ID: 915275519

View in Genome Browser
Species Human (GRCh38)
Location 1:154785422-154785444
Sequence GGCCCTTGGGAAGGAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 545}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915275519_915275534 30 Left 915275519 1:154785422-154785444 CCTTCACCTCCTTCCCAAGGGCC 0: 1
1: 0
2: 6
3: 57
4: 545
Right 915275534 1:154785475-154785497 TTTCCTGATCTCCCAGTGGCGGG 0: 1
1: 1
2: 3
3: 16
4: 221
915275519_915275527 2 Left 915275519 1:154785422-154785444 CCTTCACCTCCTTCCCAAGGGCC 0: 1
1: 0
2: 6
3: 57
4: 545
Right 915275527 1:154785447-154785469 CTGCACTGTCACCCCTTCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 184
915275519_915275525 0 Left 915275519 1:154785422-154785444 CCTTCACCTCCTTCCCAAGGGCC 0: 1
1: 0
2: 6
3: 57
4: 545
Right 915275525 1:154785445-154785467 AGCTGCACTGTCACCCCTTCAGG 0: 1
1: 0
2: 2
3: 15
4: 174
915275519_915275526 1 Left 915275519 1:154785422-154785444 CCTTCACCTCCTTCCCAAGGGCC 0: 1
1: 0
2: 6
3: 57
4: 545
Right 915275526 1:154785446-154785468 GCTGCACTGTCACCCCTTCAGGG 0: 1
1: 0
2: 0
3: 19
4: 149
915275519_915275533 29 Left 915275519 1:154785422-154785444 CCTTCACCTCCTTCCCAAGGGCC 0: 1
1: 0
2: 6
3: 57
4: 545
Right 915275533 1:154785474-154785496 TTTTCCTGATCTCCCAGTGGCGG 0: 1
1: 0
2: 2
3: 18
4: 215
915275519_915275528 3 Left 915275519 1:154785422-154785444 CCTTCACCTCCTTCCCAAGGGCC 0: 1
1: 0
2: 6
3: 57
4: 545
Right 915275528 1:154785448-154785470 TGCACTGTCACCCCTTCAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 186
915275519_915275532 26 Left 915275519 1:154785422-154785444 CCTTCACCTCCTTCCCAAGGGCC 0: 1
1: 0
2: 6
3: 57
4: 545
Right 915275532 1:154785471-154785493 AGCTTTTCCTGATCTCCCAGTGG 0: 1
1: 0
2: 0
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915275519 Original CRISPR GGCCCTTGGGAAGGAGGTGA AGG (reversed) Intronic
900208635 1:1442253-1442275 GGCCCTTGGCAAGGAAGTCCTGG - Exonic
900462841 1:2809660-2809682 GCCACATGGGAAGGAGGTGTGGG + Intergenic
900604334 1:3517082-3517104 GGCCCCTGGGAAGGCGGGGCCGG - Intronic
900720259 1:4171434-4171456 GGCCCTGGAGATGGAGCTGATGG - Intergenic
901317060 1:8316584-8316606 GAGGCCTGGGAAGGAGGTGAGGG - Intergenic
901570067 1:10152960-10152982 GGCCCTTGGCCAGTAGGTGCTGG + Intronic
901741562 1:11345301-11345323 GGCCACGGGGAAGGAGGTGGGGG + Intergenic
901789694 1:11647741-11647763 GGGCCCAGGGATGGAGGTGAGGG - Intergenic
901817273 1:11801446-11801468 GCCCCATGGGAAGGCAGTGACGG - Intronic
902111656 1:14084102-14084124 GCCCCTCTGGAGGGAGGTGATGG + Intergenic
903145897 1:21371820-21371842 GGGCCTAGGGGAGGAGGGGAGGG + Intergenic
903249852 1:22044916-22044938 GGCCCTTGGGGAGATGGTGGTGG + Intergenic
904287504 1:29461744-29461766 GGCTTCTGGGATGGAGGTGAGGG - Intergenic
904769511 1:32872851-32872873 GGGCATTGGGAGGGAGGAGATGG + Intergenic
905214551 1:36397690-36397712 GGACCTCCGGAAGGAGGTGCCGG - Intronic
905627624 1:39498981-39499003 GGCCCTTGGGAAGAAGGGGCCGG + Intronic
905668801 1:39778127-39778149 GACCCTTGGGAAGAAGGGGCCGG - Intronic
905711060 1:40103737-40103759 GGCCCTGTGGAGGGAGGTAATGG + Intergenic
905851774 1:41280054-41280076 GGCCCTGGGGCTGGAGGTCAGGG - Intergenic
905876363 1:41434322-41434344 GGGACTAGGGAAGGAGTTGAGGG - Intergenic
906189240 1:43885360-43885382 GGACCCGGGGAAGGAGGAGACGG - Intronic
906521432 1:46469163-46469185 GGCTCTGGGGAAGGAGGCCATGG - Intergenic
906530009 1:46518323-46518345 GGCTCATGAGAAGGAGGTGGGGG + Intergenic
906534348 1:46543510-46543532 GGGCCTTGGGGAGGATGTGGAGG + Intergenic
906585243 1:46970301-46970323 GGCCATTGGGAAACAGGAGAAGG + Intergenic
906680164 1:47720917-47720939 GCCCCTGGGGCAGGAGGAGATGG - Intergenic
907908706 1:58808534-58808556 GGCATTTGGGATGGAGGTGGGGG + Intergenic
911489925 1:98551729-98551751 GGGGCTTGGGAATGAGGTGGTGG + Intergenic
911664494 1:100538507-100538529 ATCCCATGGGAAAGAGGTGAAGG - Intronic
912306069 1:108568801-108568823 AGCCACTGGGAAGGAGGAGAGGG + Intronic
912418450 1:109527810-109527832 GGCCCTGGAAAGGGAGGTGAGGG - Intergenic
912496989 1:110098224-110098246 GGATGATGGGAAGGAGGTGAGGG - Intergenic
912551686 1:110489305-110489327 GGCCCCAGGGAAGGGGCTGAGGG + Intergenic
912708692 1:111934053-111934075 GGCCCTGGGGAAGGTGGTGCGGG + Intronic
912801111 1:112720238-112720260 TGGCCTTGGGAGGGAGCTGAGGG - Intergenic
913145041 1:115980715-115980737 GCCTCTTGGGAAGGAAGGGAAGG + Intronic
913219729 1:116649721-116649743 GGGCCTTGGGAAGAAGGATAAGG - Intronic
915002057 1:152602703-152602725 GGCCCCTGGGCAGGAGAGGAGGG - Intergenic
915019959 1:152769761-152769783 GGTTCTTGGGATGGAGGTAAGGG - Intronic
915275519 1:154785422-154785444 GGCCCTTGGGAAGGAGGTGAAGG - Intronic
916019197 1:160777778-160777800 GGCCCTGGGGCAAGAGGAGACGG - Intergenic
916046859 1:161006258-161006280 CGCCCGTGGAAAGGAGGGGAAGG - Intronic
917080475 1:171252456-171252478 GGCCCTAGGGAAAGAGACGAGGG - Intronic
917628775 1:176872822-176872844 GTGGCTTGGGAAGAAGGTGAGGG - Intronic
918463020 1:184795405-184795427 GGCCCATGGGGAGGAGTTGGGGG - Exonic
918572196 1:186010058-186010080 GGCCCTACAGCAGGAGGTGACGG - Intronic
919831476 1:201543830-201543852 GGGCCTTGGGGAGGAGGGAAGGG - Intergenic
920334814 1:205237870-205237892 TGCCCCGGGGAAGGAAGTGAGGG - Intronic
920335403 1:205241879-205241901 GGGCCTTGCGCAGCAGGTGAGGG - Exonic
920366245 1:205449808-205449830 ATCCCTTGGGAGGGAGCTGAGGG - Intronic
920722735 1:208402704-208402726 TGCCATTGGTAAGGAGGTGGTGG - Intergenic
922606877 1:226894982-226895004 TGCCCCTGGGAAGCAGGTGTGGG - Intronic
922868320 1:228879921-228879943 TGAACCTGGGAAGGAGGTGAGGG - Intergenic
