ID: 915276112

View in Genome Browser
Species Human (GRCh38)
Location 1:154789364-154789386
Sequence CCCTGGATATCCTGGCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 160}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915276112_915276119 -2 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276119 1:154789385-154789407 GGATTAGGAGCTGGATATTTTGG 0: 1
1: 1
2: 13
3: 62
4: 378
915276112_915276127 18 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276127 1:154789405-154789427 TGGCAGGGTGGTGGTCGGTGGGG 0: 1
1: 0
2: 2
3: 50
4: 457
915276112_915276134 28 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276134 1:154789415-154789437 GTGGTCGGTGGGGCAGGGGGGGG 0: 1
1: 0
2: 12
3: 142
4: 1404
915276112_915276129 23 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276129 1:154789410-154789432 GGGTGGTGGTCGGTGGGGCAGGG 0: 1
1: 0
2: 5
3: 95
4: 732
915276112_915276120 2 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276120 1:154789389-154789411 TAGGAGCTGGATATTTTGGCAGG 0: 1
1: 0
2: 0
3: 26
4: 216
915276112_915276130 24 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276130 1:154789411-154789433 GGTGGTGGTCGGTGGGGCAGGGG 0: 1
1: 0
2: 9
3: 108
4: 832
915276112_915276132 26 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276132 1:154789413-154789435 TGGTGGTCGGTGGGGCAGGGGGG 0: 1
1: 0
2: 7
3: 94
4: 810
915276112_915276128 22 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276128 1:154789409-154789431 AGGGTGGTGGTCGGTGGGGCAGG 0: 1
1: 0
2: 5
3: 78
4: 702
915276112_915276124 13 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276124 1:154789400-154789422 TATTTTGGCAGGGTGGTGGTCGG 0: 1
1: 0
2: 7
3: 58
4: 1105
915276112_915276121 3 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276121 1:154789390-154789412 AGGAGCTGGATATTTTGGCAGGG 0: 1
1: 0
2: 3
3: 24
4: 225
915276112_915276123 9 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276123 1:154789396-154789418 TGGATATTTTGGCAGGGTGGTGG 0: 1
1: 0
2: 0
3: 38
4: 347
915276112_915276126 17 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276126 1:154789404-154789426 TTGGCAGGGTGGTGGTCGGTGGG 0: 1
1: 0
2: 2
3: 28
4: 226
915276112_915276125 16 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276125 1:154789403-154789425 TTTGGCAGGGTGGTGGTCGGTGG 0: 1
1: 0
2: 1
3: 40
4: 352
915276112_915276131 25 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276131 1:154789412-154789434 GTGGTGGTCGGTGGGGCAGGGGG 0: 1
1: 0
2: 5
3: 84
4: 846
915276112_915276133 27 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276133 1:154789414-154789436 GGTGGTCGGTGGGGCAGGGGGGG 0: 1
1: 0
2: 8
3: 123
4: 1209
915276112_915276122 6 Left 915276112 1:154789364-154789386 CCCTTTTGCCAGGATATCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 160
Right 915276122 1:154789393-154789415 AGCTGGATATTTTGGCAGGGTGG 0: 1
1: 0
2: 2
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915276112 Original CRISPR CCCTGGATATCCTGGCAAAA GGG (reversed) Intronic
