ID: 915272845

View in Genome Browser
Species Human (GRCh38)
Location 1:154767403-154767425
Sequence GACCTTACTGTCCTCTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915272845_915272846 -8 Left 915272845 1:154767403-154767425 CCACTCAAGAGGACAGTAAGGTC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 915272846 1:154767418-154767440 GTAAGGTCATTTATAAAGCATGG 0: 1
1: 0
2: 0
3: 10
4: 246
915272845_915272847 6 Left 915272845 1:154767403-154767425 CCACTCAAGAGGACAGTAAGGTC 0: 1
1: 0
2: 1
3: 6
4: 90
Right 915272847 1:154767432-154767454 AAAGCATGGCTGTGACAGCAAGG 0: 1
1: 0
2: 2
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915272845 Original CRISPR GACCTTACTGTCCTCTTGAG TGG (reversed) Intronic
904074998 1:27834337-27834359 GACATCACTGTATTCTTGAGAGG + Intronic
906478121 1:46183590-46183612 TACCTCACTTTCCTCTTGTGAGG + Intronic
908793933 1:67812529-67812551 GAGCTAACTTTCATCTTGAGAGG + Intronic
915272845 1:154767403-154767425 GACCTTACTGTCCTCTTGAGTGG - Intronic
1067921731 10:50465184-50465206 GACCTTACTGGCCATTTCAGTGG - Intronic
1068131176 10:52897149-52897171 CACCTTACTGTCCTCATTACTGG + Intergenic
1068299195 10:55116824-55116846 GACCTTATGGTCCACTTCAGAGG - Intronic
1069573008 10:69505935-69505957 GACAGTACTGTTCTCTAGAGAGG - Intronic
1073320351 10:102612681-102612703 CACACTACTGTCCTCCTGAGAGG - Intronic
1075125928 10:119698811-119698833 GAACTTATTGGCCTCTTGAATGG + Intergenic
1076669386 10:132111352-132111374 GACCTTGCTGTGCTCATGGGGGG - Intronic
1084867603 11:72072501-72072523 GCCCTTTCTGTCCTATTGAAGGG - Intronic
1086014883 11:82155391-82155413 GATATTACTTTCCTCTTGAGAGG - Intergenic
1088513151 11:110599019-110599041 GACCTCCCTGTGCTCTTGTGTGG + Intronic
1088568132 11:111194915-111194937 GAGCTTACTGTCCATTTGAGTGG - Intergenic
1092545941 12:9450943-9450965 GACCTTCACGTCCTATTGAGAGG - Intergenic
1093378892 12:18466776-18466798 GACCTTAGAGTCATCTTAAGAGG - Intronic
1094507015 12:31071130-31071152 GACCTTCACGTCCTATTGAGAGG + Intergenic
1095417677 12:41994143-41994165 GCCATTACTTTCCTCTTGAAGGG + Intergenic
1096218343 12:49810513-49810535 GACCTTACAGACCCCTGGAGAGG - Intronic
1100646002 12:96532278-96532300 GGCCTTAGTGTCCACCTGAGAGG + Intronic
1101667504 12:106832707-106832729 GATCTTGCTGACCTCTTAAGAGG + Intronic
1109224221 13:59673142-59673164 TACGTTACTGTTCTCTTTAGAGG - Intronic
1109426087 13:62167853-62167875 GACCTCCCTGTACACTTGAGGGG + Intergenic
1110760630 13:79226690-79226712 GATCTTAATGTTCGCTTGAGAGG + Intergenic
1113657613 13:112078208-112078230 GACCAGCCTGTCCTCATGAGGGG + Intergenic
1118693867 14:68364689-68364711 GACCTTACTGCTCCCTTGAAGGG - Intronic
1128564949 15:68695033-68695055 GACCTTCCAGTCCAGTTGAGAGG + Intronic
1128762206 15:70224973-70224995 CAGGTTCCTGTCCTCTTGAGAGG - Intergenic
1132056881 15:98658291-98658313 GACCTTCCTGTGTTCTTAAGCGG - Intronic
1133227247 16:4347483-4347505 GGCCTTACTGTCCTCTTGTGAGG - Intronic
1133652278 16:7823607-7823629 GACCTTTCTCTCCTCAGGAGTGG + Intergenic
1134079653 16:11316045-11316067 GTCCTTGCTGTCCTCTTGGTGGG + Intronic
1134912449 16:18039839-18039861 GGCCTTACTGTCTTGTTGTGAGG + Intergenic
1135250468 16:20897274-20897296 GACCAGACCGTCCACTTGAGAGG - Intronic
1136427204 16:30176850-30176872 GACCCTACTGTCCTCTAGGTTGG + Intergenic
1136628776 16:31477273-31477295 GACCTGTCTGTCCTCTTTCGCGG + Intronic
1137831876 16:51551618-51551640 GACCTTACAGCCTTATTGAGGGG + Intergenic
1139324632 16:66142756-66142778 GACCTTTCTGTGCTTTTCAGAGG - Intergenic
1143623805 17:8096591-8096613 GACCTTTCTTTCTTCTTGGGTGG + Exonic
1145962169 17:28893152-28893174 CACCTAACTGGCCTCTTGGGAGG - Intronic
1148763939 17:50026678-50026700 GACCTTCCTGTCCGGGTGAGGGG + Intergenic
1156789694 18:40955845-40955867 TGCCTTACTGTCCTCTTCAATGG - Intergenic
1157537852 18:48473672-48473694 AACCTTAGTGTGCTCTTTAGAGG - Intergenic
