ID: 915272884

View in Genome Browser
Species Human (GRCh38)
Location 1:154767654-154767676
Sequence ATCAGGAGGTTCCTCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915272877_915272884 28 Left 915272877 1:154767603-154767625 CCTCAGATGGTCTCTCCACCAGT 0: 1
1: 0
2: 2
3: 8
4: 188
Right 915272884 1:154767654-154767676 ATCAGGAGGTTCCTCCCTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 160
915272880_915272884 10 Left 915272880 1:154767621-154767643 CCAGTAAAGCTGCTTGGCACTTG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 915272884 1:154767654-154767676 ATCAGGAGGTTCCTCCCTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 160
915272879_915272884 13 Left 915272879 1:154767618-154767640 CCACCAGTAAAGCTGCTTGGCAC 0: 1
1: 0
2: 1
3: 9
4: 99
Right 915272884 1:154767654-154767676 ATCAGGAGGTTCCTCCCTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915272884 Original CRISPR ATCAGGAGGTTCCTCCCTGA GGG Intronic
902200690 1:14831231-14831253 ATCCAGAGGCTCATCCCTGATGG + Intronic
903105310 1:21073447-21073469 ATCAGGAGGCTCCCACCTTAAGG + Intronic
904193572 1:28766770-28766792 ATCAGTAGGCTCCTTCTTGAAGG - Intronic
904398204 1:30237249-30237271 ATTAAGAGTTTCCTCACTGAGGG + Intergenic
907740234 1:57158352-57158374 AACAGGATGTTCCTTCCCGAAGG + Intronic
912687595 1:111779389-111779411 ATTAGGAAGTTCCTTCCTTAGGG + Intronic
915272884 1:154767654-154767676 ATCAGGAGGTTCCTCCCTGAGGG + Intronic
915888425 1:159748157-159748179 TTCAGGATCTTCCTCCCTGGGGG + Intergenic
920578692 1:207084162-207084184 ATCATGAGGTTCCTCCCAGGTGG - Intronic
921214990 1:212929004-212929026 GACAGCAGGTTTCTCCCTGAAGG + Intergenic
921277400 1:213533358-213533380 ATCAGGAGGTTCTGGCTTGATGG + Intergenic
1062818480 10:517007-517029 ATCAGGGGCTTCCTCACTGTGGG + Intronic
1063217807 10:3939654-3939676 ATCAAGAGCTTCCCCCCTGCAGG + Intergenic
1066200950 10:33142321-33142343 ATCAGCAGCTCCCTCCCTGTTGG - Intergenic
1066286996 10:33977620-33977642 ATTAGGAGGCTCTTCCATGAAGG + Intergenic
1069950011 10:72012248-72012270 AGCAGGAGGTCCTTCCCAGAAGG + Exonic
1070156305 10:73837695-73837717 ATCCTGAGGTGCCACCCTGAGGG - Intronic
1072049343 10:91688074-91688096 ATCAGGAGGCACCTCCCTTGAGG - Intergenic
1074530625 10:114296491-114296513 ATGATGCGGTTTCTCCCTGATGG - Intronic
1081629720 11:44681058-44681080 GAGAGGAGGTACCTCCCTGAAGG + Intergenic
1081764945 11:45604095-45604117 AGCAGGAGTTTGCTCCCCGAGGG - Intergenic
1083076289 11:60042271-60042293 ATCAGGAAGGTCCTTCCTAAAGG - Intronic
1083335503 11:61919413-61919435 AGCAGGAGGGTCCTCCCTACTGG - Intronic
1083597078 11:63923061-63923083 ATGAAGGGGTTCCTCCCAGATGG - Intergenic
1084023795 11:66435274-66435296 TTCAGTAGGTTCCTGCCTGATGG - Exonic
1090722389 11:129488318-129488340 ATAAGGTAGTCCCTCCCTGAGGG - Intergenic
1092289709 12:7152111-7152133 ATCAGTGGTTTCCTCTCTGACGG - Intronic
1096112461 12:49037725-49037747 CCCAGGAGGATCCTCCCTGCTGG - Exonic
1106182059 13:27378108-27378130 AACAGAAGGTTTCTCCCTCAGGG - Intergenic
1107199355 13:37695317-37695339 ATCAGGTGGCCCCTCACTGAGGG - Intronic
1108006797 13:45955626-45955648 ATCAGGAAGTGGCTTCCTGAAGG + Intronic
1108611720 13:52090354-52090376 ATCATGATGTTCCTTCCTAAAGG - Intronic
1117580897 14:57150740-57150762 ATCTGCAGGTTCCTCACAGAGGG - Intergenic
1121311119 14:92935616-92935638 ATCAGGTCGCCCCTCCCTGATGG + Intergenic
