAAAACAGCTGATGGCAGG - Intronic
1109484764 13:63004151-63004173 GAAAGTCAACAAATGAACGGTGG + Intergenic
1109692311 13:65909674-65909696 CAGAGTAAACAGATGATGCTTGG - Intergenic
1109838476 13:67890108-67890130 GTCAGCAAACAGATGAAGGTGGG + Intergenic
1110198616 13:72820978-72821000 GAGTGTAAACATCTTAAGGGTGG - Intronic
1110932719 13:81242805-81242827 GAGTGTCAAGAGAAGAAGGGAGG - Intergenic
1111409632 13:87857621-87857643 GAGACTAATCAGATTAAGGGTGG + Intergenic
1113243110 13:108362028-108362050 GAGAGGAAACAGGTGCAGGATGG + Intergenic
1114364252 14:22010066-22010088 GATAGAGAAGAGATGAAGGGAGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115029545 14:28778230-28778252 GTGCGTAAAAAGACGAAGGGAGG - Intronic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1117621577 14:57592749-57592771 AAGGGTAAACAGAGGAAGAGAGG - Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1117818235 14:59620306-59620328 GAGACTAAGTAGATTAAGGGCGG + Intronic
1117845423 14:59906567-59906589 GAGAGTAAGAATATGAAGGGAGG - Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118723268 14:68609049-68609071 GAGAAGGAACAGGTGAAGGGAGG - Intronic
1119948578 14:78720623-78720645 GAGAGTGGACAGATGCAGGATGG - Intronic
1119993647 14:79227849-79227871 GAGAAGAAAGAGAGGAAGGGAGG - Intronic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121715625 14:96071779-96071801 GAGTGTAGACAGCTGCAGGGAGG + Intronic
1121917906 14:97853123-97853145 GAGAGTGAAGTGAGGAAGGGAGG - Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122764608 14:104057763-104057785 GACAGTAAAAAGATGAGTGGTGG - Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1124036913 15:26062231-26062253 CAGAGACAATAGATGAAGGGAGG - Intergenic
1126468083 15:48979008-48979030 GAGCTTAAACATATGAATGGAGG + Intergenic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1128743705 15:70099415-70099437 GAGAATAAATAAATGAAGAGGGG - Intergenic
1128783261 15:70376728-70376750 GAAAGGAAAAGGATGAAGGGGGG - Intergenic
1129119538 15:73387696-73387718 GAAAGTAAACATGTGAAAGGAGG + Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131646267 15:94348444-94348466 GAGAGGAGAGAAATGAAGGGGGG - Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134846454 16:17444979-17445001 AAGAGTGAATGGATGAAGGGAGG + Intronic
1137004084 16:35255957-35255979 GCCAGAAAAGAGATGAAGGGTGG - Intergenic
1137421092 16:48334697-48334719 GAGGGCAAACAGCTGAAGGATGG - Intronic
1137655515 16:50154536-50154558 GAGAGTGAATGGATAAAGGGGGG - Intronic
1137828040 16:51516775-51516797 GAGAGAGAGCAGATGCAGGGTGG + Intergenic
1137977289 16:53042406-53042428 GAGGGGAAACAGAGGAAGAGAGG - Intergenic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1139020710 16:62745401-62745423 CAGAGTAGCCAGGTGAAGGGGGG + Intergenic
1139074468 16:63427268-63427290 GTGAATAAATAAATGAAGGGAGG + Intergenic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140160978 16:72494003-72494025 GAGAGGGGAGAGATGAAGGGAGG + Intergenic
1140798626 16:78464308-78464330 GAGAGGAAAGAGGGGAAGGGAGG + Intronic
1140903571 16:79392109-79392131 GAGAGGAAAGAGAAGAAGAGAGG + Intergenic
1141110261 16:81265979-81266001 GATAGTAGACAGATGGATGGTGG - Intronic
1141409146 16:83820746-83820768 GAGAGAGAAAAGAAGAAGGGAGG - Intergenic
1143305956 17:5946916-5946938 GAGCTTAAAAAGATGAAGTGGGG + Intronic
1144023879 17:11260778-11260800 GAGAGAAAACAGGTGGAGAGAGG - Intronic
