ID: 915272158

View in Genome Browser
Species Human (GRCh38)
Location 1:154760895-154760917
Sequence GGCCAGTGGCCTTGGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915272158_915272166 7 Left 915272158 1:154760895-154760917 CCTGTCCACCAAGGCCACTGGCC 0: 1
1: 0
2: 2
3: 20
4: 219
Right 915272166 1:154760925-154760947 CGGAAGAGAGCCCTTCAAGACGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915272158 Original CRISPR GGCCAGTGGCCTTGGTGGAC AGG (reversed) Intronic
900114454 1:1022503-1022525 GGGCAGTGGCCAAGGGGGACAGG + Intronic
900245761 1:1635320-1635342 GGCCGGGGGCCTGTGTGGACAGG + Intronic
900256991 1:1702477-1702499 GGCCGGGGGCCTGTGTGGACAGG + Intronic
901123853 1:6915710-6915732 CGCCAGTGGCCATGGCTGACAGG - Intronic
901199364 1:7457938-7457960 GGCCTCTGGCCGTGGGGGACAGG - Intronic
901218821 1:7570655-7570677 GGACCTTGGCCTTGGTGAACAGG - Intronic
901939370 1:12650504-12650526 GGCCAGTTGCCTTGGCCAACTGG + Intronic
902334928 1:15749284-15749306 GGCCAGTGGTCTTTCTGGAGGGG + Intergenic
902378126 1:16039781-16039803 GGCCAGAGGACTTGGTGAGCTGG - Intergenic
902511061 1:16967393-16967415 GGCCAGAGGCCTTGGGGGCGGGG - Intronic
902809877 1:18882027-18882049 GGCCAGACGCCTTGGAGGAGTGG - Intronic
902936807 1:19770253-19770275 GACCAGGGGCCTGGGTGGAGAGG + Intronic
904610386 1:31722867-31722889 AGTCAGTGGCCTTGGAGGAGTGG + Intergenic
905393141 1:37650886-37650908 GGCCAGGGGGCCTGGTGGAGAGG + Intergenic
906862010 1:49371092-49371114 GGCCAGTAGCCTGGGTGCCCAGG - Intronic
908125610 1:61027201-61027223 GACCAGTGGCTTTTCTGGACTGG - Intronic
908825770 1:68131458-68131480 GCAGAGTGGCTTTGGTGGACAGG + Intronic
914754252 1:150553928-150553950 GGCCAAGGGCCTTGGGGAACGGG + Exonic
915090011 1:153417631-153417653 GGACAATGGCCTTGGTGATCTGG - Intronic
915095473 1:153459445-153459467 GGACAATGGCCTTGGTGATCTGG + Intronic
915272158 1:154760895-154760917 GGCCAGTGGCCTTGGTGGACAGG - Intronic
915275878 1:154787807-154787829 GGCCTGGGGCCTTTTTGGACAGG - Intronic
915515841 1:156412210-156412232 GGCCAGTGGTCTTTGTTGAGGGG + Intronic
915961722 1:160272622-160272644 GGTCAGTGGCTTTGCTGGTCAGG - Intergenic
916398035 1:164413018-164413040 GGCCTGTGGCTTTTCTGGACTGG - Intergenic
920292800 1:204935828-204935850 GCCCAGTGGCCATGATGCACGGG - Intronic
920315704 1:205074444-205074466 GGCCAGGGCCCTTGGTGGAAAGG + Exonic
920381049 1:205534739-205534761 GCCAAGTGGCCATGGTGGAGGGG - Intergenic
921595369 1:217048571-217048593 TGCCTGTGGCATTGGTGGAAGGG - Intronic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1066428870 10:35334159-35334181 GCCCAGTGACCTTCTTGGACAGG + Intronic
1070390723 10:75968132-75968154 GGTCTGTGGTCTTGGTGGACAGG + Intronic
1073320419 10:102613061-102613083 GTGCAGTGGCCCTGGTGGAAGGG + Intronic
1074859777 10:117501576-117501598 GGCCAGGGGCCTGGGCGGGCAGG + Intergenic
1075537919 10:123286628-123286650 GGCCAGCTGCCTTGGATGACAGG + Intergenic