900351558 1:2237419-2237441 ACCTGGCTCTCCTGGCAACATGG - Intronic
904587657 1:31588937-31588959 CTCTGGACGTCCTGGCAAACAGG - Intergenic
907986944 1:59541437-59541459 AGCTGGAAATCCTGGCAAGATGG + Intronic
915276112 1:154789364-154789386 CCCTGGATATCCTGGCAAAAGGG - Intronic
915511736 1:156390416-156390438 CCCTGGAAATCCAGGCAAAAGGG - Intergenic
916280027 1:163040203-163040225 CCCTGGATTTCTTGCCCAAATGG + Intergenic
919887611 1:201946331-201946353 CTCTAGACATCTTGGCAAAATGG + Exonic
920700015 1:208210716-208210738 TCCTGGTTCTCCTGGCAGAAAGG - Intronic
922439372 1:225640107-225640129 CCTTGAATATTTTGGCAAAAAGG + Intronic
922465373 1:225842813-225842835 CCCTGGAGAGCCTGGCATCAGGG + Intronic
923578321 1:235182392-235182414 AACTGGATCACCTGGCAAAAAGG - Exonic
924941500 1:248815393-248815415 CCTTGTATATCCAGCCAAAATGG - Intronic
1063565974 10:7172386-7172408 CCCTGGAGATTGTGGCAAGATGG - Intronic
1064343282 10:14506639-14506661 TCGTGGATATCCTGGACAAAGGG - Intergenic
1064556087 10:16548454-16548476 CCCTGGATATCAGGCCACAAAGG + Intergenic
1064969877 10:21054075-21054097 CTCAGGATATCAGGGCAAAATGG + Intronic
1066149245 10:32597796-32597818 CGCTGGATACCCAGGCAAACAGG - Intronic
1066208943 10:33217313-33217335 CCATGGATATGTTGGCTAAATGG - Intronic
1066519492 10:36199666-36199688 CCCTTGTTATCCTGGATAAATGG - Intergenic
1067725297 10:48766052-48766074 CCCTGGATAGCATTGCATAAGGG + Intronic
1073273538 10:102288143-102288165 CCATGGATGTCCCAGCAAAACGG - Intronic
1074040341 10:109781923-109781945 CCAAGGATGTGCTGGCAAAAAGG + Intergenic
1075677677 10:124307510-124307532 CCCTGGCTCTCCTGGAAAATGGG + Intergenic
1078543938 11:12232974-12232996 CCATGGATATGCTGGACAAAGGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1080788702 11:35499809-35499831 CCCAGGGAATCCTGGCAGAAGGG + Intronic
1083455953 11:62778739-62778761 CCCTGGTTGTCCTGTCAGAAAGG + Intronic
1086821196 11:91438031-91438053 CCATGGATATTCTGTCAAACAGG + Intergenic
1087266059 11:96062643-96062665 TCCTGGATATCCTGTCTAAGAGG - Intronic
1087925031 11:103910291-103910313 CCCTGGAGTTGCTGGCAAGATGG + Intronic
1091136755 11:133198110-133198132 ACATGGATATCCTTCCAAAATGG + Intronic
1092890330 12:12963833-12963855 CCCTGGATAATCTGGCTACAGGG - Intergenic
1093401379 12:18751042-18751064 CCCTGGAGTTTCTGGCACAAAGG + Intergenic
1095692030 12:45100649-45100671 CTCTGGATATCATGCTAAAAAGG - Intergenic
1096648018 12:53048653-53048675 CCCAGGATATCCTGGCCAGAAGG - Intronic
1098498303 12:71162603-71162625 CCCTGGAAAAGCTGGCAAAGTGG - Intronic
1099774689 12:87110309-87110331 GCCTAGATATCTTGGCTAAAAGG + Intergenic
1101169466 12:102075039-102075061 CACTGGTTATCCTGGCAAAATGG - Exonic
1101328012 12:103733473-103733495 TCCTAGTTCTCCTGGCAAAATGG + Intronic
1101572534 12:105967107-105967129 ACCTGGACATCCTGTCCAAATGG + Intergenic
1106519812 13:30486734-30486756 CCCTGGAGGTCTTGGCAAATAGG - Intronic
1106589959 13:31090536-31090558 CCCTGGGGAGCCTGGGAAAAGGG - Intergenic
1106998857 13:35521115-35521137 CCCAGGATAACCTTGCAATAAGG + Intronic
