ID: 915271755

View in Genome Browser
Species Human (GRCh38)
Location 1:154758616-154758638
Sequence CCCACTGCACAGAGAGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915271755_915271766 16 Left 915271755 1:154758616-154758638 CCTTAAACTCTCTGTGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 915271766 1:154758655-154758677 AGACCGAATGGAACGAGGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
915271755_915271762 11 Left 915271755 1:154758616-154758638 CCTTAAACTCTCTGTGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 915271762 1:154758650-154758672 CATCCAGACCGAATGGAACGAGG 0: 1
1: 0
2: 1
3: 0
4: 38
915271755_915271765 15 Left 915271755 1:154758616-154758638 CCTTAAACTCTCTGTGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 915271765 1:154758654-154758676 CAGACCGAATGGAACGAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 149
915271755_915271768 25 Left 915271755 1:154758616-154758638 CCTTAAACTCTCTGTGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 915271768 1:154758664-154758686 GGAACGAGGTGGGGTACTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 94
915271755_915271764 14 Left 915271755 1:154758616-154758638 CCTTAAACTCTCTGTGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 915271764 1:154758653-154758675 CCAGACCGAATGGAACGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 43
915271755_915271761 4 Left 915271755 1:154758616-154758638 CCTTAAACTCTCTGTGCAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 915271761 1:154758643-154758665 AAGCAGGCATCCAGACCGAATGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915271755 Original CRISPR CCCACTGCACAGAGAGTTTA AGG (reversed) Intronic
903266459 1:22160887-22160909 CCCCCCAGACAGAGAGTTTAGGG - Intergenic
903570175 1:24298385-24298407 CCCACTACACAGAGTGGTTAAGG + Intergenic
903966575 1:27094348-27094370 CCCACTGAACACAAAATTTAGGG - Intergenic
904200071 1:28813737-28813759 CCCACAGCCCAGAGAGGTTTAGG - Intronic
904827978 1:33287813-33287835 CACACTGTACAGGGATTTTATGG - Intronic
905644028 1:39611984-39612006 GCCACTGCACAGTGACTTGATGG - Intergenic
906300875 1:44680772-44680794 CCAACTTCACAGAGAATATAGGG - Intronic
907644987 1:56233276-56233298 ACCAATGCACAGAGAGATTAGGG - Intergenic
909600786 1:77459005-77459027 CTCACTGCACAGGGAGTTGGTGG + Intronic
911261785 1:95694921-95694943 CTCACTGGGCAGAGAGTTTCAGG + Intergenic
912369258 1:109160988-109161010 CCCATTGCACAGACAAATTAGGG + Intronic
913245405 1:116866110-116866132 TCCACTGCACAGAGACATGACGG - Intergenic
915271755 1:154758616-154758638 CCCACTGCACAGAGAGTTTAAGG - Intronic
916783098 1:168057656-168057678 CCCACTGAACTGAGAGCTCAAGG - Intronic
918384982 1:183996657-183996679 GCCACTGCACTGAGGTTTTAAGG - Intronic
919933705 1:202237623-202237645 CCCACTTCCCAGAAAGTGTAGGG - Intronic
922094830 1:222434438-222434460 CCCACTGCAAGGTGAGTGTATGG - Intergenic
922238299 1:223737664-223737686 CTCATTCCACAGAGAATTTAAGG + Intronic
1065850088 10:29780602-29780624 GCCACAGCACAGAGAGGTGAGGG - Intergenic
1068072197 10:52209148-52209170 CTCACTGCAGAAAAAGTTTATGG - Intronic