1075712447 10:124537924-124537946 GCCAAGGGGCCATGGTGGACAGG + Intronic
1076738137 10:132467856-132467878 GGCAGGTGGCCTTGGTGGACGGG - Intergenic
1077184891 11:1231569-1231591 GGGCAGGGGCCTTCGGGGACAGG + Intronic
1077239286 11:1502288-1502310 GGCCCCTGGCCTGGGTGGGCTGG - Intergenic
1077444615 11:2585165-2585187 TGGCAGTGGCCTGTGTGGACGGG + Intronic
1084302828 11:68262442-68262464 GCCCAGTGGCGGTAGTGGACGGG + Exonic
1084417597 11:69042414-69042436 GTCCAGTGGCCTGAGGGGACTGG + Intergenic
1084435466 11:69136786-69136808 GCCCTGGGACCTTGGTGGACAGG + Intergenic
1084476505 11:69392368-69392390 GGCCAGTGTTCTGGGGGGACTGG - Intergenic
1086345694 11:85893526-85893548 GGCCTGTGGCCTTGGGGGTTGGG - Intronic
1090404355 11:126468013-126468035 GGCCAGTGGTCCTGGTGGTAGGG + Intronic
1092530781 12:9342971-9342993 CTCCAGTGGCCTTGGTGCTCTGG + Intergenic
1093067432 12:14672927-14672949 GTCCAGTGACCTTGGATGACTGG - Exonic
1096214832 12:49793121-49793143 GGCAGGTGGGGTTGGTGGACAGG - Intronic
1097798901 12:63891183-63891205 GGCCACTGGCCTTGGTAGTGAGG - Intronic
1102864910 12:116366751-116366773 GGCCAGTGGCCATGCTGTGCTGG + Intergenic
1107801956 13:44116745-44116767 GGCCATTGGCCCTTGGGGACTGG + Intergenic
1108600881 13:51993880-51993902 GGGAAGAGGCCTTGGTGGAGGGG - Intronic
1114484292 14:23053885-23053907 GGACAGTGGCCTTGGTGGTCAGG + Intronic
1114554764 14:23555701-23555723 GGCCAGTGGCAATGGTGGCGAGG - Intronic
1116802062 14:49453561-49453583 GCCCAGTTTCCTTGGTGAACCGG + Intergenic
1118918642 14:70129753-70129775 GGCCAGTGGCCTTGAAAGATAGG + Intronic
1119894590 14:78209205-78209227 GGCCTGAGACCTTGGTGGGCAGG + Intergenic
1121523996 14:94605825-94605847 GGGCAGTGGCCTTAATGGAAGGG - Intronic
1122398796 14:101454839-101454861 GGCCTGTGGCTTCGGTGAACGGG + Intergenic
1123057291 14:105577442-105577464 GCCCAGTGACCTTGGGGGCCAGG + Intergenic
1123094547 14:105760698-105760720 GGCCAGTGCAGTTGCTGGACTGG + Intergenic
1126703466 15:51386965-51386987 GGGCAGTGGCCTTGGAAAACAGG + Intronic
1128321295 15:66696575-66696597 GGCCAGAGGCCATGGTGGCTTGG - Intergenic
1129390118 15:75216135-75216157 AGTCAGGGGCCTTGGTGGACAGG - Intergenic
1131199916 15:90387960-90387982 GGGCAGTGGCCTTGGGGGCGGGG + Intergenic
1132330341 15:101008337-101008359 CGCCAGGGTGCTTGGTGGACAGG - Intronic
1132554708 16:567373-567395 GGCCGCTGGGCTTGGTGGCCAGG + Intronic
1132598239 16:762803-762825 GCCCAGGGGCCTTGGGGGCCAGG + Intronic
1132660892 16:1061097-1061119 GGCCAGTGTCCTTTGGGGCCCGG + Intergenic
1132760463 16:1506348-1506370 GGCCTGTGGACTTGGGGGACAGG + Intronic
1132955639 16:2591986-2592008 AGCCAGTGGCAATGGCGGACGGG - Intronic
1133036224 16:3035786-3035808 GGCCTGTGGCCCTGGAGCACTGG - Intronic
1134838201 16:17379550-17379572 GCCCAGTGGCCTGGCTGGGCTGG - Intronic
1139562213 16:67750207-67750229 GGGCAGTGGCTTTGCTGGATGGG - Intronic
1139672630 16:68502132-68502154 AGCAAGTGGCCTTGCTGGGCTGG + Intergenic