1144212318 17:13025912-13025934 GAAAGGAAAAAGAGGAAGGGAGG - Intergenic
1145067079 17:19768854-19768876 TAAATTCAACAGATGAAGGGAGG - Intergenic
1145392656 17:22467835-22467857 GAGAGAGAACTGAAGAAGGGTGG - Intergenic
1147496613 17:40922444-40922466 GGGAGGAAACAGAGAAAGGGAGG - Intergenic
1148869697 17:50649606-50649628 GAGAGGAGAGAGATGAGGGGTGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150952251 17:69816646-69816668 GAGTGTAAACAAATCAAGGAAGG - Intergenic
1151458651 17:74241794-74241816 GAGAGTGGACAGAGGAGGGGCGG - Intronic
1155440551 18:25857430-25857452 GAGAATTAACAGATCAGGGGAGG - Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1155702963 18:28771015-28771037 GAGTGTAAATATATGAATGGTGG + Intergenic
1155878656 18:31117464-31117486 GAGAACAAAGAGAGGAAGGGAGG - Intergenic
1158470078 18:57728453-57728475 GAGGGCAAAGAGAGGAAGGGAGG + Intronic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164785176 19:30924894-30924916 AGCAGTAAACAGATGAGGGGTGG - Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166915355 19:46191806-46191828 AAGAGTAATCAAATGATGGGGGG - Intergenic
1167047769 19:47060884-47060906 GAAAGTAAAAGGAAGAAGGGTGG + Intergenic
1167123390 19:47532468-47532490 GAAGGAAAACAGAGGAAGGGAGG - Intronic
925656457 2:6155224-6155246 GAGAGGCAATAGATGAAGGGAGG + Intergenic
926188897 2:10712557-10712579 CAGAGAGCACAGATGAAGGGCGG + Intergenic
927191024 2:20516969-20516991 GAGAGTTAATAAATAAAGGGCGG + Intergenic
927408006 2:22794461-22794483 GGGGGTATAGAGATGAAGGGAGG - Intergenic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
928963664 2:36955560-36955582 GAGAAGAGACAGAAGAAGGGAGG - Intronic
929968396 2:46552526-46552548 GAGAATATTCAGATGAAGGAGGG - Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
931062660 2:58548407-58548429 GATAGTAAGGAAATGAAGGGAGG - Intergenic
931288005 2:60848877-60848899 GAGAGAAGACAAATGCAGGGCGG + Intergenic
931908439 2:66868512-66868534 GAGAGAAAAGAGATGGAGAGTGG + Intergenic
932115460 2:69042741-69042763 GCGAGCAAGCAGGTGAAGGGTGG - Intronic
932463575 2:71898681-71898703 AAGAGCAAAGAGATAAAGGGAGG - Intergenic
933601733 2:84339056-84339078 GAGAGTAGACAGCTGGAGGTAGG + Intergenic
933639662 2:84745970-84745992 TAGATTAGAGAGATGAAGGGGGG + Intronic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936907820 2:117557164-117557186 GGAAGTAAACAGATGATGGCAGG + Intergenic
936914042 2:117621672-117621694 GAAAGAAAACAGATGAAAGAAGG - Intergenic
937130880 2:119512172-119512194 GACAGCATAAAGATGAAGGGAGG - Intronic
937316102 2:120933026-120933048 GGGAGTAGACAGGAGAAGGGCGG + Intronic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
940016108 2:149106835-149106857 GAGAGTAAAAAAAAGAGGGGAGG - Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
941013238 2:160325204-160325226 AAGAGTAAGGAGATGAGGGGTGG + Intronic
942330510 2:174818693-174818715 TAGAATAAACATATGAAAGGAGG + Intronic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
944085129 2:195836973-195836995 GAGAGAAAAGAGATGGAGAGAGG - Intronic
944708791 2:202317220-202317242 GAGAGTAAACAGGTGGAAGCTGG - Intergenic
945038401 2:205723990-205724012 GAGGGTGTACAGGTGAAGGGGGG + Intronic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945605598 2:211926048-211926070 GACAAAAAACAGCTGAAGGGAGG + Intronic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