1072747181 10:97949002-97949024 CCCACAGCACATGGAGATTATGG + Intronic
1073085077 10:100883165-100883187 CCCACTGCCCAGTGAGCTTGGGG - Intergenic
1076355658 10:129850940-129850962 CCCTCCGCACGCAGAGTTTACGG + Intronic
1079230774 11:18646884-18646906 GCCACTGCACAGAGACATGATGG - Intergenic
1080802654 11:35621941-35621963 CTTACACCACAGAGAGTTTATGG - Intergenic
1082632306 11:55557133-55557155 CCAACTGCAGTGAGAGTCTAAGG + Intergenic
1082635294 11:55586428-55586450 CCAACTGCAGTGAGAGTCTAAGG + Intergenic
1084613035 11:70216203-70216225 GCCACTGCACAGAGACATGATGG + Intergenic
1087791094 11:102406976-102406998 CCCACTGCACCAAGAGCTGAAGG + Intronic
1088226501 11:107626234-107626256 CCCTCTGCTCAGGGGGTTTATGG - Intronic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1091769545 12:3142095-3142117 ACCAAGGCACAGAGAGGTTAAGG + Intronic
1098920169 12:76295460-76295482 GCCACTGCACAGAGACATGATGG - Intergenic
1100277130 12:93081639-93081661 ATCACTGCACAGTGTGTTTACGG - Intergenic
1100402451 12:94244399-94244421 CCCATTGCACAGAGAGAGTTGGG + Intronic
1101679329 12:106949490-106949512 CCCACAACACATAGAGATTATGG + Intergenic
1103251314 12:119502341-119502363 CCTACTTCACAGAAAGTGTAAGG + Intronic
1104027540 12:125039236-125039258 TGCACTGCACAGAGAGTGCAAGG + Intergenic
1107996509 13:45866107-45866129 CTGACTTCACAGAGGGTTTATGG - Intergenic
1109089581 13:58023800-58023822 CCACATGCATAGAGAGTTTAAGG + Intergenic
1109160734 13:58970624-58970646 CCCACTGGAAAGAGTGATTAAGG - Intergenic
1111908386 13:94282470-94282492 CCCACAACACATGGAGTTTATGG + Intronic
1112529246 13:100184400-100184422 CCTACTTAACAGAGAATTTATGG - Intronic
1113443899 13:110350984-110351006 GACACTGGACAGAGAGTTTGAGG - Intronic
1118541584 14:66833401-66833423 CCCATTACACATAGAGATTATGG + Intronic
1118640499 14:67787983-67788005 CACATTGTACAAAGAGTTTAGGG - Intronic
1119901506 14:78264387-78264409 CCCACTGCACATACAGCTTAAGG - Intronic
1121942136 14:98081294-98081316 CCCACTACAGAGAGAGGTTTTGG - Intergenic
1121957417 14:98226862-98226884 GACACTGCACTGAGAGTCTATGG + Intergenic
1122187816 14:100015171-100015193 GCCAATAAACAGAGAGTTTAAGG - Intronic
1124154287 15:27211671-27211693 CACACTGCACAGAATGCTTAGGG - Intronic
1124840414 15:33236151-33236173 GCAAAGGCACAGAGAGTTTAAGG + Intergenic
1125600734 15:40914646-40914668 CCCACGGCACAGAGAGGTTTGGG + Intergenic
1127573198 15:60264234-60264256 CCCACTGAACAGGGTGTGTAGGG - Intergenic
1129144388 15:73633582-73633604 CCCACTGCCCAGAGAGCTAGCGG - Intronic
1130060720 15:80567947-80567969 CCCTCAGCACAGAGCATTTAAGG - Intronic
1132456896 16:29078-29100 CCCACTTCTCAGAGAGGTCAGGG + Intergenic
1133398364 16:5466249-5466271 CCCACTGCACAGACACTGTATGG - Intergenic
1133848106 16:9476102-9476124 CCCAAAGCTCAGAGAGTTTTAGG + Intergenic
1134272866 16:12749243-12749265 GCCACTGCATTGTGAGTTTATGG + Intronic
1140851866 16:78942502-78942524 CCCACTGCCCAGAGAGCTACGGG - Intronic
1147952934 17:44117151-44117173 CAGACTGCCCAGAGAGATTAAGG + Intronic
1148790503 17:50170124-50170146 CCACCTGCACAGAGAGCTCAGGG - Exonic