1142198140 16:88748231-88748253 GGCCCATGGCCTTTGGGGACAGG + Intronic
1142603941 17:1071461-1071483 GGACAGTTGCCTTCGTGGATTGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1145016645 17:19403129-19403151 GGCCACTGGGCCTGGGGGACAGG + Intergenic
1146317036 17:31815449-31815471 TTTCAGTGGCCCTGGTGGACAGG + Intergenic
1146912557 17:36658040-36658062 GGCCCGGGGCCTTGGGGGAAGGG - Intergenic
1147374921 17:40017630-40017652 GGACATTTGCCTTGCTGGACGGG + Exonic
1147562646 17:41518611-41518633 GGTCTGTGGCTTTGGTGGAGGGG - Exonic
1147745636 17:42692764-42692786 GGCGAGTGGCCTTGGAGGATGGG - Intronic
1149352759 17:55808515-55808537 GGCCAGTGGCCAGTGTGGAAAGG - Intronic
1150816989 17:68400231-68400253 GGCCAGTGTCCTTGGTAGGTTGG - Intronic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1152636367 17:81432177-81432199 GGCCAGTGGCCTTGGTCACTGGG + Intronic
1152728223 17:81958032-81958054 GGTCAGGGGCTTGGGTGGACTGG + Intronic
1152891665 17:82885123-82885145 GGCCAGTGGACCAGGTGGAAGGG + Intronic
1153608667 18:6859608-6859630 GGCCAGTGTCCTTAGAGGGCTGG + Intronic
1153868791 18:9297351-9297373 CGCCTGTGGCCCTGGTGGGCAGG + Intergenic
1154141934 18:11831767-11831789 GGCCAGTGGGCCTGTTTGACGGG - Intronic
1154395309 18:13982159-13982181 GGCCTGTGGCCTTATTGGAAGGG + Intergenic
1159951328 18:74486402-74486424 GGCCAGTGGCTCTGGTGGCCTGG + Intergenic
1160049798 18:75422106-75422128 GGCCAGTGGCCCTGCTGGGTGGG - Intronic
1160806285 19:993601-993623 GGGCAGTGGCCTTGCTGGGCCGG + Intronic
1160856870 19:1221690-1221712 GCCCAGTGGCCTTGGGAGAACGG + Intronic
1160858599 19:1228227-1228249 GCGCAGTGGCCTTGGGGGAGAGG - Exonic
1160860386 19:1235068-1235090 GGCCCGTGGAGCTGGTGGACAGG + Exonic
1161721754 19:5906575-5906597 GGCCAGCGGCCATGATGGAGGGG + Intronic
1163674163 19:18647017-18647039 GGCCAGTGCCCTTCTTGGGCTGG - Intronic
1164632412 19:29770185-29770207 GGACAGTGGCCTCGGGGGAAAGG + Intergenic
1164644018 19:29844954-29844976 GGCCAGGGCGGTTGGTGGACTGG + Intergenic
1164850545 19:31479574-31479596 GGCCACTGGCTTTGGTGAACTGG - Intergenic
1165061702 19:33208012-33208034 CTCCAGAGGCCTTGCTGGACAGG - Exonic
1165095154 19:33406131-33406153 GGGCAGTGGCCTTGGCAGGCGGG + Intronic
1167790745 19:51678080-51678102 GGGCAGTAGCCTTGGAGGATGGG - Intergenic
926415075 2:12641979-12642001 GGTCAGTTGCCTTCCTGGACAGG + Intergenic
926723845 2:15982534-15982556 GGCCAGGGACCTGGGAGGACAGG + Intergenic
926741616 2:16115985-16116007 GGTCAGTGTCCTTGGTGGTGAGG + Intergenic
932828276 2:74961261-74961283 GACCAGGGGCCTAGGTTGACAGG - Intronic
933159366 2:79007350-79007372 TGCAAGAGGCCTGGGTGGACTGG - Intergenic
933730003 2:85449288-85449310 GGCCAGTGGGTCTGGTGGCCAGG - Intergenic
934654363 2:96109481-96109503 GGGCAGGGGCGTTGCTGGACTGG + Intergenic
934790223 2:97053570-97053592 GGCACGTGGCCTTGGTGGTGTGG + Intergenic