1127294693 15:57598928-57598950 ATCCCGAGGGTCCTTCCTGAGGG + Intronic
1132477186 16:146101-146123 ATCATGAGGGTCCTCCCCCAAGG + Intergenic
1132926218 16:2430282-2430304 ATCCTGAGGTTCCTGTCTGAGGG + Intronic
1137343572 16:47634452-47634474 TTCAGAAAGTACCTCCCTGAGGG - Intronic
1138316616 16:56075817-56075839 ATTAGGAGATTTCTCCCTGAAGG - Intergenic
1138603306 16:58070800-58070822 ATCAGCAGATTCCACCCTGCTGG + Intergenic
1144506857 17:15839010-15839032 TGCAGGAGGTTTCTGCCTGATGG - Intergenic
1144718418 17:17450597-17450619 AGAGGGAGGCTCCTCCCTGAGGG + Intergenic
1145171039 17:20656942-20656964 TGCAGGAGGTTTCTGCCTGATGG - Intergenic
1145909502 17:28534408-28534430 ATCAGGAAGTTCCTCCCGCAAGG + Exonic
1146160082 17:30554994-30555016 ATCATGTGGTCACTCCCTGAGGG + Intergenic
1147609067 17:41791014-41791036 AACGGGAGGTTCTTCCCGGATGG + Intergenic
1152242607 17:79168142-79168164 TTCGGGAGGTCCATCCCTGAGGG + Intronic
1152365607 17:79854647-79854669 CTCAGGAGGTGCCTACCTCAGGG - Intergenic
1154193801 18:12251763-12251785 ATGCTGAGGTCCCTCCCTGAGGG + Intergenic
1160141012 18:76323114-76323136 ATCACGATGTTCCTGCCTCAAGG - Intergenic
1162554528 19:11378524-11378546 AGCAGGTGGGTCCTCCGTGAAGG + Exonic
1164498067 19:28787406-28787428 ATCAGGTGGTTCTTACCTGCCGG - Intergenic
1164698231 19:30262749-30262771 GTCAGGCAGTACCTCCCTGAGGG - Intronic
1165511775 19:36270356-36270378 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165512325 19:36272857-36272879 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165512872 19:36275398-36275420 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165513428 19:36277953-36277975 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165513978 19:36280487-36280509 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165514530 19:36283024-36283046 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165515082 19:36285557-36285579 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165515632 19:36288093-36288115 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165516184 19:36290630-36290652 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165516734 19:36293156-36293178 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165517287 19:36295679-36295701 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165517839 19:36298214-36298236 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165518391 19:36300749-36300771 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165518940 19:36303281-36303303 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165519490 19:36305796-36305818 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165520039 19:36308324-36308346 GCCACGAGGTTTCTCCCTGATGG - Intergenic
1165624029 19:37270257-37270279 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165624575 19:37272798-37272820 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165625118 19:37275325-37275347 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165625652 19:37277863-37277885 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165626192 19:37280388-37280410 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165626733 19:37282915-37282937 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165627273 19:37285436-37285458 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165627814 