923802275 1:237221842-237221864 GGCCCTAGGGAAGGCTGTGTTGG + Intronic
924938992 1:248797239-248797261 GGTTCTGGGGAAGGAAGTGAAGG - Intergenic
1062979539 10:1710541-1710563 GGACAGTGGGAAGGAGGGGAAGG - Intronic
1063272336 10:4524504-4524526 GGCCCTTTGGAAGTGGGCGAAGG + Intergenic
1063904864 10:10771023-10771045 GATCCTTGGGAAAGAGATGAGGG + Intergenic
1063948595 10:11201618-11201640 GGCCCTGAGGAAGGAGAGGATGG + Intronic
1067964106 10:50889458-50889480 GGCCAATGGGAAGGAAGTCACGG + Intergenic
1068296485 10:55078765-55078787 GGGGTTTGGGAAGGGGGTGAGGG - Intronic
1068374576 10:56162323-56162345 AGTGCTGGGGAAGGAGGTGAAGG + Intergenic
1068751068 10:60592942-60592964 GGCCTTTGGAAAGAAGGTTAGGG - Intronic
1069603269 10:69723164-69723186 GGCCTGGGGGAAGGAGGAGAGGG + Intergenic
1069646358 10:70001349-70001371 GGCCCTTGAGTGGGAGCTGAGGG - Intergenic
1069910230 10:71754331-71754353 GGCCCCCGGGAATGAGGGGAGGG + Intronic
1069987927 10:72297052-72297074 GCCCCTCGGGAAGGAGGGAAGGG - Intergenic
1071316029 10:84399171-84399193 GGAGGATGGGAAGGAGGTGAGGG - Intronic
1071333760 10:84585426-84585448 GACCCTGGGGAAGGAGTTCAAGG + Intergenic
1071347246 10:84704426-84704448 GTCCCTGGGGAAGCATGTGAGGG - Intergenic
1072424370 10:95317186-95317208 GGTCTTTGGAAAGAAGGTGAAGG + Intronic
1072763911 10:98080825-98080847 GGGCCTGGGGCTGGAGGTGAGGG + Intergenic
1072811525 10:98466288-98466310 GGGCCTTGAGTGGGAGGTGAAGG + Intronic
1072922180 10:99585552-99585574 GTCCCTTGTGTAGGAGGTGTAGG - Intergenic
1073251236 10:102121273-102121295 GGCGGTTGGTACGGAGGTGAAGG - Intergenic
1073295205 10:102434669-102434691 GGCCCCTAGGAAGGGGGTGATGG + Intergenic
1074476764 10:113781258-113781280 GGTGTTTGGGAAGGAGGTGTTGG - Intronic
1074476781 10:113781317-113781339 GGTGTTTGGGAAGGAGGTGTTGG - Intronic
1074476800 10:113781390-113781412 GGGGTTTGGGAAGGAGGTGTTGG - Intronic
1074476836 10:113781500-113781522 GGGGTTTGGGAAGGAGGTGTTGG - Intronic
1074476854 10:113781556-113781578 GGTGTTTGGGAAGGAGGTGTTGG - Intronic
1074476871 10:113781615-113781637 GGTGTTTGGGAAGGAGGTGTTGG - Intronic
1074476890 10:113781688-113781710 GGGGTTTGGGAAGGAGGTGTTGG - Intronic
1074943478 10:118257525-118257547 TGCCCTCGGAAAGGAGGTGGAGG + Intergenic
1075462896 10:122630638-122630660 GGCCCTTGGGAAGGCAGCAAAGG + Intronic
1076068759 10:127469390-127469412 GTACCTGTGGAAGGAGGTGATGG - Intergenic
1076244103 10:128932736-128932758 GGCCCCTGGGAAGGAGGAAGAGG + Intergenic
1076320727 10:129579515-129579537 GGCACTTTGGAAGGACGTTAAGG + Intronic
1077113058 11:870347-870369 GGCCCTGGGGGTGGAGATGAGGG - Intronic
1077228109 11:1447123-1447145 GGGCCCTGGGAAGGAGGTTCTGG - Intronic
1077264765 11:1643083-1643105 GGACCTGGAGAAGGAGGGGAGGG - Intergenic
1077313570 11:1904882-1904904 GGCCCGGGGAAAGGAGGAGAAGG - Intergenic
1077318874 11:1932002-1932024 GGCCCAAAGGAAGGAGGAGAGGG - Intronic
1077378257 11:2215687-2215709 GGCCGCTGGGGAGTAGGTGAAGG + Intergenic
1077478198 11:2800877-2800899 GGCGCTGGGGCAGGAGGAGAAGG + Intronic
1078060681 11:8040693-8040715 GGCTCTTGGGAAGGAGCAGTAGG + Intronic
1078088121 11:8246937-8246959 GGGTCTGGGGAAGGAGGTAAGGG - Intronic
1078352860 11:10609176-10609198 GGGCATTGGGTAGGAGGTCAAGG - Intronic
1078929585 11:15902693-15902715 GGCCTTATGGAAGGAGGTGAAGG - Intergenic
1080013685 11:27483099-27483121 GGCCCCAGGTGAGGAGGTGAAGG + Intergenic
1082980241 11:59114312-59114334 GGGCCTTGGAAAAGAGGGGATGG + Intronic
1083274481 11:61588849-61588871 GGAGCTTGGGAGGGAGGTCAGGG - Intergenic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1083418847 11:62542440-62542462 GGGCCAGGGGAAGGGGGTGATGG - Intronic
1083602640 11:63958427-63958449 GGCCATTGTGAAGGTGGAGAAGG - Intergenic
1083728319 11:64640002-64640024 GGCCCAAGGAAAGGAGGAGAAGG - Intronic
1084164996 11:67371480-67371502 GGCCCAGGGGAAGAAGCTGAGGG + Intronic
1084196541 11:67525910-67525932 GGCCCTTGGGAGGGAGGAAGGGG + Intergenic
1084268322 11:68016295-68016317 GGCCCTGAGGCAGGAGGTGCTGG + Intronic
1087938247 11:104061002-104061024 GGCCTGTGGGAAGGAGGAAATGG - Intronic
1089305405 11:117523310-117523332 GGAGGGTGGGAAGGAGGTGAAGG + Intronic
1090074944 11:123574496-123574518 GGCCCTGGGGAAGGAAGGGAAGG + Intronic
1090442729 11:126737444-126737466 GGGCCTGGGGAAGGAGTGGAGGG + Intronic
1090959473 11:131543408-131543430 GGGTCTTGGGAAAGAGGTTAGGG - Intronic
1091033458 11:132212199-132212221 GGGCCTTTGGTAGGAGGTTATGG + Intronic
1091083473 11:132695434-132695456 AGCCCTGGGCAAGGAGGTGAAGG + Intronic
1092524168 12:9299402-9299424 GGCCCTTGGGAAGGAGGCCCGGG + Intergenic
1092543100 12:9432410-9432432 GGCCCTTGGGAAGGAGGCCCGGG - Intergenic
1094069772 12:26400504-26400526 AGCCCTTTGGAAGGAGGTAATGG - Intronic
1094509919 12:31090028-31090050 GGCCCTTGGGAAGGAGGCCCGGG + Exonic
1096076917 12:48811701-48811723 GGTACCTGGGAAGGAGGGGAAGG - Intergenic
1096513386 12:52144058-52144080 AGCCCTGGGGAAGGAGCTGGAGG - Intergenic
1096868685 12:54579836-54579858 GGCCCATGGGAAAGAGGGTATGG - Exonic
1099795370 12:87393859-87393881 AGCCCTTTGGGAGGATGTGATGG - Intergenic
1100396289 12:94188926-94188948 GGCCATTGAGAATGAGGTGAGGG + Intronic
1101252568 12:102950525-102950547 GGACTTTGGGAAGGTGGTGATGG + Intronic
1101950124 12:109168083-109168105 GGCACAGGGGAAGGAGGCGAGGG - Intronic
1102171312 12:110844647-110844669 AGTCATTGGCAAGGAGGTGATGG + Intergenic
1103019448 12:117522269-117522291 AGCCTTTGAGAAGGGGGTGAGGG + Intronic
1103055955 12:117820562-117820584 GACCCTGGGGAAGGAGGAAAAGG + Intronic
1103196534 12:119048383-119048405 AGCCCATGTGATGGAGGTGAAGG + Intronic
1103573071 12:121857646-121857668 GGCCCTTGGGAGGGAGGATCAGG - Intronic