934816245 2:97328967-97328989 GGCACGTGGCCTTGGTGGTGTGG - Intergenic
934821451 2:97379517-97379539 GGCACGTGGCCTTGGTGGTGTGG + Intergenic
936270602 2:111045860-111045882 GTCCAGTGCCCTTCGTGGGCTGG - Intronic
938571885 2:132568889-132568911 AGCCAGTGGCCTTGCTGGGCAGG + Intronic
941765115 2:169288491-169288513 GGCCAGTGCCTTTGCTGGGCTGG - Intronic
944102003 2:196036915-196036937 TGGCAGTGGGCTGGGTGGACTGG - Intronic
944487832 2:200225133-200225155 TGCCCTTGGCCGTGGTGGACTGG + Intergenic
946180236 2:217944345-217944367 GGCCAGAAGGCTTGGGGGACAGG + Intronic
946324813 2:218979925-218979947 GGGCAGTGGCCCTGGTGGGAGGG + Intergenic
1169430676 20:5533275-5533297 GGCCAGTGGTCTTGCTGTGCTGG - Intergenic
1170603501 20:17859433-17859455 GGCCAGGGGGCTAGGTGGACAGG - Intergenic
1172835063 20:37868130-37868152 GTACAGTGGCCTCGGTGGCCAGG - Intronic
1172938669 20:38639431-38639453 GCTCACTGGCCTTGGTGGAGAGG + Intronic
1173467294 20:43293491-43293513 GTCAAGAGGCCTTGGTGGGCTGG - Intergenic
1173523161 20:43713759-43713781 GGCCAGTGGACTTGCTGTGCCGG + Intronic
1173981032 20:47224346-47224368 GGCCAGTGGGCTTGCTGGCAGGG + Exonic
1174454843 20:50641784-50641806 GGCCAGTGGCCATGCGGAACTGG - Intronic
1175243138 20:57564403-57564425 TGCCAGAGGCCTTGGTGTGCCGG + Intronic
1177977768 21:27872414-27872436 GGCCAGAGGTCTTGGTGCAGGGG - Intergenic
1178145385 21:29734201-29734223 GGCCAGTAGCCTGGATGGAGTGG - Intronic
1179828535 21:43981820-43981842 TGCCAGGGGCCTTGGTGGGAGGG + Intronic
1180066776 21:45416325-45416347 GCCCAGTGTCCTTTGTGAACTGG + Intronic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183359866 22:37377860-37377882 AGCCAGTGGCCGTGCTGGACGGG - Intronic
1183664328 22:39238705-39238727 GGCCAGTGGCCTTAGAACACAGG - Intronic
1184255512 22:43284579-43284601 TGCCAGTGGCTTTGGGGGATTGG - Intronic
1184641769 22:45876754-45876776 GGCCAGTGGCCCGAGGGGACAGG + Intergenic
1184778003 22:46632921-46632943 GGCCAGAGGCCTGCGTGGAAAGG - Intronic
1184859080 22:47163092-47163114 TGCCAGTGGCCAGGGTGGGCAGG + Intronic
1185063035 22:48616911-48616933 GTCCAGTCTCCTTGGTGGGCCGG + Intronic
952301509 3:32107782-32107804 GGCCACTGGCCTTGCTGGGATGG - Intronic
952541951 3:34376167-34376189 GGCCAGTGACTATGGTGGAAAGG + Intergenic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
956640870 3:71414291-71414313 GGACGGTGGCCTTGTTGCACTGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960840970 3:121958198-121958220 AGCCAGTGGACTTGGGGGGCAGG + Intergenic
961426285 3:126851131-126851153 GGCCAGTGGGCTTGGGTGGCTGG - Intronic
963008163 3:140745653-140745675 GGCCAGTGGGCCTGGAGCACTGG + Intergenic
963942393 3:151108149-151108171 GGCCAGTAGGCATGCTGGACAGG + Intronic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
968645809 4:1740011-1740033 GGCACGTGGCCTCGGTGGCCCGG - Intronic
968655247 4:1775762-1775784 GGCCAATGGGCTTTGTGGGCTGG - Intergenic
968966470 4:3771432-3771454 AGTCAGGGGCCGTGGTGGACAGG - Intergenic
