ID: 915271638

View in Genome Browser
Species Human (GRCh38)
Location 1:154757829-154757851
Sequence TCCCTTGAGTATCCAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915271638_915271641 15 Left 915271638 1:154757829-154757851 CCTGACTTTGGATACTCAAGGGA 0: 1
1: 0
2: 0
3: 9
4: 107
Right 915271641 1:154757867-154757889 GAAATACCTGGCTGCTTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 143
915271638_915271642 16 Left 915271638 1:154757829-154757851 CCTGACTTTGGATACTCAAGGGA 0: 1
1: 0
2: 0
3: 9
4: 107
Right 915271642 1:154757868-154757890 AAATACCTGGCTGCTTCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 137
915271638_915271640 3 Left 915271638 1:154757829-154757851 CCTGACTTTGGATACTCAAGGGA 0: 1
1: 0
2: 0
3: 9
4: 107
Right 915271640 1:154757855-154757877 TCAGTAGAAAAAGAAATACCTGG 0: 1
1: 0
2: 2
3: 42
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915271638 Original CRISPR TCCCTTGAGTATCCAAAGTC AGG (reversed) Intronic
902663820 1:17923705-17923727 TCCCTTGAGTGGCAAAAGCCAGG + Intergenic
909441755 1:75703774-75703796 TCCTTTGAGTAGACAAGGTCTGG - Intergenic
915271638 1:154757829-154757851 TCCCTTGAGTATCCAAAGTCAGG - Intronic
917556807 1:176098874-176098896 TCCCTGGAGTATCCAAATGAGGG + Intronic
918184827 1:182117597-182117619 TCCCTGAAGTATCTAAACTCAGG - Intergenic
1067762489 10:49058696-49058718 TCCCTTGAGTCTCCAGGTTCTGG + Intronic
1070609439 10:77923309-77923331 TTCCTTGAGGAGCCATAGTCAGG - Intronic
1070718696 10:78741363-78741385 TCCCTTGAGGATCTAGAGTCAGG + Intergenic
1073706154 10:105986831-105986853 TCCCTTGAAGATCCTAAGTGTGG + Intergenic
1074261911 10:111862580-111862602 TCCTTTGCATATCCCAAGTCTGG - Intergenic
1077668196 11:4134608-4134630 TCCCTTTGGAATCCAAAATCAGG - Intronic
1085722308 11:78923351-78923373 TCCCTTGAGTAACAACAGTGTGG + Intronic
1089284224 11:117395345-117395367 TCCCTTGAGGTTCCCAAGTGGGG - Intronic
1092565323 12:9659257-9659279 TCCCTGGAGCATCCCTAGTCAGG - Intergenic
1094239645 12:28207424-28207446 CCCCTTCAGAATCCAAAGACTGG - Intronic
1098740460 12:74167681-74167703 TCCCCTGAGTCTCCAAATTGTGG - Intergenic
1098785726 12:74751927-74751949 TCCTTTGAATCTTCAAAGTCAGG - Intergenic
1100708288 12:97226095-97226117 AGGCTTGAGTATCCTAAGTCAGG + Intergenic
1101476354 12:105052502-105052524 TGCCATGAGTCTTCAAAGTCTGG + Intronic
1103896207 12:124274869-124274891 TCTCTTGAGCATCAAAAGTTGGG - Intronic
1106770070 13:32953146-32953168 CCCCCTGAGTCCCCAAAGTCTGG + Intergenic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1108967316 13:56325965-56325987 TCCATTGAGTTTCCAATGTCTGG - Intergenic
1111729004 13:92049348-92049370 TTCCTTGAATCCCCAAAGTCAGG + Intronic
1113169723 13:107486796-107486818 TCCCTTCAATATCCAAAAGCAGG - Intronic
1113499524 13:110762088-110762110 TGCCTTGAGTCTCCTAAGTCAGG + Intergenic
1114292770 14:21302282-21302304 TCACTTGAGGATCTATAGTCTGG + Intronic
1123961974 15:25412419-25412441 ACCCTTGAGTCTCCAATGTCAGG + Intronic
1124926047 15:34071595-34071617 TTCCATGTGTATCCAAAGACAGG + Intergenic