1103907337 12:124334531-124334553 GGCCCCAGGGAAGGAGTAGAGGG + Exonic
1103966683 12:124644527-124644549 GGCCCTTGGGGAGGAGGGGAAGG + Intergenic
1104762363 12:131305160-131305182 GGTCGCTGGGATGGAGGTGATGG - Intergenic
1104817413 12:131655636-131655658 GGTCGCTGGGATGGAGGTGATGG + Intergenic
1105707240 13:22975673-22975695 CACTCTTGGGAAGGAAGTGATGG + Intergenic
1106199492 13:27524446-27524468 TGGCCTTGGGAGGAAGGTGACGG + Intergenic
1106336976 13:28792357-28792379 GGCCCTTGTGACAGAGTTGATGG - Intergenic
1107459420 13:40587196-40587218 TGCCTTTGGGAAGAAGGTGGTGG - Intronic
1107479815 13:40776805-40776827 AGACCTTGTGAAGGAGGTAATGG - Intergenic
1113973811 13:114211468-114211490 CGCCCATGGGAGAGAGGTGAGGG - Intergenic
1114616822 14:24072822-24072844 GGGTCTAGGGAAGGAGGTTAAGG + Intronic
1116702334 14:48258499-48258521 GGCCCTTGAAAAGAAGGTAATGG + Intergenic
1116916855 14:50532987-50533009 GGCGCCGGGGAAGGAGGTGGGGG + Intronic
1116952986 14:50895767-50895789 GGCCCTTGAAAAGAAGGTAATGG - Intronic
1117488290 14:56221183-56221205 GGCCATTGGGAAGGAGAGGAAGG + Intronic
1117798799 14:59422476-59422498 GTCCCTTGGGTAGGATGTGATGG + Intergenic
1119336125 14:73835307-73835329 AGGCCTTGGGAAGGAGATGGGGG + Intergenic
1119573382 14:75695908-75695930 GACCCTGGGGAGGGAGGGGAGGG - Intronic
1121749639 14:96339727-96339749 GGAGGTTAGGAAGGAGGTGAAGG + Intronic
1121964842 14:98294702-98294724 GTCACCTGGGAAGGAGCTGAGGG - Intergenic
1122847834 14:104510417-104510439 GGCCCTGGGGCAGGAGGGGAGGG - Intronic
1122931055 14:104933270-104933292 GGCCCTTGGCAAGAGGATGAAGG - Exonic
1202894978 14_GL000194v1_random:1701-1723 GGCCTGTGGGAAAGAGTTGAGGG + Intergenic
1125479239 15:40069250-40069272 GGGCCTTGGCAAGGAGTTAATGG + Intergenic
1125601196 15:40916589-40916611 GGCCCTTGGGGAGGTGCAGAGGG + Intergenic
1125855114 15:42941044-42941066 ATCCCTTGAGAAGGAGGTCAAGG - Intergenic
1125965714 15:43874157-43874179 GGCCCTTGGGGGAGAGCTGAGGG - Exonic
1126158312 15:45585711-45585733 TGCCCTTGGCCAAGAGGTGAGGG + Intergenic
1126358181 15:47818190-47818212 TCCCTTTGGGAAGGAGGAGAAGG + Intergenic
1126691977 15:51294725-51294747 GCCCCCCGGGAGGGAGGTGAGGG + Intronic
1127259036 15:57314518-57314540 GACCCCAGGGAAGGAGGGGATGG - Intergenic
1128124159 15:65178781-65178803 AGCACTTTGGAAGGAGGAGATGG - Intronic
1128666726 15:69543703-69543725 GGGTGGTGGGAAGGAGGTGATGG + Intergenic
1128816186 15:70610281-70610303 GGCTCCTGGGAAGAAGGTCAGGG - Intergenic
1128849398 15:70937457-70937479 GGCTCCTGGGAAGGAGGAGAAGG - Intronic
1128898556 15:71398267-71398289 GGCATTTGGGGAAGAGGTGATGG + Intronic
1128944313 15:71810895-71810917 GGCCCTTGGGGAGCAGGGTAAGG + Intronic
1129463533 15:75711663-75711685 GGCCCTTGTGAAGGAGGCTCAGG + Intronic
1129699755 15:77760791-77760813 GGTGCTGGGAAAGGAGGTGAGGG + Intronic
1129721353 15:77879739-77879761 GGCCCTTGTGAAGGAGGCTCAGG - Intergenic
1130045805 15:80443678-80443700 GGGCCTGAGGCAGGAGGTGAAGG + Intronic
1130385334 15:83406548-83406570 GTCCTTTGGGATGGAGGTGGAGG - Intergenic
1130856359 15:87843039-87843061 GGACCTTGGAAGGGAGGTGGGGG + Intergenic
1131090974 15:89624832-89624854 GGCCCACAGGAAGGAGGAGATGG - Exonic
1131132284 15:89908070-89908092 GGCCCCTGGAATGGAGGGGAGGG + Intronic
1131179960 15:90233047-90233069 AGCTCATGGGAAGGAGGTGGAGG - Intronic
1131262766 15:90896661-90896683 GGACTTAGGGGAGGAGGTGAAGG - Intergenic
1131271959 15:90953031-90953053 GGCCATGAGCAAGGAGGTGAGGG + Exonic
1132093008 15:98960815-98960837 ACCCCTAGGGAAGGAGGTGAGGG - Exonic
1132116972 15:99144505-99144527 GGACCTTAGGCAGGAGGTTAAGG - Intronic
1132385077 15:101394561-101394583 GGTCCTTAGTAAGGATGTGATGG - Intronic
1132472093 16:110559-110581 TGCACTTGGGCAGGATGTGATGG + Exonic
1132875087 16:2133623-2133645 GGGCCTTAGGAAGGATGTGAAGG - Intronic
1133030187 16:3007071-3007093 TGCCCTTGGGCAGGAGCTGATGG + Intergenic
1134243188 16:12520804-12520826 GGAGGTTGGGAGGGAGGTGAGGG + Intronic
1134519901 16:14913767-14913789 GGGCCCTAGGAAGGATGTGAAGG + Intronic
1134554030 16:15152470-15152492 GGGCCCTAGGAAGGATGTGAAGG - Intergenic
1134707573 16:16312421-16312443 GGGCCCTAGGAAGGATGTGAAGG + Intergenic
1134959970 16:18399704-18399726 GGGCCCTAGGAAGGATGTGAAGG - Intergenic
1135121876 16:19773231-19773253 GGCCCTGGGGAAAGGGGAGATGG + Intronic
1135421401 16:22307926-22307948 GGCCCTTTGGAAGGAGGCCGTGG + Intronic
1135465621 16:22682139-22682161 GGACCTTGGGAAAGAGTTTAAGG - Intergenic
1136501228 16:30670467-30670489 GGCACTTGGAAATGGGGTGAAGG - Exonic
1136613423 16:31380794-31380816 GGGCCTGGGGAAGGAGGGGAGGG + Intronic
1137327099 16:47451216-47451238 GGCCCTTGGAAAGCAGGTGCAGG + Intronic
1138420036 16:56892963-56892985 GGCCCTGGTGAAGGAGGAGCAGG + Exonic
1139916314 16:70430570-70430592 GGTCCATGGGTAGGAGGAGATGG - Intronic
1139937939 16:70584640-70584662 GGCTCTTGGGAAAGAGGCAAGGG - Intronic
1140416484 16:74777342-74777364 GGCCCTGGGGAAGGACCTGAGGG + Intergenic
1140462173 16:75148682-75148704 GGCCGAGGGGAAGGAGATGAGGG + Intronic
1140834825 16:78783579-78783601 TGCCTTTGGGAAGGAGAGGAAGG + Intronic
1141693828 16:85611013-85611035 GGCCCTTGGGCCAGGGGTGAAGG - Intergenic
1141788968 16:86220096-86220118 GGCCCTTCGGAAGGAGGGGTCGG - Intergenic
1141801078 16:86309708-86309730 GTCACTTGGGTAGAAGGTGAGGG - Intergenic
1141865203 16:86745488-86745510 GGTCCTTGGGGAGGAGGTTCTGG + Intergenic
1141994250 16:87626693-87626715 GACCCTTGGGAAGGTTGGGATGG + Intronic
1142090377 16:88206806-88206828 GGCCGTGGGGACGGAGGGGAGGG + Intergenic
1142117738 16:88368786-88368808 GGCCTTTGAGAAGGAGATCAAGG - Intergenic
1142124322 16:88402650-88402672 GGCCCTGAGAAAGCAGGTGACGG - Intergenic