969663783 4:8545380-8545402 AGCAAGTGGCCATGGTGGGCAGG - Intergenic
975996448 4:80321515-80321537 GGGCAGTGGCGGTGGTGGGCGGG - Intronic
979764120 4:124444955-124444977 TAGCAGTGGCCTAGGTGGACAGG + Intergenic
983852789 4:172603402-172603424 GGCCAATGGCCTTGGTAAAATGG - Intronic
985838457 5:2288247-2288269 GCCCAGTGGCCTTCCTGGCCGGG + Intergenic
986056910 5:4147117-4147139 GACCAGCGGCTTTGCTGGACAGG + Intergenic
986440403 5:7776490-7776512 GTCTAGGGGCCTGGGTGGACAGG - Intronic
989601748 5:43206660-43206682 GGGGAGTGGCCTTGGGAGACTGG - Intronic
994710513 5:103259133-103259155 GTCCCTTGGCCTTGGTGGACCGG + Intronic
997197096 5:131987534-131987556 GGCCTGAGGCCTTGGAGGCCAGG + Intronic
997728921 5:136149949-136149971 GGCCAGTGACTTTGGTGAATGGG - Intronic
999088628 5:148915211-148915233 GGCCAGTGACCTAGGTGGGAAGG - Intergenic
999154410 5:149448147-149448169 GGCCAGTGGCAAAGGAGGACGGG - Intergenic
999288088 5:150406205-150406227 GGCCAGGGTCCTGGGTGGGCAGG + Intronic
1002709649 5:181187569-181187591 AGCCAGTGGCTTTGGCGGAGCGG + Intergenic
1002922072 6:1579982-1580004 AGCCAGTGGACTTGGTGGCTGGG + Intergenic
1003746355 6:9006811-9006833 GTCCACTAGCCTTGGTGGGCAGG + Intergenic
1005098767 6:22146809-22146831 GGCGAGGGGACTTGGAGGACAGG + Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006414461 6:33895275-33895297 GGCCATTGCCCCTGGTGGGCGGG - Intergenic
1010243522 6:73640601-73640623 GGCCACTGGGCTTGGTGTAGAGG - Intronic
1011788254 6:90869722-90869744 TGCCAGGGGCCATGGCGGACAGG + Intergenic
1011838174 6:91459468-91459490 AGACAGTGGCCTTGGTGTTCAGG + Intergenic
1012873696 6:104700536-104700558 GGGCAGTGCCCTTGATGGTCAGG + Intergenic
1014979839 6:127932790-127932812 GCCCAGTGGCCTGAGTAGACTGG - Intergenic
1015497064 6:133893183-133893205 GGCCTGTGGGGTTGGTGGAAGGG - Exonic
1016214980 6:141588444-141588466 AGGCAGTGGCCCTGGGGGACTGG + Intergenic
1016918065 6:149263780-149263802 GGCCAGTGGCATTGGCGCCCAGG + Intronic
1019121840 6:169810439-169810461 GGGGAGTGGCCTCGGTGGGCAGG + Intergenic
1019121857 6:169810496-169810518 GGGGAGTGGCCTCGGTGGGCAGG + Intergenic
1019508932 7:1407581-1407603 GGCCTGTGGCTTGGGTGGCCTGG - Intergenic
1019759610 7:2800752-2800774 AGCGAGTGGCAGTGGTGGACTGG + Intronic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1026108212 7:67437655-67437677 GGGCAGTGGTCTTGGTGGTAAGG + Intergenic
1026446090 7:70486199-70486221 GCCCTGTGCCCTTGGAGGACTGG - Intronic
1026634459 7:72069268-72069290 GGACACTGGCCTTGGTGGATGGG + Intronic
1027604803 7:80287583-80287605 GGCCAGTGGACTTGGGGCAGGGG + Intergenic
1030314811 7:108103720-108103742 GGCCAGTGGCCTGGAGGGAAAGG + Intronic
1034235031 7:149560012-149560034 GTTCCGTGGCCTTGGTGGAAGGG - Intergenic
1034276049 7:149824326-149824348 GCCCAGAGACCCTGGTGGACAGG - Intergenic
1034501251 7:151452302-151452324 AGCCAGTGGCCCTGGGAGACAGG + Intergenic