1149657137 17:58316204-58316226 CCCACTGCACTGAGCCTTTACGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151682670 17:75630048-75630070 CCCACCCCAGAGACAGTTTATGG - Intronic
1152982959 18:296262-296284 CCCACTGGGCAAAGAGCTTATGG + Intergenic
1156117352 18:33802018-33802040 CCCACAACACATAGAGATTATGG + Intergenic
1159990116 18:74896510-74896532 AGCACTGCACAGACAGTTCAGGG - Intronic
1164502256 19:28829894-28829916 GCAACTGCACAGTGAGTTGAGGG - Intergenic
1166355127 19:42222692-42222714 CTCACTGGACTGAGAGTTTGTGG - Intronic
1167521687 19:49959357-49959379 CACACTGCACAGAGAGGTCCAGG + Exonic
1167523696 19:49971365-49971387 CACACTGCACAGAGAGGTCCAGG - Intergenic
1167715141 19:51138197-51138219 CCCTCTGCACAGAGAGGCTCAGG - Intergenic
1167756372 19:51415895-51415917 CACACTGCACAGAGAGGTCCAGG + Exonic
925328194 2:3038907-3038929 ACCAGGGCACAGAGGGTTTAGGG + Intergenic
925538392 2:4940466-4940488 CCTGCTGCACAGAGAGTTTGTGG - Intergenic
925780627 2:7378558-7378580 CCAGCTGCACAAAGAGTTGAGGG - Intergenic
928043154 2:27898903-27898925 CACACTTCACAGTGATTTTATGG + Intronic
928370038 2:30734046-30734068 CTCTCTTCACAGAGAGTTTGGGG - Intronic
928969349 2:37011085-37011107 CCCAGTGCACAGACAGTGTCTGG + Intronic
931400449 2:61926488-61926510 CCCTTTGCACAGTGAGTTTGGGG - Intronic
931625991 2:64256116-64256138 GCCACTGCACACAGACTTGAGGG - Intergenic
932159180 2:69445354-69445376 GCCACTGCACAGAGACATGATGG + Intergenic
932296093 2:70624455-70624477 GCCACTGCACGGAGACATTATGG - Intronic
933821328 2:86114969-86114991 CCCAGTGCCCAGAGTTTTTAGGG + Intronic
936490170 2:112963270-112963292 CCCTCTGCACACAGTGTGTATGG + Intergenic
937467984 2:122151737-122151759 CCCACTGCACATTGGGATTATGG - Intergenic
940282727 2:152004278-152004300 CCCACTGCCCTGAGAGGTTCAGG + Intronic
942620790 2:177843379-177843401 TCCACATCAGAGAGAGTTTAAGG + Intronic
946619995 2:221550811-221550833 ACAAATGCAAAGAGAGTTTATGG + Intronic
1169787306 20:9373128-9373150 GCCACTGCACACAGACTTTATGG - Intronic
1170851376 20:20007811-20007833 CTCATTGAACAGATAGTTTAGGG + Intergenic
1171783300 20:29440818-29440840 TCCTCAGCACAGACAGTTTATGG + Intergenic
1172143743 20:32742620-32742642 CCCACTGTACACAGTGTATAAGG + Intronic
1173182313 20:40814586-40814608 ACCAAGGCACAGAGAGGTTAAGG - Intergenic
1175798531 20:61787504-61787526 CCCACAACACAGAGGGATTATGG + Intronic
1176126683 20:63478671-63478693 CCCACTGCACAGAGCGCACAAGG + Intergenic
1176250124 20:64116648-64116670 CCCACTGCACAGGGGGTCTTGGG + Intergenic
1176303856 21:5113425-5113447 CCCACTGCACTGGGAGTGTCAGG - Intergenic
1177628469 21:23696843-23696865 CCCACTGAGCATAGAGTTCATGG - Intergenic
1179853174 21:44148525-44148547 CCCACTGCACTGGGAGTGTCAGG + Intergenic
1180024733 21:45154130-45154152 CCCACTGCAGAATGAGATTATGG - Intronic
1181685880 22:24527744-24527766 CCTGCAGCACAGAGAGTTCAAGG - Intronic
1182547998 22:31086641-31086663 ACCAAGACACAGAGAGTTTAAGG + Intronic
1182652391 22:31862674-31862696 CCCACTGCACTGGGAGGGTAAGG + Intronic
1182797638 22:33002885-33002907 CCCACAACACATAGAGATTATGG - Intronic
1182996149 22:34814260-34814282 CCCACTGAACAGAGGGATAAAGG - Intergenic
1183191908 22:36327021-36327043 CCCATTGCCAAGAGAGTTAATGG - Intronic