1109456920 13:62605186-62605208 CACTGGATATTATGGCAGAATGG + Intergenic
1111625209 13:90776043-90776065 CCATGTATATTCTGGAAAAAGGG + Intergenic
1113461578 13:110485763-110485785 CCCAGGGAATCCTGGCAAACCGG - Exonic
1115374790 14:32662625-32662647 CAGTGGATAGCCTGGCATAATGG - Intronic
1116332332 14:43612431-43612453 CCCTGAATTTCCTGGCACACAGG + Intergenic
1116587060 14:46719673-46719695 CTCTGGATATACAGACAAAAAGG - Intergenic
1117404556 14:55389277-55389299 CCCTGAATATCATGGTAAGACGG + Intronic
1117659442 14:57988320-57988342 CCCTGGCTATTCTGGGAGAATGG - Intergenic
1118082305 14:62374610-62374632 CCCTGGATGTCCTAGACAAAGGG - Intergenic
1119188651 14:72663539-72663561 GCGTGGCTATCCAGGCAAAAGGG - Intronic
1121673830 14:95735758-95735780 GCATGGATATGCTGGGAAAAGGG - Intergenic
1121823186 14:96988298-96988320 CTCAGGATATCTTGGCAGAAAGG + Intergenic
1122248332 14:100420105-100420127 CCCTGGAGATCCAGGCAACTAGG - Intronic
1122248750 14:100423465-100423487 CCCTTCAGATCCTGGCACAAAGG + Intronic
1129960215 15:79677466-79677488 CCCAGGATTTCCTGCCAAATGGG + Intergenic
1130762143 15:86831902-86831924 ACCTGGATATCCAGGCAGAGGGG - Intronic
1133963910 16:10517714-10517736 CCCTGGAGAGCCTGTCAAAATGG + Intergenic
1134456956 16:14401938-14401960 GCCTGGATATCCTGACACGAGGG - Intergenic
1135251314 16:20902558-20902580 CCCTTAATATCCTGGAATAATGG + Exonic
1140631711 16:76861402-76861424 CACTGGATCTCATGGCAAGATGG - Intergenic
1141070646 16:80951606-80951628 CTCTGGAGATCCTGGCAGACAGG + Intergenic
1141575094 16:84958595-84958617 CCTTTGAATTCCTGGCAAAAGGG + Intergenic
1143431836 17:6893763-6893785 CCCCGGATCTCCGGGCAAGATGG + Intronic
1144225929 17:13145972-13145994 ACCTGGATACACTGGAAAAAGGG + Intergenic
1144819838 17:18064602-18064624 CCCTGGATCACCTGCCAACAGGG + Intronic
1148222873 17:45876623-45876645 CTCTGGATATCCTGGCATAGGGG - Intergenic
1149905007 17:60518237-60518259 GCCTGGGTAACATGGCAAAATGG - Intronic
1150510503 17:65747455-65747477 CTATGGACATTCTGGCAAAATGG + Intronic
1155441792 18:25870020-25870042 CACTGGAAACCATGGCAAAAGGG - Intergenic
1155927962 18:31678086-31678108 CCCTGGCTTACCTTGCAAAAGGG - Intronic
1156386049 18:36606326-36606348 CCATGGATGGCATGGCAAAAAGG - Intronic
1160021142 18:75182880-75182902 ACCTGGATACCCTGGGAAAGGGG - Intergenic
1161865873 19:6831943-6831965 GCATGGATATCCTTGTAAAAGGG - Intronic
1162571366 19:11475805-11475827 GCCTGGCTAACATGGCAAAACGG - Intronic
1166132921 19:40757377-40757399 TCCTGGATATCCTGGTATCACGG + Exonic
928209345 2:29312092-29312114 CCCTGGGTAGCCTGGCAATATGG - Intronic
928822644 2:35380354-35380376 GCCGGGATAACCTGGCAAACAGG + Intergenic
928883506 2:36123034-36123056 CCCTGGGAATCCTGGCAAGGTGG - Intergenic
930554320 2:52876102-52876124 CCCTGTATATCCTTGAAAACTGG + Intergenic
931347532 2:61460318-61460340 GCCTGGATATGCTGGACAAAAGG - Intronic
935982698 2:108643192-108643214 CCCTGGATTTGTTGGCAAGATGG + Intronic
937554218 2:123133518-123133540 CCCTACATATACTGGCAAAGAGG - Intergenic
942201787 2:173578505-173578527 GCCTGGAGTTACTGGCAAAAAGG + Intergenic
