ID: 915278556

View in Genome Browser
Species Human (GRCh38)
Location 1:154806853-154806875
Sequence TCACCTCCCTGGTCGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915278556_915278561 5 Left 915278556 1:154806853-154806875 CCTGAAATCGACCAGGGAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 79
Right 915278561 1:154806881-154806903 GAAGCAGCCATTCCCCACCAGGG 0: 1
1: 0
2: 0
3: 21
4: 202
915278556_915278560 4 Left 915278556 1:154806853-154806875 CCTGAAATCGACCAGGGAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 79
Right 915278560 1:154806880-154806902 GGAAGCAGCCATTCCCCACCAGG 0: 1
1: 0
2: 1
3: 22
4: 220
915278556_915278563 14 Left 915278556 1:154806853-154806875 CCTGAAATCGACCAGGGAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 79
Right 915278563 1:154806890-154806912 ATTCCCCACCAGGGTGCCCAAGG 0: 1
1: 0
2: 1
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915278556 Original CRISPR TCACCTCCCTGGTCGATTTC AGG (reversed) Intronic