948038459 2:234879233-234879255 GAGAGGAGACAGGAGAAGGGTGG + Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
948865108 2:240771223-240771245 GAGAGAAAAAAGATGAAGATGGG + Intronic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1168957373 20:1843763-1843785 GAGAGTAGAGAGAGCAAGGGAGG + Intergenic
1169178186 20:3538106-3538128 GAGAGTAAATAGGTGGGGGGAGG - Intronic
1169795329 20:9456375-9456397 GATGGTAAAAAGATGAATGGGGG + Intronic
1169874549 20:10282599-10282621 AAGTGTAAACAGATGAGGGCTGG + Intronic
1171789110 20:29502209-29502231 GATAGCAAAAAGAAGAAGGGAGG + Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173099747 20:40074720-40074742 GAGATAAAACAGATTAAGGAGGG - Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173791452 20:45830438-45830460 GGAAGTAGACAGATGAAGAGAGG - Intronic
1173798899 20:45882314-45882336 GAGAGTAAGCTGGGGAAGGGAGG - Intronic
1173833888 20:46112594-46112616 AAGAGTCAGCAGATGAAAGGTGG + Intergenic
1173879240 20:46398786-46398808 GAAAGAAAAAAAATGAAGGGAGG + Intronic
1173959652 20:47061152-47061174 GAGAGTAAAGAGATGAAGTTGGG - Intronic
1174767329 20:53266248-53266270 AGGAGTAAAGAGATGAAGGAGGG + Intronic
1175075692 20:56370806-56370828 CATAGGAAACAGATGAAGCGAGG + Intronic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1177955153 21:27589218-27589240 GAGATTAAAGAGGTGAAGAGGGG - Intergenic
1178145877 21:29739300-29739322 GAGAGGAAACGGAATAAGGGAGG + Intronic
1178778756 21:35578899-35578921 GAGAGAAGAGAGAGGAAGGGAGG + Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183337046 22:37255874-37255896 GAAAGAAAAGAGAGGAAGGGAGG + Intergenic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
949346857 3:3084782-3084804 GTGAGAAAACAGATGCAGAGAGG - Intronic
951286901 3:20824338-20824360 GGGAGGAAACAGGTTAAGGGAGG - Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951840413 3:27027804-27027826 GAAGGCAAACAGATGCAGGGTGG + Intergenic
951850485 3:27134059-27134081 GAAAGAAAAGAGAGGAAGGGGGG + Intronic
952780857 3:37096487-37096509 GACAGGAAATAGATGAAGGGAGG + Intronic
953972014 3:47355362-47355384 GAGAGTAAAAAGATAAGGGAAGG + Intergenic
954808794 3:53235490-53235512 GAGAGGAAAGTGAGGAAGGGTGG + Intronic
955369132 3:58335907-58335929 GGGAGTGAAGAGATGGAGGGAGG - Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956069694 3:65434813-65434835 GAGACTACACAGTAGAAGGGTGG + Intronic
956693110 3:71895836-71895858 GAGAGTAGAGAGAAGATGGGTGG + Intergenic
957146591 3:76432834-76432856 GAGAGAAAAAAGAGGAAGGAAGG + Intronic
957414803 3:79887708-79887730 GAGAACAAACAGATGTAGGAAGG - Intergenic
957612816 3:82490374-82490396 GAGAGTATACATATGAAGCCTGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
958985352 3:100774345-100774367 CAGAGTAAACACATGTGGGGTGG + Intronic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
961934863 3:130572299-130572321 GATAGTAAAATGATGAAGGAAGG - Intronic
961955845 3:130803311-130803333 GGGAGGAAACAAAGGAAGGGAGG - Intergenic
962370681 3:134818521-134818543 GAGAGGGAAGAGTTGAAGGGGGG - Intronic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965120681 3:164551481-164551503 GGGGTTAAACAGATGAAGAGTGG + Intergenic
965473922 3:169130627-169130649 GATGCTAAAGAGATGAAGGGTGG + Intronic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
966210918 3:177452482-177452504 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
966483857 3:180445832-180445854 GAGAGGAAAGAGATAAGGGGTGG + Intergenic