1142480141 17:213993-214015 GGCCTTTGGGAATGAGATGGAGG + Intronic
1142685469 17:1574947-1574969 GGCCCTCGGGGAGGAGGCGAGGG + Exonic
1143200730 17:5111555-5111577 GACCCTTGGGTAGGGAGTGAAGG - Intronic
1143742891 17:8966681-8966703 GCCCCTGGGGAAGGGAGTGAGGG + Intergenic
1144504856 17:15821305-15821327 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1144636154 17:16910532-16910554 GGCCCTTGGGAAGAAACTGAAGG - Intergenic
1144645916 17:16973295-16973317 GGCCCTTAGGAAGAAACTGAAGG + Intergenic
1145169029 17:20639188-20639210 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1145203591 17:20968627-20968649 GGCCCTTAGGAAGAAACTGAAGG - Intergenic
1146655174 17:34630790-34630812 GGTCCCTGGGAAGGAGCTCAGGG - Intronic
1147392819 17:40121231-40121253 GGCCGTTGGGAAGGAACTGTTGG + Intergenic
1147969608 17:44212433-44212455 GGCCACTACGAAGGAGGTGAAGG - Exonic
1148546642 17:48524349-48524371 GGCTCCTGGGAAGGAGTTGGTGG - Intergenic
1148901456 17:50881473-50881495 AGCCCTTGGGGAGGATGAGAGGG + Intergenic
1149397927 17:56263847-56263869 GTCCTTTGGGATGGAGGTTAAGG - Intronic
1149495268 17:57113461-57113483 GGCCCTTGGGCTGGAGGGAAAGG + Intronic
1149702723 17:58668821-58668843 GGCCTTTGGGTAGGATGTTAGGG - Intronic
1150069223 17:62138058-62138080 GGCCTTTGCGGAGGAGGTGATGG - Intergenic
1150445286 17:65223701-65223723 GGTCCTCGAGAAGGAGGTGAGGG - Intronic
1151255214 17:72871503-72871525 GGCCTCTGGGGAGGAGGAGAGGG + Intronic
1151339151 17:73458667-73458689 AGAGCTTGGCAAGGAGGTGACGG - Intronic
1151817582 17:76478890-76478912 GACACTGGTGAAGGAGGTGAGGG + Exonic
1152130740 17:78474876-78474898 GGCCCATGTGACTGAGGTGAAGG - Intronic
1152267502 17:79304922-79304944 GGGCCAAGTGAAGGAGGTGAGGG - Intronic
1152686006 17:81694166-81694188 GGCCCTTGGGACTGAGGACATGG + Intronic
1152873512 17:82772350-82772372 GGCCCTCGGGGAGCTGGTGAGGG + Intronic
1153233262 18:2961183-2961205 GGGTCTTGGGCAGGAGGTCAGGG - Intronic
1153620513 18:6973288-6973310 GGCCCTTGGGGAGAAGCAGATGG - Intronic
1153770186 18:8409014-8409036 GGCCCTTAGGAGAGAGGTGGAGG - Intergenic
1154500049 18:14991595-14991617 GGCCTCTGGGAAAGAGTTGAGGG + Intergenic
1155020923 18:21896636-21896658 GGACCTTGGGAAGGAGGCCTGGG + Intergenic
1155364514 18:25036454-25036476 GGCCCAAGGGGAGGAGGTCATGG + Intergenic
1156258987 18:35427050-35427072 GGTCTTTGGGAAAGAAGTGATGG + Intergenic
1156527477 18:37780061-37780083 GTCCCATAGGAAGGAGGAGATGG + Intergenic
1157286025 18:46378009-46378031 GGCATTTGGGAAGAGGGTGAGGG + Intronic
1157491210 18:48125019-48125041 GGCCACTGGGAAGCAGGGGAGGG + Intronic
1157709853 18:49842833-49842855 GCCCCTTGGAAAGGTGGAGAGGG + Intronic
1157973748 18:52301509-52301531 GGCACTAGGGAAGGAGAGGAAGG - Intergenic
1159860887 18:73647936-73647958 GGCCCATGGGCAGGAGGTGAGGG - Intergenic
1160685918 19:436550-436572 GGCTCTGGGGAAGGATGAGAGGG + Intronic
1160726834 19:621093-621115 GGCCTTTGCGGAGGAGGTGATGG - Exonic
1160883214 19:1331928-1331950 GGCTCTCGGGAAGGAGGAGGGGG + Intergenic
1161417209 19:4153983-4154005 GGCACTTGGGGAGGCTGTGAAGG + Intronic
1162126021 19:8499901-8499923 GGCTCCTGGGAAAGAGCTGAGGG - Intronic
1162456223 19:10786629-10786651 GTCCCTGGAGAAGGAGGTGGAGG + Exonic
1162668548 19:12236142-12236164 GGCACTTGGGAATGTGGGGAAGG + Intronic
1162796141 19:13088613-13088635 GGGCCCAGGGATGGAGGTGAGGG - Intronic
1162796635 19:13090622-13090644 GGCCCTGGGGAAGGCGGCCAAGG + Intronic
1162875443 19:13617847-13617869 GGACCTTGGGGATGAGGAGAGGG - Intronic
1162933504 19:13968890-13968912 TGCCCCTGGGAGGGAGGTGGAGG + Exonic
1163509007 19:17724407-17724429 GGACTTTGGGAGGGAGGGGAGGG + Intronic
1163789403 19:19297642-19297664 GGCCCTGGGGAAGGGTCTGAGGG - Intronic
1164728276 19:30481828-30481850 GGACTTTGGGGAGGTGGTGAGGG - Intronic
1164868024 19:31620968-31620990 GGCCTTTGGGAAGTAATTGAGGG + Intergenic
1165112255 19:33509275-33509297 GGCCCCTGGGAAGAAGGGCACGG - Intronic
1165190883 19:34062464-34062486 GGGACTAGGGAAGGAGTTGAGGG - Intergenic
1165423345 19:35732916-35732938 GGTCCTGGGGATGGAGGTGCTGG + Exonic
1166746962 19:45146058-45146080 GGCCCTAGGGCAGGTGTTGAGGG + Intronic
1167144988 19:47676145-47676167 ACCCCTTGGGGAAGAGGTGAGGG + Intronic
1167422451 19:49412268-49412290 GGCCCTAGGGATGGAGGAAAAGG + Intronic
1167468964 19:49664916-49664938 GGCCCGTGAGAAGGAGGTCTGGG - Intronic
1167507810 19:49880418-49880440 GGCCCTTGAGAAGCACGTGTGGG + Intronic
1168224359 19:54983543-54983565 GGAGCTGGTGAAGGAGGTGATGG + Exonic
1168301184 19:55406118-55406140 GGCCCTTGGGCAGGTGGAGCTGG - Intronic
1168696612 19:58407487-58407509 GGCCCTTGGGTAGAATGTGTGGG + Intronic
925448021 2:3944279-3944301 AGTCCTTGGGAAGGATGTGAGGG - Intergenic
927845898 2:26472843-26472865 GGCCGGTGGGAGGGAGGTGGCGG + Intronic
927878733 2:26675825-26675847 GGCCTTTGGGAAGGAGCTGTTGG - Intergenic
928082572 2:28323939-28323961 GGCCCGTGAGAGGGAGGTCAAGG + Intronic
928126451 2:28619962-28619984 TGCCCGTGGCAGGGAGGTGAGGG + Intronic
928850959 2:35745518-35745540 GGACAGTGGGAGGGAGGTGAGGG - Intergenic
929830654 2:45344023-45344045 GGCTCTTGGGCAGCAGGAGAGGG - Intergenic
931067202 2:58600199-58600221 GGCCCTTAGAAAGGACATGAGGG - Intergenic
931769083 2:65481969-65481991 GGCCACTTGGAAGGAGGTGGGGG + Intergenic
933188275 2:79303254-79303276 GGGCCTTGTGAATGAGGTGTGGG + Intronic
933216639 2:79637370-79637392 GGCAATTGGGAAGGAGTTAAGGG + Intronic
933891002 2:86769819-86769841 GGGCCTGGGGAAGAAGGGGAGGG + Intronic
933947761 2:87301530-87301552 GTGCCAAGGGAAGGAGGTGAGGG + Intergenic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
934979670 2:98829488-98829510 GGCCCATGGGGAGGAGGTGAGGG + Intronic