1184819498 22:46898911-46898933 CCCACTGCAGAGGGAGTGAAAGG - Intronic
950269311 3:11600981-11601003 CCAGCTGCCCAGAGAGTCTACGG - Intronic
950601699 3:14040904-14040926 CCCACTGTAGAGCGATTTTATGG - Intronic
952541121 3:34369437-34369459 CCCCCTGGACACAGAGTTCAGGG - Intergenic
955810213 3:62780028-62780050 CCCCTTGTACATAGAGTTTATGG + Intronic
957418707 3:79939805-79939827 CCCACTGCTAAGTGAGTTTAAGG + Intergenic
960968599 3:123123234-123123256 GCCACTGCAGAGGGAGTTTTAGG + Intronic
961293734 3:125867436-125867458 GCCACTGCACAGAGACATAATGG - Intergenic
961881262 3:130062897-130062919 GCCACTGCACAGAGACATGATGG - Intergenic
962178605 3:133181597-133181619 CCCATTGCAAAGAGATTTTCAGG + Intronic
965023343 3:163264321-163264343 CCCACTACACATAGAGATTATGG + Intergenic
965042758 3:163532188-163532210 CCTAATGCACAGAGAAATTAAGG + Intergenic
965336583 3:167435060-167435082 GCCACTGCACAGAGACATGACGG - Intergenic
965344659 3:167533808-167533830 CCCACTGAGCAGAGTGTCTATGG + Intronic
965612537 3:170559847-170559869 CCCAGTGGACAGAGAGTGTTTGG - Intronic
966505715 3:180699152-180699174 GCCACTGTAAAGTGAGTTTAGGG + Intronic
968862318 4:3182678-3182700 CCCACAGCTCCGAGAGGTTATGG + Intronic
969401906 4:6961391-6961413 CCCATGGCACAGAGAGATTTGGG - Intronic
972619182 4:40730499-40730521 ACCACCGCACAAAGTGTTTATGG + Intergenic
973052575 4:45612813-45612835 CCAACTGCAGAGAGAGTCCAAGG + Intergenic
973163297 4:47045957-47045979 CCCACAACACATAGGGTTTATGG - Intronic
976558818 4:86478423-86478445 GCCACTGCACACAGACTTGAGGG - Intronic
977321785 4:95525083-95525105 AACACTGCACACAGAGTTGATGG + Intronic
979899420 4:126199418-126199440 ATCACTGCACAAAGAGTTTAGGG + Intergenic
980617406 4:135248550-135248572 CCCATTGTACAGACAGTTTGTGG - Intergenic
980969059 4:139552428-139552450 ACCACTGCAAAGAGACTTCAAGG + Intronic
986047046 5:4049121-4049143 CCCTCTCCACACACAGTTTAGGG - Intergenic
986095354 5:4549052-4549074 GGCACTGAATAGAGAGTTTAGGG + Intergenic
986368702 5:7060016-7060038 GCCACTGCACAGAGACATGATGG + Intergenic
986929250 5:12797228-12797250 CCCTCTGCTCAGAGAGTTGCAGG - Intergenic
987821051 5:22967226-22967248 CCCACAACACATGGAGTTTATGG - Intergenic
988363339 5:30264497-30264519 CTCACTGCAGAGAGAGTTCATGG + Intergenic
995913966 5:117220900-117220922 CCCACAACACATAGAGATTATGG - Intergenic
997823358 5:137085427-137085449 CCATCTGCACAGAGAGCTTCTGG + Intronic
997881832 5:137598632-137598654 CACACTGCAGAGAGGATTTATGG + Intergenic
998090212 5:139361960-139361982 CTCACTGTACAGTGAGTTTCAGG - Intronic
1000519190 5:162277483-162277505 GCCACTGCACAGAGACATGATGG + Intergenic
1003790069 6:9536227-9536249 CACACTGCACAGAAAGATGATGG - Intergenic
1004575434 6:16889576-16889598 GCCACTGCACAGAGACATGATGG - Intergenic
1004896973 6:20157683-20157705 CCCACTACAAATAAAGTTTAGGG + Intronic
1005097685 6:22135913-22135935 CTCAGTTCACAGAGAGCTTAAGG - Intergenic
1005321847 6:24663323-24663345 CCCACTGCACAAAGAAATTGAGG + Intronic
1006207199 6:32357896-32357918 CTCACTGCACAAAGGGTTAAGGG + Intronic
1006988142 6:38190670-38190692 CCCCTTGCACAGAGATTTTTGGG + Intronic