19:37287964-37287986 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165628352 19:37290488-37290510 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165628891 19:37293013-37293035 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165629434 19:37295539-37295561 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165629975 19:37298064-37298086 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165630518 19:37300592-37300614 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165631054 19:37303130-37303152 GCCACGAGGTTTCTCCCTGATGG + Intergenic
1165631520 19:37305585-37305607 CTCACGAAGTTTCTCCCTGATGG + Intergenic
1166042988 19:40214306-40214328 AGCAGGAGGTGGCTGCCTGAGGG - Intronic
1167323038 19:48807863-48807885 CTCAGGCGGGTCCTCCCAGAGGG + Intronic
925056634 2:861838-861860 ACCAGGTGGAGCCTCCCTGAGGG + Intergenic
925454588 2:4004362-4004384 ATCAGGTGGGTCAGCCCTGAGGG - Intergenic
925523623 2:4775696-4775718 ATCAAGAGGTTGGTCACTGAGGG + Intergenic
927194748 2:20539667-20539689 ATCATAAGGTTCCTCACTCATGG + Intergenic
927711983 2:25331866-25331888 AGCAGGAGGTGCCTCCCACATGG - Intronic
929155355 2:38784053-38784075 AACAGAAAGTTCCTCCCTCACGG + Exonic
930698775 2:54438817-54438839 ATCAGGAGGTTATTCTCAGAGGG - Intergenic
931571490 2:63673501-63673523 ATCAGGCCATTCCTGCCTGATGG - Intronic
932442564 2:71747036-71747058 TTCAGGATGTTCCTCCCGGCTGG - Intergenic
933799029 2:85945045-85945067 ATTAGGATGTTCCTCCCAGAAGG + Intergenic
934144809 2:89081426-89081448 ATCAGTAGGTACATCCTTGAGGG - Intergenic
934224448 2:90119125-90119147 ATCAGTAGGTACATCCTTGAGGG + Intergenic
935505497 2:103896465-103896487 GTCAGGAAGTTCCAGCCTGATGG + Intergenic
938930497 2:136082429-136082451 AGCATGGGGTTCCTTCCTGAGGG - Intergenic
939848896 2:147280478-147280500 AGTAGAAGGTTCCTTCCTGAAGG - Intergenic
946254769 2:218434519-218434541 TTCGGGAGGTGCCTCCCTGCAGG - Exonic
947553321 2:231064517-231064539 ATTTTGAGGTTCCTCTCTGATGG + Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1169762452 20:9111139-9111161 TTCAGGAAGCTCATCCCTGAGGG - Intronic
1171186405 20:23126988-23127010 AACAGGAGGGGCCTGCCTGAGGG + Intergenic
1171533903 20:25869430-25869452 TCCAGGAAGTTTCTCCCTGATGG + Intergenic
1172271880 20:33659607-33659629 ACCAGGAGGGTCCTCCCTTGTGG + Exonic
1173465945 20:43281519-43281541 ATCATGATTTTCCTCCTTGAGGG - Intergenic
1175751888 20:61504292-61504314 TTCAGGAGGTTCCTCTCTCAAGG + Intronic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1178735049 21:35141569-35141591 CACAGGAGGCTCATCCCTGATGG + Intronic
1180831783 22:18910423-18910445 ACCAGGTGGCTCCTCGCTGAGGG + Intronic
1181061391 22:20283691-20283713 TTCAGGAGGGGCCTCCCTGGGGG + Intergenic
1203281863 22_KI270734v1_random:135694-135716 ACCAGGTGGCTCCTCGCTGAGGG + Intergenic
949857153 3:8472545-8472567 ATCAGGGGGATACTCCCAGAAGG - Intergenic
950930589 3:16785057-16785079 ATCTGGAGGTTCCTCCTGGAGGG - Intergenic
952300960 3:32104382-32104404 ATCAGGTAGCTCCTCCTTGATGG - Intergenic
954647658 3:52141330-52141352 AGCAGGAGGTTCCTCTCTAGAGG + Intronic
962283123 3:134066815-134066837 ATCAGCAGCCTCCTCTCTGACGG - Intronic
963115241 3:141723342-141723364 ACCAGGAGGCTCCTACCTTAAGG - Intergenic
967876744 3:194272713-194272735 GTCAGGTGGTTCAACCCTGATGG + Intergenic
970430420 4:15984018-15984040 AACAGGAGTTTTCTCCCTGCAGG + Intronic