935341117 2:102060769-102060791 GGCACATGGGCAGGAAGTGAAGG - Intergenic
935982534 2:108641458-108641480 GGCCCCTGGGATGGGGTTGATGG + Intronic
936332441 2:111560043-111560065 GTGCCAAGGGAAGGAGGTGAGGG - Intergenic
936598640 2:113873958-113873980 GGCCATTGTGAAGAAGGTGATGG + Intergenic
937260796 2:120585873-120585895 AGCCCTAGGGTAGGGGGTGAGGG + Intergenic
938149125 2:128866252-128866274 GGACATTGGGAGGGAGTTGATGG + Intergenic
938493219 2:131776699-131776721 GGCCTCTGGGAAAGAGTTGAGGG - Intergenic
938499263 2:131821954-131821976 GGCCTCTGGGAAAGAGTTGAGGG + Intergenic
939260552 2:139802828-139802850 GAACCATGGGAAGGAGGTGATGG - Intergenic
941721781 2:168820220-168820242 GGCACATAGGAAGGAAGTGATGG - Intronic
941753928 2:169164366-169164388 GTCCCTTGGGAAGGGGTTAAGGG + Intronic
942321759 2:174742153-174742175 GGCCCTGGGGAAGGAGGCAGAGG - Intergenic
942563545 2:177245090-177245112 GCCTCTTGGGGAGGAGATGAGGG - Intronic
946178309 2:217935341-217935363 GGCCCTCTGGCAGGAGATGATGG + Intronic
946395350 2:219441579-219441601 GGCCCCGCGGGAGGAGGTGAGGG + Intronic
947028324 2:225763899-225763921 GGCCCTTGGGAATGTGGGGGCGG + Intergenic
947363705 2:229372452-229372474 GGCCTGTGGGAGGGGGGTGAGGG + Intronic
947825485 2:233103453-233103475 GGCCCTTGGAATGGAGCTCAAGG + Intronic
948368616 2:237474071-237474093 TGCCCTCGGGTAGGAGGTGCTGG + Intergenic
948377687 2:237532464-237532486 GGCCCTTGGGAGTGAGGGGGCGG - Intronic
948393067 2:237626592-237626614 GGACCTGGGGAAGGATGGGAGGG - Intergenic
948424336 2:237877879-237877901 GGCCCTTGGGCAGGAGGATCGGG - Intronic
948654093 2:239466027-239466049 GGCTCTGGGGGTGGAGGTGATGG + Intergenic
948908492 2:240991344-240991366 GGCCCTGGGGAAGGTGCTGGAGG + Intronic
949043469 2:241859655-241859677 GGCCCCGGGGAAGAAGGTCAAGG - Intergenic
1168756826 20:324371-324393 CGCCCTTGGGAAGCAGGAGCTGG - Intergenic
1168761654 20:353854-353876 GGGCCTTGGGAAGAGGGTGTGGG - Exonic
1168821237 20:775061-775083 TGGCCTTGGGAGGGAGGAGAAGG - Intergenic
1169221106 20:3823581-3823603 GGCCTCTGTGAAGCAGGTGAGGG + Intronic
1169329716 20:4706682-4706704 GGGCCCTGGGAAGAAGGTGAGGG - Intergenic
1169342395 20:4806180-4806202 GGGCCTTGAGAAGGAGGCCAAGG + Intronic
1169355086 20:4898981-4899003 GGCCCTTGGGAGTGAGGCCAGGG + Intronic
1171200006 20:23233198-23233220 GGCCTTTGTGTAGGAAGTGAGGG + Intergenic
1171944996 20:31368628-31368650 GGTCCTTGGGAAGCAGGAGGTGG - Exonic
1172439576 20:34955957-34955979 GGACCTTGGGAAGGAGGGGAGGG + Intergenic
1172830438 20:37829473-37829495 GGCCATTGGGATGATGGTGAGGG + Intronic
1173248638 20:41352928-41352950 GACCCTTAGCAAGGAAGTGAAGG + Intronic
1173249219 20:41355849-41355871 GGCCCTTTGGCTGGAGGAGATGG + Intronic
1173793496 20:45842909-45842931 CTCCCTTGGAAAGGAGGTCAGGG + Intronic
1174338980 20:49884349-49884371 CCCCCCTGAGAAGGAGGTGACGG + Intronic
1174341058 20:49895782-49895804 GCCCCTAGGGAAACAGGTGAGGG + Intergenic
1174452521 20:50628935-50628957 TGCCCCTGGGAAGGAGCTCAGGG + Intronic
1174830789 20:53810540-53810562 GGTGCTTGTGAAGGAGATGAGGG + Intergenic
1175116276 20:56684842-56684864 GGCCTCTGGGTAGGAGCTGAAGG - Intergenic
1175594981 20:60223863-60223885 ACCCCCTGGGAAGGCGGTGAGGG - Intergenic
1176000814 20:62830498-62830520 GGCCCTGGGGAAGGAGGTCCTGG - Exonic
1176614683 21:9017688-9017710 GGCCTGTGGGAAAGAGTTGAGGG + Intergenic
1176710532 21:10146183-10146205 GGCCTCTGGGAAAGAGTTGAGGG - Intergenic
1178248069 21:30973285-30973307 GGCTCTGGGGAAGGAGGCGTAGG - Intergenic
1178417819 21:32418026-32418048 AGCCCTAGGGTAGGGGGTGAAGG - Intronic
1178671129 21:34592560-34592582 GGCCTCAGGGAAGGAGGTCAGGG - Intronic
1178891609 21:36524998-36525020 CGCCCATGAGAAGCAGGTGATGG - Intronic
1178974497 21:37209433-37209455 GGAGCTTGGGAAGGGGTTGAGGG - Intergenic
1179817860 21:43919304-43919326 GGAAATTGGGAAGGGGGTGAGGG - Intronic
1179883991 21:44305720-44305742 GGCTCTCGGGAAGAAGGTGTGGG + Intronic
1180073470 21:45450176-45450198 GTCCCTGGGGAAGGAGGGGAGGG + Intronic
1180821017 22:18827762-18827784 GGGCCTTGGGAAGAAGGATAAGG - Intergenic
1180840714 22:18957662-18957684 GGGGCTTGGGAAGGTGGGGATGG + Intergenic
1180993699 22:19953954-19953976 GGCCCATGGAAGGGAGGGGAGGG + Intronic
1181060773 22:20281112-20281134 GGGGCTTGGGAAGGTGGGGACGG - Intronic
1181191960 22:21148283-21148305 GGGCCTTGGGAAGAAGGATAAGG + Intergenic
1181207237 22:21262227-21262249 GGGCCTTGGGAAGAAGGATAAGG - Intergenic
1181583582 22:23841199-23841221 GGCTCGTGGGGAGAAGGTGAGGG + Intergenic
1182066250 22:27433751-27433773 GGCCCCTGGGACAGAGGTCAGGG - Intergenic
1183047396 22:35231047-35231069 GACGCTTGTGAAGGAAGTGAAGG + Intergenic
1183061473 22:35338819-35338841 GGCCCTCCTGAAGGAGGTGAGGG + Intronic
1183407299 22:37636585-37636607 GGGCTTGGGGAGGGAGGTGAGGG + Intronic
1183654896 22:39178949-39178971 GGCCTTCAGGGAGGAGGTGACGG + Intergenic
1183675137 22:39294944-39294966 GGCACTTGGACAGGAGGTGATGG - Intergenic
1184194838 22:42920542-42920564 GGCCTTTGGGAGGAAGGAGAAGG - Intronic
1184217456 22:43077189-43077211 GTACCTGGGGAAGCAGGTGAGGG - Intronic
1184458606 22:44625061-44625083 GGCCCTTGGGCAGCAGCTCAGGG - Intergenic
1184545492 22:45164427-45164449 GACCCTGGGGAGGGAGGTGCGGG + Intronic
1184676464 22:46045734-46045756 GTTCCTTGGGGAGCAGGTGAGGG + Intergenic
1184729092 22:46363404-46363426 TGCCCTTGGGAGGCAGGAGAGGG + Intronic
1184995030 22:48199235-48199257 GGTCCTGGGGAAGGGGGTGGGGG + Intergenic
1203219683 22_KI270731v1_random:33189-33211 GGGCCTTGGGAAGAAGGATAAGG + Intergenic
1203271144 22_KI270734v1_random:53638-53660 GGGCCTTGGGAAGAAGGATAAGG - Intergenic
950041997 3:9925744-9925766 AAGCTTTGGGAAGGAGGTGAGGG - Intronic