1035059963 7:156062032-156062054 GGCCTGTGGTCTGGCTGGACAGG + Intergenic
1035649239 8:1252706-1252728 GGGCAGTGGCCATGGCGGCCAGG + Intergenic
1036609606 8:10338327-10338349 GGCCAGAGGCCAGGGTGGAGTGG + Intronic
1039800091 8:40946558-40946580 GGCCACTGGCATTTGGGGACTGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041174293 8:55177880-55177902 GGCCAGTGGCATTTGAGGAAAGG - Intronic
1041707886 8:60865621-60865643 GGCCCGGGGCCATTGTGGACAGG - Exonic
1045368100 8:101494146-101494168 GGCCCGCGGCCTTGGGGCACCGG - Intronic
1047298927 8:123596442-123596464 GGGCTGTGCTCTTGGTGGACCGG - Intergenic
1049206137 8:141364520-141364542 GGCCTGTGGGCGTGGGGGACAGG - Intronic
1049336490 8:142089435-142089457 GGGCAGTGGCCTTGGTCAGCGGG - Intergenic
1049814441 8:144591590-144591612 GGCCAGTGGTGCTGGGGGACAGG + Intronic
1051306767 9:15718210-15718232 GGCCTGTGGCAGTGGTGGCCAGG + Intronic
1052366763 9:27620608-27620630 GATCAGTGGCCTGGGTGGGCAGG - Intergenic
1056555884 9:87686696-87686718 TGTCGATGGCCTTGGTGGACTGG - Exonic
1057227460 9:93299900-93299922 GGTCAGTGGCTTTGGTGCTCCGG + Intronic
1057396091 9:94681702-94681724 GGCCTGCGGCCTTGGTAGCCAGG + Intergenic
1057907386 9:98993364-98993386 GGCCAGTGGCTTGGGCTGACAGG + Intronic
1059477036 9:114555492-114555514 GGCCAGTTGCCTTGGCCGAGTGG + Intergenic
1060279964 9:122209188-122209210 AGCCAGTGACCTTGGTCAACTGG - Intronic
1060676725 9:125522092-125522114 TGCCAGTGGCCCTGGTGGAAGGG + Intronic
1061206087 9:129164278-129164300 GGCCAGTGGCCTTCTTGTTCTGG + Intergenic
1061207973 9:129175305-129175327 GGCCAGTTCCCGTGGGGGACAGG + Intergenic
1062472036 9:136710366-136710388 GGCCAGCGACCTGGATGGACAGG - Intergenic
1062667164 9:137680922-137680944 GGCAAGTGGCCAGGGTGGATGGG + Intronic
1187929126 X:24277784-24277806 GGTCACTGGCCTTGGTGAAGGGG - Intergenic
1189487664 X:41445606-41445628 GGCCAGTGGGCCTGGTGCTCTGG - Intergenic
1190385284 X:49878652-49878674 GCCCAGCGGCCTTGGTAGCCCGG + Intergenic
1193240819 X:79167028-79167050 AGATAGTGGCCTTGGAGGACAGG + Intergenic
1197819266 X:130529326-130529348 GGGCAGTGGCCCTGCTGGGCAGG + Intergenic
1198090727 X:133326511-133326533 GGCCAAATGGCTTGGTGGACAGG + Intronic
1199538099 X:148926441-148926463 GGCCACTGTCATTGGTGGAGAGG - Intronic
1199565596 X:149212414-149212436 GGCCACTGCCCCTGGAGGACTGG - Intergenic
1200122461 X:153797603-153797625 GGCCCCTGGCCCTGGTTGACCGG - Intronic
1200129266 X:153832078-153832100 TGCCAGTGGCCATGGTGGGAGGG - Intergenic
1200258171 X:154596880-154596902 GGGAAGCAGCCTTGGTGGACAGG + Intergenic
1200793976 Y:7323879-7323901 GACCAGTGCCCTTGGTGAAGGGG + Intergenic
1202168102 Y:22013984-22014006 GGCCATTGGCCTTGGTAAAAGGG - Intergenic
1202223259 Y:22572384-22572406 GGCCATTGGCCTTGGTAAAAGGG + Intergenic
1202319856 Y:23623276-23623298 GGCCATTGGCCTTGGTAAAAGGG - Intergenic
1202550912 Y:26046780-26046802 GGCCATTGGCCTTGGTAAAAGGG + Intergenic