967039052 3:185672683-185672705 TGGAGAAAAAAGATGAAGGGAGG + Intronic
967115557 3:186334346-186334368 GATTGTAAACTGATGGAGGGTGG + Intronic
968256654 3:197280119-197280141 GAGAGGGAAAAGATGAAGAGAGG - Intronic
969159151 4:5240036-5240058 GAGAGAAGAGAAATGAAGGGGGG - Intronic
969481452 4:7448983-7449005 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969481512 4:7449132-7449154 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969481519 4:7449157-7449179 GAGAGGGAAAAGAGGAAGGGAGG - Intronic
969499272 4:7543280-7543302 ATGAGTCAACAGATGAACGGAGG - Intronic
970964505 4:21912951-21912973 GAGAGTAAACTGAAGAAGACAGG + Intronic
972191580 4:36598540-36598562 GAAAGGAAACAGAAGAAGGTAGG + Intergenic
973321707 4:48817134-48817156 GAGAGTAAGCAGAAGCAGTGTGG + Intronic
974177477 4:58343280-58343302 GAGCATAAACAGATGTAAGGAGG + Intergenic
976790057 4:88868400-88868422 GAAAGTAAACAGATAAAAGCTGG - Intronic
978528017 4:109685749-109685771 GAAGGGAAAAAGATGAAGGGAGG - Intronic
978879543 4:113685065-113685087 GAGAGTAAACCAATGATAGGAGG + Intronic
978952216 4:114574373-114574395 GAGAGAAGAGAGAGGAAGGGAGG - Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980720137 4:136684927-136684949 GAGGGTAGACAGATGAGGTGAGG - Intergenic
981964933 4:150588830-150588852 GGGAGTAAACAGCTGGAGGGTGG + Intronic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
983057225 4:163112448-163112470 GAGAGGAAACACATGGATGGAGG + Intronic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988426421 5:31070669-31070691 GAGACTATACACATGAAGGAAGG + Intergenic
989604475 5:43230730-43230752 AAGAAAGAACAGATGAAGGGGGG + Intronic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991443870 5:66679554-66679576 GAGAGTATACAAATGAAGAAGGG - Intronic
992678182 5:79126763-79126785 GAGACCAAGCAGATGAAGTGAGG + Intronic
993421215 5:87702906-87702928 AAGAGTGAAAAGATGAAGGTTGG + Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
994168858 5:96637555-96637577 GACATTAAACAGATGAAGACTGG + Intronic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995484442 5:112625888-112625910 GAGAGTGAAGAGATGAATAGAGG - Intergenic
996538130 5:124600346-124600368 GAGAATAAAAATGTGAAGGGTGG + Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
997010033 5:129865808-129865830 GGGAGAAAAGAGATGGAGGGAGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997352915 5:133243882-133243904 GACAGTTATGAGATGAAGGGTGG + Intronic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999830228 5:155311881-155311903 CAGAGGAAACATATGAATGGTGG + Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000287586 5:159840110-159840132 GAGAGTCAAGAGATGGAGAGGGG - Intergenic
1000439562 5:161249662-161249684 GAGAGTAGAGACATGGAGGGAGG - Intergenic
1001273065 5:170330309-170330331 GAGAGGACAGAGATGAAGGCAGG + Intergenic
1001278310 5:170366862-170366884 GAGAGTGCAGAGATGAAGGGAGG - Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1002397589 5:178970195-178970217 GAGAGGAATCAGATAAGGGGAGG - Intergenic
1003694551 6:8390417-8390439 GATAGTAAAAAGATGAGGGTGGG - Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1006284477 6:33082008-33082030 AAGAGGAAAAAAATGAAGGGAGG + Intronic
1007065657 6:38987955-38987977 GAGATCAAACAGGTGAAGGCAGG - Intronic
1007800274 6:44386503-44386525 GTGGGTAAACAGCTCAAGGGCGG + Intergenic
1008213572 6:48756662-48756684 GAGAAAAAACAGTTGAAGAGTGG - Intergenic