950120214 3:10476779-10476801 AGCCCTGAGGAAGGGGGTGAAGG + Intronic
950441479 3:13013332-13013354 GGCTTCTGGGAAAGAGGTGAGGG - Intronic
950873411 3:16248881-16248903 TGCACTTGGGAATGAGGCGATGG + Intergenic
953418252 3:42735176-42735198 GGCCGTGGGGGAGGAGGGGAGGG + Intronic
953436649 3:42882500-42882522 GCCCCTTGGGAGGGTGGGGAGGG + Intronic
953438353 3:42897503-42897525 GGCCCTGGGTAGGGAGGGGAAGG - Intronic
953916709 3:46925109-46925131 GGCCCTTGGGCAGCAGGGCAGGG - Intronic
954437144 3:50502453-50502475 GGCTCTTGGGGAGGAGGAGAAGG + Intronic
954631269 3:52048873-52048895 GGGGCCTGGGAAGGAGGGGAAGG - Intergenic
954656506 3:52197496-52197518 AGCACTTGGGGAGGAGGGGAAGG - Intergenic
954784896 3:53085353-53085375 GGCGCTTAGGAAGGAGGGAAGGG - Intronic
956658239 3:71573758-71573780 GAGCCTTGGGAAGGAGGGGTGGG - Intronic
959972195 3:112420677-112420699 GGCCCTTGAAAAGAAGGTAATGG + Intergenic
961473703 3:127134279-127134301 GCCCCCTTGAAAGGAGGTGAGGG - Intergenic
961906541 3:130268848-130268870 GGACCTTGAGGAGGTGGTGAGGG - Intergenic
962023812 3:131526995-131527017 GGCTCCTGGGAAGGAGGCGGGGG - Intergenic
962153831 3:132922875-132922897 GGCCGATGGGAAGGAAGTGCAGG - Intergenic
962263684 3:133930779-133930801 GGCCCATGGGAGGGAAGTGGGGG - Intergenic
962730531 3:138279549-138279571 GGCCTTGGGGAATGAGGTGGAGG + Intronic
962938360 3:140102447-140102469 GGCCCTTGGAAAGCAGGGCAGGG + Intronic
963062540 3:141236068-141236090 GGGCCAAGGGAATGAGGTGAAGG - Intronic
967137043 3:186521387-186521409 TGCCCTGGAGAAGGATGTGATGG - Intergenic
967271843 3:187739044-187739066 GGTCAATGGGAAGGAGGGGAGGG - Intronic
968460680 4:723400-723422 TGCCCTTGGGAAGCAGAAGAAGG + Intronic
968608707 4:1547247-1547269 AGCCCTTGGGCAGGGGGTGTGGG - Intergenic
968805327 4:2768268-2768290 GCCCCTGGGCTAGGAGGTGAGGG + Intergenic
968950397 4:3688518-3688540 GGCCCTGAGGGAGGAGGTGCAGG + Intergenic
969918292 4:10511520-10511542 GGCCCTGAGGAAGGAGGTGGAGG - Intronic
970445076 4:16116655-16116677 GTCCCTAGGGAAGGAGATGTTGG + Intergenic
971181784 4:24335335-24335357 GTCCTTAGGGAAGTAGGTGAGGG + Intergenic
971294283 4:25375672-25375694 AGCCCCTGGGAAGTAGATGACGG - Intergenic
972325892 4:38014823-38014845 GGCCTTTAGGAAGGAGCTGCAGG + Exonic
972649313 4:41001133-41001155 TGCCATTGGGAAGGGGCTGATGG - Intronic
973293214 4:48490297-48490319 GGCCCTGGGGGACGAGGTGCTGG + Exonic
975545326 4:75555002-75555024 GGAGGTTGGGAAGGAGGTGAGGG + Intergenic
977107032 4:92899928-92899950 AGCCCTCGTCAAGGAGGTGAGGG + Intronic
977860749 4:101956998-101957020 GGAACTTAGGAAGGAGATGATGG - Intronic
979014733 4:115419072-115419094 GGCCCTTGGGGAGGAGGGGCAGG - Intergenic
979342561 4:119543800-119543822 GGTCATTGGGAAGGAGGTATAGG - Intronic
981328286 4:143477423-143477445 GGCACTTGGGAAGGCAGAGAAGG + Intergenic
981584411 4:146285705-146285727 GAGCCTTGGGAAGGAGGCCAAGG + Intronic
981715033 4:147744403-147744425 GGCCCTTGGAAAGCAGGTTGAGG + Intronic
983467172 4:168108856-168108878 TGCCATGGGGAATGAGGTGAAGG - Intronic
984959262 4:185078629-185078651 GTCCCTTGGGAGGCAAGTGAGGG + Intergenic
984987967 4:185350056-185350078 GGCCATTGAGAAGGAGATTAAGG - Intronic
985655716 5:1130521-1130543 CGCCCTGGCTAAGGAGGTGAGGG - Intergenic
985655728 5:1130560-1130582 CGCCCTGGCTAAGGAGGTGAGGG - Intergenic
986270620 5:6227709-6227731 GGCCCTAGGGAGGCACGTGAGGG - Intergenic
986284062 5:6347161-6347183 GGCCCTGAGGAATGAGGAGAGGG - Intergenic
986691103 5:10314625-10314647 GGAACTTTGGAAGGAGTTGATGG + Intergenic
987419272 5:17699456-17699478 AGGCCATGGGAAGGAGGTGAGGG + Intergenic
988497817 5:31759506-31759528 GTCCCTTGGCAAGGAGGTTTTGG - Intronic
988979036 5:36545923-36545945 GGAGGGTGGGAAGGAGGTGAGGG + Intergenic
990173081 5:53076931-53076953 GGCACTAGGGAAGGTGGGGAGGG - Intronic
990823612 5:59872075-59872097 GGTCAATGGGAAGGAAGTGAAGG + Intronic
990907824 5:60822588-60822610 GGCACTTGGGAGGAAGGTCAAGG + Intronic
992886474 5:81165192-81165214 GGACCCTGGGGAGGAGGAGATGG + Intronic
993380952 5:87207202-87207224 GGACCTTGGGAGGGAGGTGAGGG - Intergenic
994166595 5:96615594-96615616 GGCCCCAGGGAAGGAGGCCAGGG + Intronic
995422226 5:111980691-111980713 GAGCCTTGGGTAGGAGGTCAGGG - Intronic
995707930 5:115004461-115004483 TGGCCTTGGGATGGAGGTGGCGG - Intergenic
996994917 5:129684258-129684280 GCCACTTGTGGAGGAGGTGAAGG + Exonic
997370942 5:133359513-133359535 GGCCCTTGGCAGGGCAGTGATGG + Intronic
997595118 5:135102194-135102216 GAGCCTGGGGAAGGAGGTCACGG - Intronic
997837831 5:137210717-137210739 GGCAGCTGGGATGGAGGTGAAGG + Intronic
997894728 5:137705838-137705860 TTCCCTTGGGATGGAGGTGCTGG + Intronic
999230967 5:150061554-150061576 AGCCTTTGGGAAGGTGGTGGAGG - Exonic
999240505 5:150124790-150124812 GGCCTTTGGGCAGGTGGTGGAGG - Exonic
999251946 5:150188023-150188045 GGCTGTGGGGATGGAGGTGATGG + Intergenic
999423618 5:151466866-151466888 GGGCATTGGGAAGAAGGTGAGGG - Intronic
999434266 5:151550868-151550890 GGACCTAGGGAGGGAGATGAGGG + Exonic
999687918 5:154118809-154118831 GGCTCTTGGGAAGGAGGCCTTGG - Intronic
999755161 5:154658758-154658780 GGCCCAGGGGAAGGAGAAGATGG - Intergenic
1000044282 5:157508862-157508884 GCCCCTTGGGAACCAAGTGAAGG + Intronic
1001051526 5:168418265-168418287 GGCCCTCGGGAAGGAGGGGGAGG - Intronic
1001101053 5:168814559-168814581 GGCCCTAGAGAAGGAGGTTAAGG - Intronic
1001125691 5:169017332-169017354 GGGCATTGGGAAGGAGTCGAAGG - Intronic
1001436546 5:171703759-171703781 GGCCATGAGGGAGGAGGTGACGG - Intergenic
1001522231 5:172403006-172403028 GGCCCTGGCCAAGGAGGTGCTGG - Intronic
1001557668 5:172647514-172647536 GCCCCGTGGGATGGAGGGGAAGG - Intronic