1126666578 15:51080946-51080968 TGCCTTGAGAATTCAAAGGCAGG + Intronic
1127805429 15:62515391-62515413 TCTTTGGAGTAGCCAAAGTCTGG - Intronic
1129785766 15:78309110-78309132 TCCTTTGAGTATCCCCAGCCTGG - Intergenic
1138616251 16:58169556-58169578 TCCAGTGAGGTTCCAAAGTCTGG - Intronic
1141225988 16:82115266-82115288 TCCCCTGAGTCCCTAAAGTCCGG + Intergenic
1141958091 16:87385608-87385630 ACCTTTGATCATCCAAAGTCTGG - Intronic
1145797550 17:27664545-27664567 TGCCCTGAGGACCCAAAGTCTGG - Intergenic
1147215399 17:38896225-38896247 TGTCTTGATTATCCATAGTCAGG + Intronic
1149306041 17:55347424-55347446 TTCCTTGAGAACCCTAAGTCTGG + Intergenic
1149367295 17:55958712-55958734 GCTTTTGAGTTTCCAAAGTCTGG + Intergenic
1152129886 17:78469859-78469881 TCCCTAAAGTAGTCAAAGTCAGG + Intronic
1159663987 18:71134525-71134547 GCCCTTGAGTATCAAGACTCTGG + Intergenic
1166364457 19:42271566-42271588 TCCCCTGAGTATACACACTCTGG - Intronic
925529637 2:4845078-4845100 TTCCTTGAGTATTGAATGTCGGG - Intergenic
934650224 2:96086278-96086300 GCCCTTGAGGAGCCACAGTCTGG + Intergenic
934890028 2:98059304-98059326 TTCCTTGAGTATCCAAACCAGGG - Intergenic
935042395 2:99445776-99445798 TCCCTTGCCTCTTCAAAGTCAGG + Intronic
936055003 2:109256091-109256113 TCCCATGAGCCTGCAAAGTCTGG + Intronic
936731367 2:115385189-115385211 TCCCTTGAGGATCCTCATTCCGG + Intronic
937976212 2:127583523-127583545 TCCCATCAGTTGCCAAAGTCTGG - Intronic
1170314993 20:15031991-15032013 ACTCGTGAGTACCCAAAGTCCGG + Intronic
1171383977 20:24754839-24754861 TGCCTGGAGTATCCTAGGTCAGG + Intergenic
1172047369 20:32090017-32090039 TCATTTGAGTATGCAAATTCAGG + Intronic
1173407969 20:42783758-42783780 GCCCTTGAGGAATCAAAGTCAGG + Intronic
1175489384 20:59369173-59369195 TCACTTGATGATCCATAGTCAGG + Intergenic
1178779348 21:35586837-35586859 TCCCTGGAGTATCTGAAGTCAGG - Intronic
1179783771 21:43718679-43718701 TCCCTTGGGTATCCGGGGTCCGG + Intergenic
1183072839 22:35408352-35408374 TACCTGGAGAATCCAAAGGCAGG - Intronic
1184932787 22:47693554-47693576 TGGTTTGATTATCCAAAGTCAGG + Intergenic
1185118262 22:48950310-48950332 TCCCTTGAGACTCAAAAGACAGG + Intergenic
949176496 3:1069400-1069422 TCTCTTGGGTTTTCAAAGTCAGG + Intergenic
950462329 3:13132776-13132798 TCCGTTCAGTATTCAAAATCAGG - Intergenic
950857876 3:16122269-16122291 TCTATTTAGTATCCAAACTCTGG + Intergenic
950929153 3:16771778-16771800 TCCCTTGAGCCCCCCAAGTCAGG + Intergenic
951225777 3:20119651-20119673 TCCCTTGAGCAGCCAAACGCAGG + Exonic
954199686 3:49016900-49016922 TCCCTTGAGGAGCCCAAATCTGG + Intronic
956669079 3:71669641-71669663 TCCCTTGTGTTACCAGAGTCTGG - Intergenic
959323045 3:104903901-104903923 TCCCCTGTGTATCTAAAATCTGG - Intergenic
960487613 3:118272264-118272286 TCACTTGAGAATTCAATGTCTGG + Intergenic
963586163 3:147192050-147192072 TCCCATCAGTACCCCAAGTCAGG + Intergenic
966596376 3:181727472-181727494 TCTCTTAAGTACCCACAGTCGGG - Intergenic
966951994 3:184828887-184828909 TCCCTTTAGTACCCAAACCCAGG + Intronic
970923055 4:21417629-21417651 TCCCTTGAGTAACAAACATCGGG - Intronic
971198020 4:24487702-24487724 TCCCTTGATTCTCCAAAGGCAGG + Intergenic