972441889 4:39102419-39102441 TTCAGGAAGTTGCTGCCTGAAGG - Intronic
973771553 4:54211778-54211800 CTCAAGAGGTTCCTCTCTCAAGG - Intronic
974122804 4:57660410-57660432 CTCTGGAGGTAACTCCCTGATGG + Intergenic
980092758 4:128459570-128459592 ATCAGGCAGTTTCTCCCAGAGGG + Intergenic
980378360 4:131977433-131977455 CCCACGAGGTTTCTCCCTGATGG + Intergenic
985746850 5:1652751-1652773 ATCAGGAGTGCCCTCCCTGTTGG + Intergenic
986288979 5:6383562-6383584 TTTGGGAGCTTCCTCCCTGATGG + Intergenic
986378778 5:7162362-7162384 AACATAATGTTCCTCCCTGATGG - Intergenic
988724553 5:33913010-33913032 ATCAGATGGATTCTCCCTGAGGG + Intergenic
990634117 5:57704718-57704740 CTCTGGAGATTCCTCCTTGAAGG + Intergenic
992260549 5:74966076-74966098 CTGTAGAGGTTCCTCCCTGATGG + Intergenic
998813605 5:145990535-145990557 AACAGGTGGTTCCTCACAGAAGG + Intronic
999283372 5:150379538-150379560 ATCTGGTGGGTCTTCCCTGAAGG - Exonic
1004627756 6:17393314-17393336 ATCCGGAGGCTCCTGGCTGAAGG - Exonic
1007650566 6:43418006-43418028 ATCAGTAGGATCCTTTCTGATGG - Intergenic
1012231804 6:96768702-96768724 ACCAGGAGGGTCCTCCCTGCAGG + Intergenic
1014450952 6:121580947-121580969 ATCAAGTTGCTCCTCCCTGAAGG - Intergenic
1017632626 6:156411947-156411969 ATCTGGAGGTTTCACCATGATGG + Intergenic
1018415708 6:163600617-163600639 ACCAGGAATTTCCTCCCAGAGGG + Intergenic
1020070365 7:5223339-5223361 ATCAGTACCTCCCTCCCTGAAGG + Intronic
1022854001 7:34297796-34297818 ACAAGGAGGCTCCTCCCAGAAGG + Intergenic
1024508232 7:50181401-50181423 CTCAGCAGCTTCCTCCCTGAGGG - Intergenic
1024530020 7:50383787-50383809 ATAAGGAGGAGCCTCCCTCAGGG + Intronic
1032937838 7:136754174-136754196 ATCAGGAATTTCATTCCTGAAGG + Intergenic
1035274355 7:157738449-157738471 CTCTGGAGGCTCCTCTCTGATGG + Intronic
1035396266 7:158537001-158537023 ATCCTGAGGCTCCACCCTGATGG - Intronic
1035616870 8:1008757-1008779 AGGTGGAGGTTGCTCCCTGACGG - Intergenic
1035954680 8:4063639-4063661 ATCAGGTGCTGCCTCCCTGAGGG + Intronic
1035954959 8:4066949-4066971 CTCATTAGGTTCCACCCTGAGGG - Intronic
1036175316 8:6532249-6532271 GTCAGGAGCTTCCTCAATGAAGG - Intronic
1038271876 8:26081940-26081962 ACGAGGAGGTGCTTCCCTGAAGG - Intergenic
1038688238 8:29738102-29738124 AACAGGAAGGTCCTCCCGGAAGG + Intergenic
1041089460 8:54288503-54288525 ATCAGGCTTTCCCTCCCTGAGGG - Intergenic
1041192231 8:55365798-55365820 ATCAGGAGATTCGTAACTGAAGG + Intronic
1046733847 8:117754819-117754841 ATCATTAGGAACCTCCCTGAAGG + Intergenic
1047250906 8:123181690-123181712 ATCAGGGGGTTCCAGCCTGTGGG - Intronic
1048856096 8:138687804-138687826 ATAAGAACGATCCTCCCTGAAGG - Intronic
1049393200 8:142382566-142382588 GCCAGGAGGTCCCTGCCTGAGGG - Intronic
1049547914 8:143243138-143243160 ATCAGGAGGAACCTCCTAGATGG + Intergenic
1053513052 9:38705726-38705748 AGCAGGAGCTTCCCACCTGAAGG + Intergenic
1056062312 9:82896495-82896517 ATCAGCCTGTTGCTCCCTGAGGG - Intergenic
1056438729 9:86598650-86598672 TTCAGGAGGCTTTTCCCTGAAGG + Intergenic
1056740455 9:89249983-89250005 ATCAGGAGCTTGCTCTCTGCTGG + Intergenic
1061924456 9:133799087-133799109 ATCAGGACGCTTCTCCCCGAGGG - Intronic
1062026251 9:134342085-134342107 ATGAGGAGGCGTCTCCCTGAAGG + Intronic
1190879798 X:54484031-54484053 CTCAGGAGTTTCACCCCTGAAGG - Intronic
1192220452 X:69194257-69194279 GTCAGGACTTTCCTCCCTCAGGG - Intergenic
1200840536 Y:7776786-7776808 ACCTAGAGGATCCTCCCTGAGGG - Intergenic