1008766095 6:54916751-54916773 GATAGTACACAGATGAATGTGGG + Intronic
1008853722 6:56055755-56055777 TAGATGAAGCAGATGAAGGGAGG + Intergenic
1009536589 6:64896279-64896301 GAGGGCAAGCAGATGCAGGGTGG + Intronic
1009564427 6:65293979-65294001 GAGAGAAAGCAAATGGAGGGGGG + Intronic
1009566994 6:65322222-65322244 GAGAGGAACCAGATGAAATGAGG + Intronic
1010439408 6:75875965-75875987 GAGTGTAAACAAATGAAGCTAGG - Intronic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1011763623 6:90594900-90594922 GAGGATAAAGAGATGATGGGAGG + Intergenic
1012805479 6:103887366-103887388 GAGATTAAACACCTGAAGGAAGG + Intergenic
1013209379 6:107973145-107973167 GAGAGAAAAGAGAAAAAGGGGGG + Intergenic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1014020719 6:116585557-116585579 TAGAGTAAACAAATAAAGGTAGG - Intronic
1014804741 6:125816562-125816584 GAGAGTAACCAGATTAGGGAAGG + Intronic
1015219478 6:130787829-130787851 GAGAGTAACCAGGGGAAGGGAGG - Intergenic
1016657306 6:146535968-146535990 TAAAGTAAACAGATCAATGGCGG + Intergenic
1016842600 6:148539356-148539378 GAGAGTCAGAAGAGGAAGGGTGG - Intronic
1019671386 7:2281661-2281683 GAGAGAAAACAGATGAGATGAGG + Intronic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020399138 7:7755114-7755136 GTGAGAAAACAGATCAAGGCAGG - Intronic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020848423 7:13317279-13317301 TGAAGTAAACAGAGGAAGGGAGG + Intergenic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1021972939 7:25983320-25983342 GAGAGAAAACAGAAAAAGTGTGG + Intergenic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1023488830 7:40715543-40715565 GATAGAAAACACATGAGGGGGGG - Intronic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1025488117 7:61077267-61077289 GAAAATAAACAGGTGAAGGAAGG - Intergenic
1026217801 7:68365040-68365062 GAGAGCCAAGAGATGGAGGGAGG + Intergenic
1028462621 7:91112870-91112892 GAGAGAGAACAGGGGAAGGGGGG + Intronic
1028605972 7:92656156-92656178 AAGAGAAAGAAGATGAAGGGAGG + Intronic
1030715821 7:112805672-112805694 GAGAGCAAACAAAGGAAGAGAGG - Intergenic
1030907039 7:115198639-115198661 GAGAGTAAAGAAATTAAGAGGGG - Intergenic
1031472206 7:122180397-122180419 GGGAGTAAAGAGATGAAGAGAGG - Intergenic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032275565 7:130452341-130452363 GAAGGTAACCAGATGAAGAGTGG - Intergenic
1032957674 7:136990399-136990421 GACAGTAAAAAGATCAATGGTGG - Intronic
1033812899 7:145037705-145037727 GAGACTAAGCAAATGAAGAGGGG + Intergenic
1033933447 7:146552718-146552740 GAGTCAAAACAGATGAAGGCAGG - Intronic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034571425 7:151959598-151959620 CAGAGGATACAGATTAAGGGAGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036215667 8:6877825-6877847 GAGAGTAAACAGCAGAAGGTAGG + Exonic
1036546260 8:9772036-9772058 GAGAGGAGACAGAGGTAGGGAGG + Intronic
1038040585 8:23720806-23720828 GAGAGAAAAGGGAGGAAGGGAGG - Intergenic
1038214902 8:25552714-25552736 GAGAGGAAATAGATCAATGGAGG + Intergenic
1038590403 8:28832200-28832222 GAGAGAAAAGAAAAGAAGGGAGG + Intronic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1039051742 8:33501424-33501446 GAGAGTGAATAAATGTAGGGAGG - Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1042468457 8:69155995-69156017 GAGAGTAAATTCATAAAGGGAGG + Intergenic
1043075256 8:75690744-75690766 GAGAGTACAGAGATGGAGGAGGG - Intergenic