1001651326 5:173318197-173318219 GACCTGTGGGGAGGAGGTGAAGG - Exonic
1001774984 5:174321772-174321794 GCCCCTGGAGAAGGAGGTGAGGG + Intergenic
1002075771 5:176707649-176707671 GGCCCTCCGCAAGGAGGAGAGGG + Intergenic
1002309798 5:178307458-178307480 GGCTCTGGGGAAGGAGGAGCTGG - Intronic
1002518348 5:179775587-179775609 GGGCCTTGGGAGGGAGGAGGAGG - Exonic
1002523457 5:179803705-179803727 GGCCCCTAGGAAGGAAGCGAGGG - Intronic
1002533877 5:179865485-179865507 GGCGTTTGGGAAGGTGGTCATGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003191615 6:3879894-3879916 GATCCCTGGGATGGAGGTGACGG + Intergenic
1003266221 6:4566869-4566891 GGCTTATGGGAAGGATGTGAAGG - Intergenic
1003415239 6:5901479-5901501 GGAAGGTGGGAAGGAGGTGAGGG + Intergenic
1003950196 6:11109399-11109421 GGCCCTGGGTAGGGAGGAGAAGG + Intronic
1004039190 6:11959146-11959168 GGCCGTGGGGAAAGAAGTGAAGG - Intergenic
1004244495 6:13960116-13960138 AGTCATTGGGAAGAAGGTGAAGG + Intronic
1004439221 6:15631695-15631717 GGCCCTGGGCAATGAGGAGATGG - Intronic
1004546048 6:16599188-16599210 GGCCCTTTAGAGTGAGGTGAAGG - Intronic
1004655263 6:17653719-17653741 GCCTCTGGGGTAGGAGGTGACGG + Intronic
1005492891 6:26362902-26362924 GGCCTTAGGGATGGAGGAGAGGG - Intergenic
1005852149 6:29829797-29829819 TGCTCTGGGAAAGGAGGTGAAGG - Exonic
1006042851 6:31270082-31270104 GGCTCTGGGAAAGGAGGAGAAGG + Exonic
1006364923 6:33609747-33609769 GGCCCTTGGGAGGCTGGGGAGGG + Intergenic
1006641639 6:35492441-35492463 GGTCCTTGGGCTGGAGGTGGGGG - Intronic
1006793782 6:36719858-36719880 AGCCATAGGAAAGGAGGTGAGGG + Intronic
1006823686 6:36918175-36918197 GGCACTCGGGGAGAAGGTGAGGG + Intronic
1006916066 6:37594614-37594636 GGACCGGGGGAAGGAGGTGGGGG - Intergenic
1007432500 6:41784949-41784971 GGCCCTTGGGGAGGAGGAGCGGG + Exonic
1007520931 6:42451631-42451653 GGCGCATGGGGAGGAGGAGAGGG - Intronic
1007747361 6:44051383-44051405 GGACCTGGGGTAGGAGGAGACGG + Intergenic
1011237098 6:85229754-85229776 GGAGCCTGGGAAGGAGGGGAAGG - Intergenic
1012475765 6:99613712-99613734 GGCACTTGGGATGGTGGTGGTGG - Exonic
1012956477 6:105576329-105576351 GACACTGGGGAAGGAGGTCAAGG - Intergenic
1013304864 6:108838584-108838606 GGCCCTTGAGAAGGCGGGAATGG + Intergenic
1013480641 6:110549896-110549918 GGACCTTGAGAAGGAGGTGGAGG - Intergenic
1013698005 6:112727258-112727280 GGCCCTTGGAAAACAAGTGAGGG + Intergenic
1014847915 6:126302321-126302343 TGACCTTAGGAAGGAAGTGAGGG + Intergenic
1015822774 6:137281286-137281308 GGCTGTTGGAATGGAGGTGAAGG + Intergenic
1015935541 6:138403857-138403879 GTCCCTTGCGGAGGAGGTGGTGG - Intronic
1016780295 6:147950606-147950628 GCCCATTAGGAAGGAGGAGAAGG - Intergenic
1017998271 6:159553990-159554012 AGGACTTGGGAAGGAGGTCAGGG - Intergenic
1018795686 6:167183902-167183924 GGCCTCGGGGAAGGTGGTGATGG - Intronic
1018820631 6:167371161-167371183 GGCCTCGGGGAAGGTGGTGATGG + Intronic
1018834195 6:167471002-167471024 GGCCCTTGGGAGAGAGGCCATGG + Intergenic
1018873915 6:167803721-167803743 GGATCTTGAGAAGGTGGTGATGG - Intergenic
1019018979 6:168901777-168901799 GGCCCTTGGGAAGAACAAGAGGG + Intergenic
1019179201 6:170176410-170176432 GGCGCCTGGGAAGGACGGGAGGG + Intergenic
1019364297 7:623918-623940 GGATCTAGGGAAGGAGGTGGAGG + Intronic
1019512729 7:1426094-1426116 GGCCCTGGGGAGGGTGCTGAGGG - Intergenic
1019519155 7:1452885-1452907 GGCCCTGGGGAAGGAGCTTGGGG - Intronic
1019816498 7:3204906-3204928 GGCACATGGGAAGGAGGGCAGGG - Intergenic
1020642066 7:10767893-10767915 TGGCCTTGGGAAGGAAGTGGGGG - Intergenic
1022544739 7:31175471-31175493 GGAGGTTGGGAAGCAGGTGATGG - Intergenic
1023844501 7:44113233-44113255 GCACCTAGGGAAGCAGGTGAGGG - Exonic
1024135424 7:46402500-46402522 GGCCTTTTGGAAGGTGGAGATGG + Intergenic
1024381265 7:48698840-48698862 GGTGCTTGGGAAGGACGAGATGG + Intergenic
1025613202 7:63096230-63096252 GGCCCTGGGCAAGGTGGAGAGGG + Intergenic
1025942147 7:66082488-66082510 GGCCCTGGGCAAGGTGGAGAGGG - Intronic
1026824512 7:73573124-73573146 GTCCCTAGGGAAGGTGGGGAAGG - Intronic
1026946373 7:74318896-74318918 GGTCCTGGGGAAGGGGGTCAAGG + Intronic
1026952058 7:74354133-74354155 GGCTGTTGGGAAGGAGGGAATGG - Intronic
1027969804 7:85064584-85064606 GGCCTTAGTGAAGGAGGCGAGGG - Intronic
1028184926 7:87771669-87771691 GGCCCCAGGGATGGGGGTGAAGG + Intronic
1028554281 7:92105466-92105488 GCCTCTTGGGAAGGGGATGAGGG + Intronic
1029460720 7:100692782-100692804 TGCCATTGGGAAGGATTTGAGGG - Intergenic
1029481660 7:100817167-100817189 GAGCCTGGGGAAGGGGGTGAGGG - Intronic
1029918767 7:104239662-104239684 TGTCCTTGAGATGGAGGTGAGGG + Intergenic
1030091238 7:105861060-105861082 GGCCCTGGGGAAGGAGGATGAGG + Intronic
1031001500 7:116420806-116420828 AGCCCTTGAGATGGAGGTGATGG - Intronic
1031986258 7:128166541-128166563 GGCCTTTGGGAGGAAGGGGAAGG + Intergenic
1032486375 7:132290475-132290497 AGCCAATGGGAAGGAGGTGAGGG - Intronic
1033030450 7:137820938-137820960 GGCCCCAGGGGAGGAGGGGAGGG - Intronic
1033452830 7:141476996-141477018 GGTCCTTGGGAATGAAGTGTAGG - Exonic
1033535976 7:142312627-142312649 GGCACTGGGGAGGGAGCTGAGGG - Intergenic
1033654541 7:143363575-143363597 GCCCCATGGGGAGGAGATGAAGG + Intergenic
1034440074 7:151081794-151081816 CGCAGTTGGGAGGGAGGTGAAGG + Exonic
1034978927 7:155463512-155463534 GGCCCTTGGTGAGGAGGAGGAGG - Exonic
1035171256 7:157018515-157018537 GGCGCTGGGGAAGGAGGTCCCGG + Intergenic
1035330972 7:158097232-158097254 GGCACTGGGGAAGGAGGTGGAGG + Intronic
1035622817 8:1047141-1047163 GGGTCTGGGGAAGGAGATGATGG - Intergenic
1036580223 8:10067172-10067194 GGTTCTTGGGAAGGGGGAGATGG - Intronic
1037994415 8:23342048-23342070 GGCCCTTTGGGAGGAAGTGGAGG + Intronic