944303946 2:198157752-198157774 TCCTGGATGTCCAGGAAAAATGG - Intronic
947426544 2:229988456-229988478 TCCTGGATATACTGGTGAAAAGG - Intronic
1169791210 20:9412680-9412702 CCCTGGATATCCTGTCACTTTGG + Intronic
1170222271 20:13953132-13953154 AGCTTGATATGCTGGCAAAAGGG + Intronic
1170597830 20:17818834-17818856 CCCTGGATTTTCTGCCCAAATGG - Intergenic
1172598860 20:36169693-36169715 CCCTGCATCTCCTGTCTAAATGG + Intronic
1172786384 20:37471596-37471618 CCCTGAATATCCCGTCTAAATGG + Intergenic
1173589893 20:44216634-44216656 CTCTGGGTACCCTGACAAAATGG + Intergenic
1176864282 21:14035120-14035142 GCCTGGGGATCCTGTCAAAATGG - Intergenic
1178703842 21:34856763-34856785 TCTGGGAAATCCTGGCAAAATGG - Intronic
1179959713 21:44761229-44761251 CCCTGGAGCTCCTGGGAAGAGGG + Intergenic
1180417848 22:12785333-12785355 CCCAGGACATCAAGGCAAAATGG + Intergenic
1181496804 22:23291884-23291906 CTCTGGATATCCCTGCAGAAAGG + Intronic
1181808536 22:25390073-25390095 CCCTTGATATCTTTGCAAAAAGG + Intronic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
1182304751 22:29360073-29360095 CACTGGACTTCCTGGTAAAAGGG + Intronic
949693533 3:6667791-6667813 GCCTGGATGTCCAGGCAGAAGGG + Intergenic
949907015 3:8866201-8866223 CCCTAGAAATTCTGTCAAAAAGG + Intronic
951282957 3:20775335-20775357 ACCTGAGTATCATGGCAAAATGG - Intergenic
953042694 3:39268970-39268992 CCCTGGGTATCCTGGGAATTTGG + Intronic
953276044 3:41499422-41499444 CCCAGTATTTCCTGGCAAAGTGG + Intronic
955732097 3:61997856-61997878 CCCTGGGACTCCTGGTAAAAGGG - Intronic
961331419 3:126143346-126143368 CCATGGATATCCTGGACAAAGGG + Intronic
963955942 3:151253767-151253789 TCCTGGACAGCCTGGCAATATGG - Intronic
964287042 3:155129348-155129370 ACCTGGATATCCTGGAAGGAAGG - Intronic
967714506 3:192747060-192747082 GCATGGATATGCTGGCCAAAGGG - Intronic
968713549 4:2138169-2138191 CCCTGAACATCCTGGCACACAGG + Intronic
971162127 4:24144110-24144132 ACCTGCATATCCTGGCAAATAGG - Intergenic
972053255 4:34767429-34767451 ACCTAAATATCATGGCAAAAGGG + Intergenic
977932331 4:102762117-102762139 CCCTGAATATCTTGGCTTAAAGG + Intergenic
978711071 4:111781809-111781831 GCCTGGATATACTGGAAAAAGGG - Intergenic
979783492 4:124686019-124686041 CTCTTGATTTCCTGGCAGAAAGG + Intronic
980588725 4:134855123-134855145 CCCTGGATAGCCTGGCAGGGTGG + Intergenic
982466940 4:155743538-155743560 CCCTGCATTACCTGACAAAATGG - Intergenic
985713655 5:1444216-1444238 CCCGGGAAATCCTGTCCAAACGG + Intronic
986780233 5:11058523-11058545 GCCTGGATGTCCAGGCAGAAGGG + Intronic
987528135 5:19080132-19080154 CCCTGGATATCCTGACTAGGAGG - Intergenic
992821631 5:80503716-80503738 CCCAGGCTATGATGGCAAAAGGG - Intronic
993765906 5:91858128-91858150 GCCTGAATATCGTGGCCAAAAGG - Intergenic
994299970 5:98135705-98135727 CCGTGGATACCCAGGCAAACAGG + Intergenic
995400587 5:111736606-111736628 CCCTAGATTCCCTGACAAAATGG - Intronic
996900341 5:128537207-128537229 CTTTGGATATTCTGGCAAAGGGG + Intronic
997524095 5:134541474-134541496 CCTTGGATACCCTGGTGAAAGGG + Intronic
997732345 5:136191017-136191039 CCCTGGAGAACCTGGCAGGAGGG - Intergenic