1008456986 6:51722476-51722498 ACCAATGCTCACAGAGTTTAGGG - Intronic
1016348324 6:143140243-143140265 CCCACGACACACAGAGATTATGG + Intronic
1018455089 6:163944518-163944540 GCCACTGCACAGAGAAGTTTAGG + Intergenic
1018496092 6:164347180-164347202 CTGACTGCAGAGAGGGTTTACGG + Intergenic
1018655798 6:166034467-166034489 CCCACCGCACATAGGGATTATGG - Intergenic
1018870246 6:167777143-167777165 CCCAAAGCACAGAGAGTGCAGGG + Intergenic
1020316264 7:6907409-6907431 GCCACTGCACAGAGACATGATGG - Intergenic
1021078597 7:16335356-16335378 CCCTCTGCAGACAGAGTTCAGGG + Intronic
1027607972 7:80323729-80323751 CCAGCTGTACAGAGAGTCTAAGG + Intergenic
1027659987 7:80977128-80977150 CCCAGTGCCCAGAGTTTTTATGG - Intergenic
1031422199 7:121565692-121565714 GCCACTGCACAGAGATATGATGG + Intergenic
1031690859 7:124786128-124786150 CCCACAGCACCGAGGGATTATGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032743746 7:134765472-134765494 CCCACTGCACAGAATTTTTGTGG + Intronic
1033062293 7:138120717-138120739 CCCAGTGCACAGAATGTTTCTGG + Intergenic
1033998018 7:147376239-147376261 CCCAGTGTTCAGAGAGTTTATGG + Intronic
1038687277 8:29729963-29729985 CACACTGCAGAGAGAGTGTTCGG + Intergenic
1039427333 8:37496438-37496460 CCCACCTCACATTGAGTTTAAGG - Intergenic
1040643696 8:49371946-49371968 CCCACAGCACATGGAGATTATGG + Intergenic
1041867398 8:62592115-62592137 CCCAATCCACAGAGAGGTTGTGG - Intronic
1042947033 8:74165472-74165494 TCCAAAGCACAGAGAGATTAAGG - Intergenic
1044278052 8:90324826-90324848 TCCACTGCAGAGAGAGTGTGAGG + Intergenic
1047195981 8:122721819-122721841 CCTGCTGCACAGAGACTTCAGGG - Intergenic
1047337725 8:123952551-123952573 CCCACTTCACAAAAAGTATAGGG - Intronic
1048135706 8:131744563-131744585 GCCACTGCACAGAGACATAATGG - Intergenic
1049770117 8:144376034-144376056 CCCAAGGCCCAGAGAGGTTATGG - Intronic
1049868553 8:144955966-144955988 GCCACTGCACAGAGACATAATGG + Intergenic
1056523694 9:87423238-87423260 CCCAGTGGTCAGAGAATTTATGG - Intergenic
1057763029 9:97891655-97891677 CCCTCTGCACAGCGAGTTCCTGG + Intergenic
1058761128 9:108133407-108133429 TTCACTGCAGAGAGAGTTGAGGG - Intergenic
1059320492 9:113464606-113464628 CCCTCTCCACAGAGAGTTGCAGG - Intronic
1060151284 9:121289929-121289951 CCCAGTGCAGAGAGAGTTTAAGG + Intronic
1186826516 X:13345874-13345896 CACACTTCACAGATAGTTGAGGG - Intergenic
1191761557 X:64652906-64652928 GCCACTGCACAGAGACATGATGG - Intergenic
1195887629 X:109656921-109656943 ACCACTGCTAAGAGAGTTTCAGG - Intronic
1196834673 X:119803154-119803176 CCCATGCCACAGAGAGATTAAGG - Intergenic
1197287024 X:124607657-124607679 CCCACTTCACTCAGAGTTAAAGG - Intronic
1198145417 X:133851528-133851550 CCCACTTCAGAGAGATTTGAGGG - Intronic
1198682677 X:139199648-139199670 CCCACAGCAGGGAGATTTTATGG - Intronic
1198845237 X:140903141-140903163 CTGACTGCACAGAAAGTTCAAGG + Intergenic
1200399464 X:156010645-156010667 CCCACTTCTCAGAGAGGTCAGGG - Intronic
1200739620 Y:6839111-6839133 CCCACTTTACAGAGAGTTAATGG - Intergenic
1201307273 Y:12561826-12561848 GCCACTGCACAGAGACATGATGG + Intergenic
1202076269 Y:21040792-21040814 GCCACTGCACAGAGACATGATGG + Intergenic