ID: 915278556 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:154806853-154806875 |
| Sequence | TCACCTCCCTGGTCGATTTC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 87 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 6, 4: 79} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915278556_915278561 | 5 | Left | 915278556 | 1:154806853-154806875 | CCTGAAATCGACCAGGGAGGTGA | 0: 1 1: 0 2: 1 3: 6 4: 79 |
||
| Right | 915278561 | 1:154806881-154806903 | GAAGCAGCCATTCCCCACCAGGG | 0: 1 1: 0 2: 0 3: 21 4: 202 |
||||
| 915278556_915278560 | 4 | Left | 915278556 | 1:154806853-154806875 | CCTGAAATCGACCAGGGAGGTGA | 0: 1 1: 0 2: 1 3: 6 4: 79 |
||
| Right | 915278560 | 1:154806880-154806902 | GGAAGCAGCCATTCCCCACCAGG | 0: 1 1: 0 2: 1 3: 22 4: 220 |
||||
| 915278556_915278563 | 14 | Left | 915278556 | 1:154806853-154806875 | CCTGAAATCGACCAGGGAGGTGA | 0: 1 1: 0 2: 1 3: 6 4: 79 |
||
| Right | 915278563 | 1:154806890-154806912 | ATTCCCCACCAGGGTGCCCAAGG | 0: 1 1: 0 2: 1 3: 18 4: 192 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915278556 | Original CRISPR | TCACCTCCCTGGTCGATTTC AGG (reversed) | Intronic | ||