1159529093 18:69632611-69632633 GAAGGTACTGTCCTCTTGACTGG + Intronic
1161674302 19:5635469-5635491 TTCCCTACTGTCCTCTTAAGAGG - Intronic
1164291490 19:23872906-23872928 GTCCTACATGTCCTCTTGAGAGG - Intergenic
1165922799 19:39309002-39309024 GACCTTAGTGTCCACCTGAGTGG - Intronic
1167703989 19:51067607-51067629 GACCTTTCTTTCACCTTGAGAGG - Intergenic
926161924 2:10495368-10495390 GACCTGACTGTTCTCCAGAGCGG + Intergenic
927107982 2:19844205-19844227 GGCCTTCCTGTCCTCATCAGTGG - Intergenic
933510661 2:83237476-83237498 GTCCTTTCTGCCCTCTTCAGTGG + Intergenic
935224694 2:101043300-101043322 GAACTTGGGGTCCTCTTGAGGGG - Intronic
939081376 2:137665563-137665585 GGCCTAACTGTCCTCCTGACAGG - Intronic
939946344 2:148416107-148416129 GAAGTTACTGTCCTCTGGATAGG + Intronic
940899581 2:159114223-159114245 CACCCAACTGTCCTCCTGAGGGG + Intronic
942168558 2:173266614-173266636 GACTTTGCTGTCCTCTTCACTGG - Exonic
947196511 2:227573494-227573516 GACCCTACTGTCTTCTCCAGTGG - Intergenic
1170727959 20:18946855-18946877 GACTCTACTGCCCTCTGGAGAGG + Intergenic
1171437484 20:25134600-25134622 GACCTGACTGTGCTCCTGAGAGG - Intergenic
1172312859 20:33931758-33931780 GACCTGACAGTCCTGCTGAGAGG - Intergenic
1172346919 20:34209391-34209413 GGCCTTCCTGTGCTCTTGGGTGG + Intronic
1174083668 20:47989503-47989525 GACCATCCTGTCCTCCTGTGGGG - Intergenic
1175166551 20:57048370-57048392 GACCTTGCTGTCACCCTGAGAGG + Intergenic
952204479 3:31166601-31166623 GAACTTACAGTCTTCTTCAGGGG + Intergenic
954078314 3:48197139-48197161 TACCTTTCTGTCATCTTCAGGGG + Intergenic
965878470 3:173358201-173358223 GACCTTACTGACCTATTTACTGG + Intergenic
981861265 4:149359186-149359208 GAAGTTACTTTCCTCTAGAGAGG - Intergenic
982394583 4:154902586-154902608 AACCTTTCTGTTCTCTTCAGAGG + Intergenic
982636752 4:157906523-157906545 GACTTTACTTTCTTCTGGAGGGG + Intergenic
983009065 4:162522374-162522396 GATCTTACTCTCCTGTTGTGGGG + Intergenic
985509965 5:307978-308000 GACCTTGCTGTGCCCTTGGGTGG + Intronic
986000401 5:3626748-3626770 GACCTTGATGTGTTCTTGAGGGG - Intergenic
988034388 5:25807357-25807379 GACATTACTGTCCTTTGGATGGG + Intergenic
997315640 5:132932891-132932913 CATTTTACTGTTCTCTTGAGAGG + Intronic
1003915855 6:10785699-10785721 GACTTTTCTGTCCTCATCAGAGG + Intronic
1004041104 6:11976588-11976610 AATCTCACTGTCCTCTGGAGTGG - Intergenic
1004291268 6:14369614-14369636 AACCTTACTGTCCCCTCTAGTGG + Intergenic
1013285378 6:108676999-108677021 GGCCTTTCTGTTCTCTGGAGTGG + Intronic
1019744345 7:2691261-2691283 GACCTTCCCCTACTCTTGAGGGG - Intronic
1020876590 7:13702513-13702535 GACCAAAATTTCCTCTTGAGGGG - Intergenic
1023856882 7:44189457-44189479 GGGCTTACTGTGCTCCTGAGAGG + Intronic
1025606811 7:63045271-63045293 GCCCTCACTGCCCTCCTGAGAGG + Intergenic
1034091913 7:148371436-148371458 CACGATAATGTCCTCTTGAGTGG + Intronic
1034839429 7:154382015-154382037 GGTTTTCCTGTCCTCTTGAGTGG + Intronic
1034957129 7:155341914-155341936 GACCTTAATTTCCTCTTGAATGG + Intergenic
1034992152 7:155554765-155554787 TACCTTAATGACCTCTTTAGAGG + Intergenic
1037726147 8:21484022-21484044 GACCTCACTGTGCTCTCAAGAGG - Intergenic
1039132459 8:34281998-34282020 GATCTTATTTTCCTCTTTAGAGG + Intergenic
1045257157 8:100535987-100536009 GACCTTACATTCTTCTTGAATGG - Intronic
1046627548 8:116591092-116591114 GACCATATTGCCCTCTGGAGAGG + Intergenic
1046734734 8:117765104-117765126 AAACTTACTGTCCTTTTGCGAGG - Intergenic
1060901909 9:127266001-127266023 GAGCTTACTGTCCTCTGGCTGGG + Intronic
1062660859 9:137632190-137632212 GATGTTACTGTCCTGTCGAGGGG + Intronic
1185633527 X:1535049-1535071 GACCTAATTGTCCTCTTGTGGGG + Intronic
1187737848 X:22322704-22322726 TACCTTACTGTCCTCTTAGAGGG + Intergenic
1197248256 X:124188427-124188449 GAATTTACTGCCCACTTGAGAGG - Intronic
1200214636 X:154362273-154362295 CACCTTACTGGCGTCATGAGAGG + Exonic