1043088218 8:75864606-75864628 AAGAGTAAATAGATGTAGGCTGG + Intergenic
1043852418 8:85229812-85229834 GAAAGAAAAAAGAGGAAGGGAGG + Intronic
1045829101 8:106436671-106436693 TACAGTAAAGAGATGAAGAGAGG - Intronic
1046138423 8:110060802-110060824 GAGAGAAAACAGTTGAAGTCTGG - Intergenic
1046308047 8:112396830-112396852 AAGAGTAAACGGTTGATGGGTGG + Intronic
1046740253 8:117820117-117820139 GAGAGACAGCACATGAAGGGTGG - Intronic
1046839244 8:118839125-118839147 GAGAGACTAGAGATGAAGGGAGG + Intergenic
1047549061 8:125850070-125850092 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1049349033 8:142154273-142154295 GAAAGTAAATAAAGGAAGGGAGG - Intergenic
1049391333 8:142373139-142373161 GAGAAGAAAGAGAGGAAGGGAGG + Intronic
1051223866 9:14878396-14878418 GAGAGTAGAGAGGTGGAGGGAGG - Intronic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051726499 9:20092091-20092113 GAGAGTGAACAGTGGAAGGAGGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052193867 9:25688849-25688871 GAGAGTAAAGAGGTGAAGTGTGG - Intergenic
1056897880 9:90567691-90567713 GTGAGTATACTGATGAATGGAGG - Intergenic
1057788260 9:98104831-98104853 GAGAGTGAGGAGATGAAAGGAGG + Intronic
1057925127 9:99139817-99139839 AGGAGAAAAAAGATGAAGGGGGG - Intronic
1058989747 9:110243364-110243386 GTGAGGAAACAGACAAAGGGTGG - Intergenic
1060720863 9:125976387-125976409 TTGAATAAATAGATGAAGGGAGG + Intergenic
1060816754 9:126639152-126639174 GAGAGGAAAGAGAGGAGGGGAGG + Intronic
1060938934 9:127532305-127532327 AAAAGTAAAAAGATGGAGGGGGG + Intronic
1061290668 9:129648954-129648976 GACAGTAAACAGAATAAGGGAGG - Intergenic
1061308911 9:129749693-129749715 GACATTAACCAGATGAAGGGAGG + Intronic
1061381586 9:130261905-130261927 GAGAGTAAAAATACTAAGGGTGG - Intergenic
1061584495 9:131557129-131557151 GAGAGTAGAGAGATAATGGGTGG - Intergenic
1185610954 X:1393259-1393281 AAGAAAAAACAGAGGAAGGGCGG - Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186534212 X:10330091-10330113 GGGAGTACCCAGATGAGGGGGGG + Intergenic
1187269765 X:17769128-17769150 AAGATTCAACAGATGCAGGGAGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187638467 X:21260456-21260478 GAAAGGAAACGTATGAAGGGTGG + Intergenic
1187839463 X:23471863-23471885 TAAAGTAAATAGAGGAAGGGAGG - Intergenic
1187997767 X:24946973-24946995 GAAAGTAGACAGATTAAGGTGGG - Intronic
1188179925 X:27042276-27042298 AAAAGTAAAGAGATGAAGGAAGG - Intergenic
1189281556 X:39822628-39822650 GAAAGTAAGCAGATGAAGGAAGG - Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190988974 X:55526235-55526257 GAGAGAAAACAGGTTAAGTGGGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1192754094 X:74027843-74027865 GAGAATAAAAAAATGAAGGAAGG + Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1194966956 X:100299033-100299055 GAGAGTAAGCAGTTGCAGGTGGG + Intronic
1195307611 X:103600710-103600732 GAAAATAAAAAGATGAAGGCAGG - Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1196570169 X:117256816-117256838 TTGAGTAAAAAGATGAATGGTGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1199035914 X:143050792-143050814 GAGAGTGAACATAAGCAGGGTGG - Intergenic
1199153341 X:144516491-144516513 GAGTGTAGACAGTTGCAGGGAGG - Intergenic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201532035 Y:15002002-15002024 GAGAGAAAACAGAGAAAGAGAGG + Intergenic
1201936933 Y:19419783-19419805 GAGAGTAGAGACATGGAGGGAGG - Intergenic