ID: 915278560

View in Genome Browser
Species Human (GRCh38)
Location 1:154806880-154806902
Sequence GGAAGCAGCCATTCCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915278555_915278560 5 Left 915278555 1:154806852-154806874 CCCTGAAATCGACCAGGGAGGTG 0: 1
1: 0
2: 1
3: 11
4: 91
Right 915278560 1:154806880-154806902 GGAAGCAGCCATTCCCCACCAGG 0: 1
1: 0
2: 1
3: 22
4: 220
915278556_915278560 4 Left 915278556 1:154806853-154806875 CCTGAAATCGACCAGGGAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 79
Right 915278560 1:154806880-154806902 GGAAGCAGCCATTCCCCACCAGG 0: 1
1: 0
2: 1
3: 22
4: 220
915278551_915278560 13 Left 915278551 1:154806844-154806866 CCTGCGGTCCCTGAAATCGACCA 0: 1
1: 0
2: 0
3: 2
4: 36
Right 915278560 1:154806880-154806902 GGAAGCAGCCATTCCCCACCAGG 0: 1
1: 0
2: 1
3: 22
4: 220
915278559_915278560 -7 Left 915278559 1:154806864-154806886 CCAGGGAGGTGAGGAAGGAAGCA 0: 1
1: 0
2: 12
3: 110
4: 539
Right 915278560 1:154806880-154806902 GGAAGCAGCCATTCCCCACCAGG 0: 1
1: 0
2: 1
3: 22
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915278560 Original CRISPR GGAAGCAGCCATTCCCCACC AGG Intronic