972762280 4:42118716-42118738 TCCCTTGAGTACACACAGACAGG + Intronic
976606730 4:86990520-86990542 TCCCTGGAGTACCCCAAGTGTGG + Intronic
984239052 4:177195340-177195362 TCCCTAGAGTATTCTAAGTTAGG + Intergenic
987729275 5:21747515-21747537 TTCCTTTAGTAACCAAACTCAGG + Intergenic
988517333 5:31916367-31916389 GCCCTTGCGTACCCACAGTCAGG + Intronic
990446662 5:55899508-55899530 TGCCTGGAGTATCCAAAGGTTGG - Intronic
990977125 5:61569950-61569972 TCCTTTGAGTCTCCAAGCTCAGG + Intergenic
994260013 5:97646448-97646470 AACCTTGAATATCAAAAGTCTGG + Intergenic
1000893192 5:166824226-166824248 TCACTTGACTTCCCAAAGTCTGG - Intergenic
1006163517 6:32051192-32051214 TCCCCTGAGTATCCACAGGTAGG + Intronic
1006271004 6:32967784-32967806 TCCCTTGATTACCCAGAGTATGG - Intronic
1007214738 6:40228279-40228301 GCTCTTCAGTGTCCAAAGTCCGG - Intergenic
1014161549 6:118175392-118175414 TCCTTTGAATATGCAAATTCAGG + Intronic
1014326655 6:120005114-120005136 TGCCTTGAGTAGCCAGAGGCAGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1015181101 6:130363985-130364007 TCCCTTGAGCACTCAAGGTCAGG + Intronic
1026018871 7:66693213-66693235 TCCCTTGAGTGTCCAGAGCCGGG + Intronic
1026881534 7:73909464-73909486 TCCCTTGAGTGTCCAGAGCAGGG - Intergenic
1027411371 7:77922613-77922635 TCCTTTGGGTATCCTAAGTTGGG - Exonic
1028462767 7:91114869-91114891 TTCCCTAAGTCTCCAAAGTCTGG - Intronic
1038499428 8:28031130-28031152 TCCCTGGAGTATCCAGGGTCTGG - Intronic
1043276580 8:78403842-78403864 TTCCTTGAGTACCCAAGGTAAGG + Intergenic
1043371549 8:79599691-79599713 TCCCTTCAGTATCAGAAGTGTGG - Intergenic
1043460704 8:80457183-80457205 TCATTTAAGTTTCCAAAGTCTGG + Intergenic
1044230019 8:89763509-89763531 TCCCTTGAGTAAACAAATTCAGG + Intronic
1046183917 8:110688812-110688834 TCCAGTCAGTATCCAAAATCTGG + Intergenic
1047435148 8:124829911-124829933 TCCCATTAGCATCCAAACTCAGG - Intergenic
1048875172 8:138831520-138831542 TTCCTTGAATCCCCAAAGTCAGG - Intronic
1050000662 9:1073971-1073993 TCCCATTAGGATTCAAAGTCAGG - Intergenic
1051727464 9:20102899-20102921 TCCCTTGAGCTTCCAGAGTGAGG - Intergenic
1055416985 9:76094184-76094206 TTCCTTGAGGATTCAAGGTCAGG + Intronic
1060675840 9:125513824-125513846 TCCCTCGTGTGTCCAAAGTAGGG + Intronic
1186023370 X:5281894-5281916 TCCCTGGAGTCGCCAAATTCAGG + Intergenic
1186165056 X:6819085-6819107 TCACTTGAGTATTAAAATTCTGG - Intergenic
1186516691 X:10171558-10171580 TTCCTAGAGTTTCCAAAGTGTGG - Intronic
1186591706 X:10937018-10937040 TCCATTAAGTATCCACATTCTGG - Intergenic
1188812230 X:34664748-34664770 TCTCTTGAGTTTCCAAAAGCTGG + Intergenic
1189716801 X:43875429-43875451 TTCCTTGAATATTCAAAATCAGG + Intronic
1190992543 X:55566775-55566797 TGCCTTGACTCTCCAGAGTCAGG - Intergenic
1191008712 X:55738753-55738775 TCCCCTGAGTATCATAAGCCAGG - Intronic
1192928608 X:75781898-75781920 GCCGTTTTGTATCCAAAGTCTGG - Intergenic
1198872979 X:141194997-141195019 TCTCTTCAGTCTCCACAGTCTGG + Intergenic
1201553060 Y:15239055-15239077 TCAATTAAATATCCAAAGTCAGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic