ID: 915277133

View in Genome Browser
Species Human (GRCh38)
Location 1:154796944-154796966
Sequence GACTTAAATGTATCTAATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915277129_915277133 7 Left 915277129 1:154796914-154796936 CCAGAAATGAAAAAGGCGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 159
Right 915277133 1:154796944-154796966 GACTTAAATGTATCTAATCCCGG 0: 1
1: 0
2: 1
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915277133 Original CRISPR GACTTAAATGTATCTAATCC CGG Intronic
907096704 1:51788375-51788397 TATTAAATTGTATCTAATCCTGG + Exonic
908499135 1:64725377-64725399 GACTTAAATATATCTGATCTGGG - Intergenic
914718807 1:150272542-150272564 GTCTTGAATGGATCTAATCTAGG + Intronic
915277133 1:154796944-154796966 GACTTAAATGTATCTAATCCCGG + Intronic
915661418 1:157408808-157408830 GACTTCAATGTATCTTTTCTGGG + Intergenic
917588233 1:176450410-176450432 CACTTAAATGTACATAATCTTGG + Intergenic
920829882 1:209454656-209454678 TATTTAAATGTATCTAAACTTGG + Intergenic
920965032 1:210694382-210694404 GACTGACAGGTATCTTATCCTGG + Intronic
1062886034 10:1016667-1016689 GTCTAAAGTGTATCTAGTCCTGG + Intronic
1063842793 10:10090921-10090943 AGCTTAAATGTCTGTAATCCAGG + Intergenic
1064434126 10:15295845-15295867 GGGTTAAATGTAGCTAATCATGG - Intronic
1069088089 10:64165509-64165531 GACTAGAATGTAAATAATCCAGG - Intergenic
1070001893 10:72384794-72384816 GTCTTAAATGAATGGAATCCTGG + Intronic
1071543483 10:86509152-86509174 GAATTAATTGTCTCTAATCAAGG + Intronic
1072441655 10:95461895-95461917 AACTTAAATATTTCTAAGCCTGG + Intronic
1074927397 10:118087154-118087176 GATATAAATGTATCTCAGCCGGG + Intergenic
1080186681 11:29495985-29496007 GACATAAATGTTTCCAAACCAGG - Intergenic
1080726419 11:34902977-34902999 GATTTAACTGTTTATAATCCTGG + Intronic
1083169092 11:60911836-60911858 GGAGAAAATGTATCTAATCCTGG - Intergenic
1088669181 11:112124638-112124660 GACTTAAAATTATCTATTCTAGG + Intronic
1090980109 11:131712577-131712599 GAGTAAAATGTATCTACTGCAGG - Intronic
1093976944 12:25433540-25433562 GAATAAAATTTCTCTAATCCTGG - Intronic
1095495179 12:42776734-42776756 GACATAATTGTGCCTAATCCTGG + Intergenic
1105873460 13:24531247-24531269 GCTGTAAATCTATCTAATCCTGG - Intergenic
1109685663 13:65816831-65816853 AACTTAAATAAATCTTATCCTGG - Intergenic
1111498289 13:89083181-89083203 GACTTAAATGAGACTAAGCCAGG - Intergenic
1111626643 13:90796457-90796479 GACTGAAATTTATGTCATCCAGG - Intergenic
1114313820 14:21491709-21491731 GCCTTAAATGTAGCTATTCTCGG + Intronic
1119108250 14:71944960-71944982 TACTTAAATATATCTAAACATGG + Intronic
1120609420 14:86622121-86622143 GACTATAATGCATCTAAACCAGG + Intergenic
1120906584 14:89625897-89625919 GACTGAAGTGCACCTAATCCAGG - Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1130140304 15:81220683-81220705 GAGTTAAATGTATTTTATCCAGG + Intronic
1132820527 16:1865951-1865973 CATTTAAATGTATTTATTCCAGG + Intronic
1135078136 16:19411539-19411561 GACTGAATATTATCTAATCCAGG + Intronic
1146852805 17:36238089-36238111 GACTTAAAAATATCTAATACAGG + Intronic
1146868716 17:36361981-36362003 GACTTAAAAATATCTAATACAGG + Intronic
1147071590 17:37962605-37962627 GACTTAAAAATATCTAATACAGG + Intergenic
1147083116 17:38042129-38042151 GACTTAAAAATATCTAATACAGG + Intronic
1147099059 17:38166102-38166124 GACTTAAAAATATCTAATACAGG + Intergenic
1150080596 17:62235145-62235167 GACTTAAAAATATCTAATACAGG + Intergenic
1150310886 17:64129168-64129190 GAGTTAAATGAATGTAAACCAGG + Intronic
1153937077 18:9937297-9937319 GACTTAAATGATTCTTCTCCAGG - Intronic
1157053442 18:44197344-44197366 GACAAAAATGTACCTAATTCTGG - Intergenic
1160897449 19:1409297-1409319 GGCTTGAATGGACCTAATCCAGG - Intronic
1166171424 19:41030005-41030027 GACATCAATCCATCTAATCCTGG + Intergenic
925366841 2:3316444-3316466 GACTTAAATGTACCTAATCAAGG - Intronic
928130162 2:28643227-28643249 TATTTAAATGTATCCATTCCAGG - Exonic
929893988 2:45942130-45942152 GACGTAAATGTTTCAAAGCCTGG - Intronic
930154160 2:48088604-48088626 GACTTACATGTATGTAAGTCTGG + Intergenic
931551883 2:63455511-63455533 GATATAAATGTAACTACTCCTGG - Intronic
933220760 2:79685310-79685332 TACTTATATGTATCTATTACTGG - Intronic
941715997 2:168763994-168764016 GCCTTTTATGTATCTACTCCAGG + Intronic
943278561 2:185900291-185900313 GACTTAATAGTTTCTACTCCTGG + Intergenic
1169128241 20:3146639-3146661 GACTTAATTGTATCCAAGGCAGG - Exonic
1169883001 20:10367718-10367740 GACTTAAATGTGTTTATTACAGG + Intergenic
1173271970 20:41545158-41545180 GAGTTAAATGTGTCTATTGCTGG - Intronic
1174283693 20:49457250-49457272 GATTTCAATGTAACTAATACTGG - Intronic
1175331013 20:58163862-58163884 GAGTTAAATGGATCCAATACGGG - Intergenic
1177964629 21:27712674-27712696 GACTTAAATGTGATTCATCCAGG + Intergenic
952856339 3:37773566-37773588 GAGTTAAATTTATCTAATTAGGG - Intronic
955517821 3:59745519-59745541 GGTTTATATTTATCTAATCCAGG + Intergenic
955952262 3:64254274-64254296 GACTTCAATTTATCTAAACCTGG - Intronic
956547528 3:70421048-70421070 GAATTATATGTATATAATCCTGG - Intergenic
957509658 3:81170770-81170792 GGGTTAAATGTATCTATTTCTGG - Intergenic
957783954 3:84856071-84856093 GTCTTAAATGTCTTTAAGCCAGG - Intergenic
958730520 3:97955913-97955935 TACTTAAATATATCTAAACGTGG + Intronic
960048660 3:113220689-113220711 GACCAAAATGCCTCTAATCCAGG - Intronic
960452219 3:117824707-117824729 AACTTACATGTATTTAATTCTGG - Intergenic
964384307 3:156130995-156131017 GAATTAAATTTATCTAATAAGGG - Intronic
964951585 3:162301552-162301574 AACTTAAATGTATTTTATCTTGG - Intergenic
965032046 3:163383511-163383533 TATTTAAATTTATCTAGTCCTGG - Intergenic
965857419 3:173105043-173105065 GACTTTATTGTTTGTAATCCAGG - Intronic
970927227 4:21466866-21466888 GAAGCAAATCTATCTAATCCTGG + Intronic
974782954 4:66577413-66577435 GACATCATTATATCTAATCCTGG + Intergenic
974787970 4:66645853-66645875 GATTTAAATTTGTCTAACCCAGG - Intergenic
974793881 4:66723546-66723568 GACTTAAATCCATCTAATTGTGG - Intergenic
976457940 4:85271273-85271295 GGCTTTAATGCATCTGATCCAGG - Intergenic
982051612 4:151507896-151507918 GAGGTAAATGTTTCTGATCCTGG + Intronic
982826975 4:160014211-160014233 TACTTGTAGGTATCTAATCCTGG + Intergenic
983537406 4:168872954-168872976 GACTTCAATGTATCAATTCTGGG - Intronic
985200227 4:187476982-187477004 GACTTAAAAGTATCTGATTTAGG - Intergenic
986564826 5:9101651-9101673 AACTTAGTTGTATCTAATCCAGG + Intronic
987318780 5:16748660-16748682 GATTTATATTTATGTAATCCAGG - Intronic
989781692 5:45273400-45273422 GACTTAAATGTTTATAATCAGGG - Intronic
994020025 5:95012364-95012386 TACATAAATGTATGTACTCCAGG - Intronic
996331927 5:122339404-122339426 AACTTAAATGTATCTAAAGATGG - Intronic
999445245 5:151633661-151633683 AACTTAAATGTATCTGCTTCTGG + Intergenic
1000588716 5:163131913-163131935 GAGTTAAATTTACCTAATCTCGG - Intergenic
1002404489 5:179019202-179019224 GATTAAAATGTATCAAATGCCGG - Intergenic
1003219091 6:4141422-4141444 GACTCAAAGGAACCTAATCCTGG + Intergenic
1005681859 6:28216387-28216409 GACCAAAAAGTATCTATTCCAGG + Intergenic
1006532123 6:34664905-34664927 CAGTCAAATGTATCTCATCCTGG + Intronic
1007471450 6:42093269-42093291 GACTTTAATGGTTCTTATCCAGG - Intergenic
1008359365 6:50597460-50597482 GACTTAAATTTAACCAATGCAGG - Intergenic
1008410568 6:51173983-51174005 GAGGTAAACGTATCAAATCCAGG - Intergenic
1010519234 6:76811935-76811957 CATTTAAATGTAGCTGATCCAGG + Intergenic
1014239878 6:119004897-119004919 GACTTTAAGGTATTTTATCCTGG - Intronic
1015005741 6:128279395-128279417 TAATTAAAGGTATCTAATGCTGG - Intronic
1015100295 6:129470386-129470408 GACTTAAATGTATGTATGCTTGG - Intronic
1018221028 6:161579617-161579639 GACTTATATTTATTTAATACTGG - Intronic
1019087202 6:169489810-169489832 TTCTCAAATGTCTCTAATCCAGG + Intronic
1020499163 7:8893323-8893345 TTCTTAAATGTATCTTATCTTGG + Intergenic
1024141073 7:46464001-46464023 GACTTAAGTGTGATTAATCCAGG + Intergenic
1031696687 7:124865299-124865321 GACTTAAATGTACTTTATGCAGG - Intronic
1036212782 8:6855598-6855620 GACTTGAATGTCTCTTTTCCTGG + Intergenic
1036813355 8:11883096-11883118 GACTTAAATGTATGAATTACTGG + Intergenic
1041926287 8:63240707-63240729 CACTTAAATGTAACTAAAACTGG + Intergenic
1042573858 8:70196494-70196516 GTCATAACTGTCTCTAATCCAGG - Intronic
1048672943 8:136743547-136743569 GACTTAATTGTTTCTATTCTGGG - Intergenic
1049878831 8:145047239-145047261 GTCTTAAATGTAACAAATACAGG + Intergenic
1050465187 9:5914781-5914803 TACTTAAATGGATCTAATTCTGG - Intronic
1058190142 9:101904330-101904352 GATTTATATGTATTTAATCTTGG + Intergenic
1058349682 9:104007151-104007173 GACTGTAGTGTATCTAAACCTGG + Intergenic
1060581487 9:124750999-124751021 GACCCAAATGTGTCTGATCCAGG - Intronic
1185959897 X:4538041-4538063 GACATAATTGTATCTATTTCTGG + Intergenic
1186510907 X:10129083-10129105 GACCTTACTGTATCCAATCCTGG - Intronic
1187926899 X:24258747-24258769 GACTTAAATGTTACTCAGCCTGG + Intergenic
1193854505 X:86582610-86582632 GAATTAAATGAATATATTCCTGG + Intronic
1195388574 X:104337201-104337223 GATTTAAATATATCTAGTCTGGG + Intergenic
1195646857 X:107241568-107241590 GACATTAATGTATCTTATCTTGG - Intronic
1197867530 X:131035047-131035069 GCTTAAAATGTAGCTAATCCAGG + Intergenic
1198486554 X:137093042-137093064 GCAATAAATGTATTTAATCCTGG - Intergenic
1198578321 X:138035711-138035733 TACTTAAATATATCTACTCTAGG - Intergenic
1200862649 Y:8009352-8009374 GAGTGACATGTTTCTAATCCAGG - Intergenic
1200904593 Y:8468833-8468855 GATTGACATGTTTCTAATCCAGG + Intergenic
1201789751 Y:17826654-17826676 GACATAAATGTATGTGATCTTGG - Intergenic
1201811803 Y:18079335-18079357 GACATAAATGTATGTGATCTTGG + Intergenic
1202351398 Y:23996406-23996428 GACATAAATGTATGTGATCTTGG - Intergenic
1202519381 Y:25673713-25673735 GACATAAATGTATGTGATCTTGG + Intergenic