1039079052 8:33718054-33718076 ATCCCTTGGGATGGAGGGGAGGG + Intergenic
1039221579 8:35337216-35337238 TGATATTGGGAAGGAGGTGAGGG - Intronic
1039376264 8:37037311-37037333 GGCCATAGGGAAGAAGATGAAGG - Intergenic
1039461926 8:37752272-37752294 GGGCAGTGGGAAGGAGGTGCAGG - Intronic
1039839161 8:41281201-41281223 AGGCCTTGGGGAGGAGGTGCAGG - Intronic
1039900256 8:41746734-41746756 GGCCCTGGGGAAGGTGGAGGAGG + Intronic
1040599744 8:48871445-48871467 AGCCCATGGACAGGAGGTGAAGG + Intergenic
1041238924 8:55832114-55832136 AGCCCTGGGGAAGGAGGGGAGGG + Intergenic
1042518192 8:69681848-69681870 GGCCCTTGTGATGGATTTGAAGG - Intronic
1043647657 8:82541258-82541280 GGCTCTTCTGAAGGTGGTGAGGG + Intergenic
1044915106 8:97104852-97104874 TGCCCTTGTGAAGCAGGTGTGGG + Intronic
1045115419 8:98974577-98974599 GGCCCTGCGGGAGGAGGAGAGGG + Intergenic
1045279954 8:100741590-100741612 GGTCCTTAGGCAGGAGGTCAGGG - Intergenic
1045353711 8:101366024-101366046 TACCCTTGGGGAGGAGGTGGGGG - Intergenic
1047524879 8:125624430-125624452 AGCACTTGGGAAGCATGTGAGGG + Intergenic
1048696541 8:137034769-137034791 GTTCCTTAGGAGGGAGGTGAGGG - Intergenic
1049644245 8:143728928-143728950 GGCCCCAGAGAAGGGGGTGAGGG + Intronic
1049671674 8:143872827-143872849 GGCCATCGGGAAGGAGGTTGTGG - Exonic
1049759679 8:144326396-144326418 GGCCCTTGGGTCAGAGGTTAGGG + Intronic
1051686167 9:19660173-19660195 TGCCCTAGGGAAGCAGGTGGAGG + Intronic
1051711199 9:19933030-19933052 AGCCCTGGGGCAGGAGGTGGGGG + Intergenic
1052146546 9:25057441-25057463 GGCCCATAGAAAGGAGTTGAAGG + Intergenic
1052212813 9:25927230-25927252 GGCCTTAGGGAAGGAGGAAATGG + Intergenic
1052866243 9:33466278-33466300 GGCCCTTGGGAGGGAGTGGGAGG - Intronic
1053100132 9:35364610-35364632 AGTGCTTGGGAAGGAGGGGAGGG - Intronic
1053463061 9:38285422-38285444 GGCCCTGGGGCAGGACGTGCTGG - Intergenic
1053478573 9:38399531-38399553 GGTCCTAGGAAGGGAGGTGAGGG - Intergenic
1053647509 9:40131881-40131903 GGCCTCTGGGAAAGAGTTGAGGG - Intergenic
1053758219 9:41331962-41331984 GGCCTCTGGGAAAGAGTTGAGGG + Intergenic
1054328487 9:63729835-63729857 GGCCTCTGGGAAAGAGTTGAGGG - Intergenic
1054537070 9:66244289-66244311 GGCCTCTGGGAAAGAGTTGAGGG + Intergenic
1055146112 9:72936898-72936920 GTTGGTTGGGAAGGAGGTGAGGG - Intronic
1056765336 9:89441569-89441591 AGACCATGGGAAGGAAGTGAGGG + Intronic
1057915670 9:99053396-99053418 GGACCTTGGGGAGCAGGGGATGG + Intronic
1058547675 9:106078073-106078095 AGCCATTGGGACGGGGGTGAGGG - Intergenic
1058561975 9:106239963-106239985 GGCCCTGGGGAACGAGGTGAGGG + Intergenic
1058670500 9:107357119-107357141 AATCCTTGGGATGGAGGTGATGG + Intergenic
1059653246 9:116334609-116334631 GGACTTTGGGCAGTAGGTGAAGG + Intronic
1059816107 9:117917514-117917536 GTATCTTGGGAAGGAGGTGATGG + Intergenic
1060104001 9:120862331-120862353 GGACTTGGGCAAGGAGGTGAAGG - Intronic
1060553686 9:124497684-124497706 GGTCCTTGGGCAGTGGGTGATGG - Intronic
1061008602 9:127942437-127942459 AGTCCTTGGGAAGGAGCTCAGGG + Exonic
1061055780 9:128222262-128222284 GTCCATTGAGAAGGAGGTGGAGG + Exonic
1061293872 9:129666740-129666762 AGCCCTTGGTAAGAAGGGGAGGG + Intronic
1061714724 9:132511469-132511491 GGCACTGGGGAAGGAGGAGTGGG - Intronic
1061836629 9:133333848-133333870 GGCCCTAGGGAGGGAGGGGGAGG - Intronic
1061987985 9:134141325-134141347 GGACCCTGGGAGGGAGGGGAAGG + Intronic
1062082735 9:134632959-134632981 AGACCATGAGAAGGAGGTGATGG + Intergenic
1062368343 9:136222851-136222873 GGGCCTTGGGACAGGGGTGAGGG + Intronic
1062460932 9:136662315-136662337 GGCCCATGGTGAGGGGGTGACGG - Intronic
1062462327 9:136667077-136667099 TGCCCGTGGGAAGCAGGTGTGGG + Intronic
1062598826 9:137311108-137311130 GGCCCTGGGGCTGGAGGTGTTGG + Intronic
1062719866 9:138034370-138034392 GGGCTTTGGGATGGTGGTGAGGG + Intronic
1062723070 9:138054454-138054476 GGCCCTTGGGGAAGAGCTGGGGG + Intronic
1202795293 9_KI270719v1_random:115178-115200 GGCCTCTGGGAAAGAGTTGAGGG - Intergenic
1186121343 X:6365199-6365221 GTCCATTGGGAAGGAAGGGATGG - Intergenic
1186662888 X:11687267-11687289 ATCCCTTGGGAAGGCAGTGATGG + Intergenic
1187842531 X:23504015-23504037 AGCCCTTGGGGAGGGGGTCATGG - Intergenic
1188003200 X:25001108-25001130 GGCCCTGGGAAAGCAGGTGTTGG + Intergenic
1188328308 X:28835236-28835258 GGCCCAAGGGAAGTAGTTGAGGG - Intronic
1188722215 X:33536832-33536854 GGAGATTGGGAAGGAGGTAAGGG - Intergenic
1188911318 X:35851366-35851388 GGCCCTGGGTAAGGAGAAGAAGG + Intergenic
1189726311 X:43970624-43970646 GGCCCCTGGGAAGAAGCTGTTGG - Intronic
1190452887 X:50598427-50598449 TGCCCTTGGGGAGGAGGTGGAGG - Exonic
1190539956 X:51467054-51467076 GGACCTTGGGAAATAGATGAGGG + Intergenic
1192433732 X:71129531-71129553 GACCTTTGGGGAGGAGGGGAGGG + Intronic
1193286767 X:79723387-79723409 GGCCCTGGGTAGGGAGGGGAAGG - Intergenic
1194073069 X:89351106-89351128 GGCTTTTGGGAAAGAGATGAGGG - Intergenic
1194227558 X:91279783-91279805 AGCCTTTGGGATGGAGGTGGGGG + Intergenic
1195285376 X:103377555-103377577 CGCCCTTTGGGAGGAGGTGAAGG + Exonic
1196005677 X:110834825-110834847 GGCAATTGGGATGGAGATGAAGG - Intergenic
1198315851 X:135465234-135465256 GGACCATGGCAAGGAGGTGTAGG - Intergenic
1198557626 X:137812134-137812156 GGCCGTTGGAAAGGCTGTGAAGG + Intergenic
1198597261 X:138250078-138250100 GGCCCTTGGGCTGGGGGTGGTGG + Intergenic
1199954776 X:152734391-152734413 GGCCTTTGGGAAGCAGAGGATGG + Intronic
1199996720 X:153030652-153030674 GGCCCTTTGGAGGGAGGTGGGGG - Intergenic
1200234726 X:154462734-154462756 GGCCCATGGGTAGGAGGGGAAGG - Intronic
1200727304 Y:6686846-6686868 GGCTTTTGGGAAAGAGATGAGGG - Intergenic
1200728456 Y:6702621-6702643 GGCTTTTGGGAAAGAGATGAGGG - Intergenic