998740588 5:145196293-145196315 CTCTGTTTATTCTGGCAAAATGG - Intergenic
998926064 5:147127710-147127732 ACCTGGATGTCCAGGCAGAAGGG - Intergenic
999954616 5:156686955-156686977 CATTGGATATCCTTGAAAAATGG - Intronic
1001171252 5:169420876-169420898 CCCTGGTTGTCCTGGCAGGAGGG + Intergenic
1007476343 6:42122322-42122344 CCCTGGAGACCCTGCCTAAATGG + Intronic
1008858944 6:56125566-56125588 ACCTGGATTTTATGGCAAAAAGG - Exonic
1009378044 6:62995580-62995602 CTCTGTCTCTCCTGGCAAAATGG - Intergenic
1019263950 7:101826-101848 CCGTGGATTTCAAGGCAAAAGGG + Intergenic
1021910890 7:25385234-25385256 CCCTGGAGATCCCTGCAAGAAGG + Intergenic
1022857211 7:34326867-34326889 GCCTGGATATGCTGGACAAAGGG + Intergenic
1024551236 7:50564181-50564203 CCCTGGAAGTCCTGGCAAAGTGG - Intronic
1027776574 7:82472849-82472871 CTCAGGATATGCGGGCAAAAAGG - Intergenic
1028763800 7:94526850-94526872 TCCTGGCAATCTTGGCAAAAAGG + Intronic
1030803031 7:113877754-113877776 TCCTGGCTATCCTGGGAAGAGGG - Exonic
1032179881 7:129665803-129665825 CCCTGGGCAACATGGCAAAACGG - Intronic
1036946817 8:13101869-13101891 CCTTTGATATCCTGCCGAAAAGG - Intronic
1039295066 8:36141870-36141892 CCTTGCAAATCCTGGAAAAATGG - Intergenic
1039884805 8:41648768-41648790 CCCTGGAGAGCCTGGCACAGAGG + Intronic
1040707555 8:50147887-50147909 ACCAGGATTTCCTGGAAAAATGG + Intronic
1045173560 8:99696716-99696738 CCCCGGATCTTCTGGGAAAACGG - Intronic
1046696909 8:117351277-117351299 CCATGGATATCTTGGCAAAGAGG + Intergenic
1048291885 8:133187384-133187406 CCCTGGAAGTCCTGGGAAATGGG + Intergenic
1048583809 8:135754221-135754243 CCATGGATATGCTGGACAAAGGG - Intergenic
1050041474 9:1499182-1499204 GCATGGATATCCTGGACAAAGGG + Intergenic
1052085862 9:24264685-24264707 CCTTGGATTTACTGGGAAAATGG + Intergenic
1056411926 9:86337425-86337447 TCCTAGATATACAGGCAAAAGGG + Exonic
1058831735 9:108823767-108823789 GCCTGGATATCCAGGCAGAGAGG - Intergenic
1059432862 9:114260349-114260371 CCCTGGGTCTCCTGCCAAACAGG + Intronic
1061888846 9:133607091-133607113 CCCTCAATACCATGGCAAAAAGG + Intergenic
1061912666 9:133733321-133733343 CCATGGGTGTCCTGGCAAACTGG - Intronic
1186060959 X:5706443-5706465 TCCTGGATATCCAGACATAAGGG - Intergenic
1187075521 X:15930488-15930510 CCAGGGATATTCTGGCAAAGTGG + Intergenic
1187116281 X:16355194-16355216 GCCAGGAGACCCTGGCAAAAGGG + Intergenic
1189327568 X:40122152-40122174 CCCTGGAAATGCTGTGAAAATGG + Intronic
1195105291 X:101597610-101597632 CTATTGATATCCTGGCTAAATGG - Intergenic
1195107591 X:101616157-101616179 CTATTGATATCCTGGCTAAATGG + Exonic
1195791330 X:108591086-108591108 TCCTGGATTTCCTGGAGAAAGGG + Exonic
1195925329 X:110019004-110019026 TCCTTGGTAGCCTGGCAAAAGGG + Intronic
1196192999 X:112813654-112813676 CCATGGATCCTCTGGCAAAAAGG + Intronic
1197422809 X:126258911-126258933 CCCTGCAGCTCCTGGGAAAAGGG - Intergenic
1197662301 X:129187364-129187386 ACCTGGATATCTTGACAATATGG - Intergenic
1199214901 X:145252392-145252414 ACTTGGAGATCCTGGAAAAAGGG + Intronic
1200282152 X:154786073-154786095 TCCTAGATTTCCTGGCATAATGG - Intronic