ID: 915279683

View in Genome Browser
Species Human (GRCh38)
Location 1:154813970-154813992
Sequence CACACAGAGACTGCCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 7, 3: 27, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915279678_915279683 16 Left 915279678 1:154813931-154813953 CCCAAGTGTTTAAATGTTTAGCA 0: 1
1: 1
2: 1
3: 17
4: 268
Right 915279683 1:154813970-154813992 CACACAGAGACTGCCAGGGCTGG 0: 1
1: 0
2: 7
3: 27
4: 343
915279679_915279683 15 Left 915279679 1:154813932-154813954 CCAAGTGTTTAAATGTTTAGCAA 0: 1
1: 0
2: 2
3: 22
4: 269
Right 915279683 1:154813970-154813992 CACACAGAGACTGCCAGGGCTGG 0: 1
1: 0
2: 7
3: 27
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915279683 Original CRISPR CACACAGAGACTGCCAGGGC TGG Intronic
900648020 1:3717790-3717812 CCCCCAGATGCTGCCAGGGCAGG + Intronic
900833771 1:4984608-4984630 CACACAGGTGCTGACAGGGCTGG + Intergenic
900985028 1:6068385-6068407 CAGTCAGAGAGTGCCAGGGCTGG - Intronic
900985037 1:6068445-6068467 CAGTCAGAGAGTGCTAGGGCTGG - Intronic
901023042 1:6264706-6264728 CACACAGAGACAGGCAGGTTAGG + Intronic
901149941 1:7094697-7094719 TACACGGAGGCTCCCAGGGCTGG + Intronic
901314987 1:8300943-8300965 GACAGAGAAAATGCCAGGGCTGG - Intergenic
902547249 1:17197809-17197831 TTCACAGAGACTCCCAGGTCAGG + Intergenic
902997522 1:20238403-20238425 CACAAAGAAACGGCCAGGGTGGG + Intergenic
903008349 1:20313030-20313052 CAGCCAGAGGCTGCCTGGGCTGG + Intronic
903009896 1:20322310-20322332 CACACAGAGACAGCCAGATAAGG + Intronic
903172024 1:21560327-21560349 CAGGCAGACACTGGCAGGGCTGG - Intronic
903622445 1:24707793-24707815 CACACACACACTGGCAGCGCAGG - Intergenic
904037996 1:27568955-27568977 CGCACAAAGCCTGCCAGGGTGGG + Intronic
904382784 1:30122866-30122888 CAGACAGAGAAATCCAGGGCTGG + Intergenic
904838816 1:33357122-33357144 TCCACAGAGACTTCCACGGCTGG + Intronic
905335398 1:37241229-37241251 CACACACACACGGCAAGGGCTGG - Intergenic
906528057 1:46508025-46508047 CACCGAGAGGCTGGCAGGGCAGG - Intronic
906654434 1:47537410-47537432 CAGAGAGAGAATGCCAGAGCTGG - Intergenic
908395219 1:63719200-63719222 CAGAAAGGGACTGCCAGGCCAGG - Intergenic
908805568 1:67927766-67927788 CACAAAGAGACAGCCCAGGCTGG - Intergenic
910292969 1:85616603-85616625 CACCCAGGGACTGCCCGGGAAGG - Intergenic
910796006 1:91098619-91098641 CACACAGATAATGCCAGTTCAGG - Intergenic
911326601 1:96475637-96475659 CCCACAGAAACTGGGAGGGCGGG - Intergenic
912517884 1:110227291-110227313 CCCACAGAGCCTGCATGGGCTGG - Intronic
913693236 1:121299663-121299685 ACCACAGAGGCTGCCAGGGAGGG - Intronic
914144320 1:144980417-144980439 ACCACAGAGGCTGCCAGGGAGGG + Intronic
915279683 1:154813970-154813992 CACACAGAGACTGCCAGGGCTGG + Intronic
915287634 1:154862957-154862979 CACACTGACACTGCCAGCGGTGG - Intronic
915590314 1:156866756-156866778 CACACACTGCCTTCCAGGGCTGG + Intronic
917969715 1:180198832-180198854 AAGACAGAGGCTCCCAGGGCCGG + Exonic
918152867 1:181813566-181813588 CACACTGATTCAGCCAGGGCAGG + Intergenic
918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG + Intergenic
919802985 1:201364667-201364689 CACAGAGCAGCTGCCAGGGCAGG - Intronic
920480558 1:206318032-206318054 ACCACAGAGGCTGCCAGGGAGGG - Intronic
921071267 1:211660168-211660190 GACCTAGAGACTGCAAGGGCAGG - Intronic
923918417 1:238535721-238535743 AACACGGACACTGCCAGGGAAGG + Intergenic
924443901 1:244110451-244110473 GACTCAGAGACTGTCAGAGCTGG - Intergenic
1064683537 10:17835616-17835638 CACACAGAGCCTTCCAAGGAAGG + Intronic
1066386805 10:34948198-34948220 CACACAGAGACTAATAGGGAAGG + Intergenic
1066489669 10:35882698-35882720 CACACAGCCACAGCCAGGCCAGG + Intergenic
1067238812 10:44473193-44473215 CACACAGAGACTTACAGGGTGGG + Intergenic
1069222945 10:65906478-65906500 CCCACAGAGACTCTCAGGGGAGG - Intergenic
1070307418 10:75247954-75247976 CCCAGAGAGGCTGCCAGGGCTGG - Intergenic
1070838105 10:79464098-79464120 CACCCAGAGTGTGCCAGGCCTGG + Intergenic
1070976549 10:80609988-80610010 CAAACATAGACTGTTAGGGCAGG + Intronic
1072609913 10:97011168-97011190 CACACAGAGTCTGGGAGGCCAGG + Intronic
1074020894 10:109581583-109581605 CACAAAGAGACTCTCAGGGGTGG - Intergenic
1074306895 10:112287406-112287428 CACACAGAGACTGTCCCAGCAGG + Intronic
1074869358 10:117564833-117564855 CACACAGACTCAGCCAGAGCAGG + Intergenic
1075310182 10:121407270-121407292 CAGGCAGCCACTGCCAGGGCAGG + Intergenic
1075707232 10:124508494-124508516 CACAAAGACAAAGCCAGGGCCGG - Intronic
1076734409 10:132452292-132452314 CACCCAGAGACTGCAGGGTCGGG - Intergenic
1077060743 11:616924-616946 TACACAGAGATTGCCTGGGGAGG - Exonic
1077299783 11:1841615-1841637 CACCCAGAGCCTGCCAGGGAGGG + Exonic
1077378670 11:2217666-2217688 CACAGAGAGCCTGCCAGGCATGG - Intergenic
1078902081 11:15650890-15650912 TGCTCAGAGGCTGCCAGGGCAGG - Intergenic
1078927800 11:15890216-15890238 CAGACCCAGGCTGCCAGGGCCGG - Intergenic
1079692489 11:23436978-23437000 CACACATAGACTGCAAGTGAAGG - Intergenic
1083278382 11:61610566-61610588 CACCCAAAGAATGGCAGGGCCGG - Intergenic
1084676584 11:70639066-70639088 CTCACAGAGCCAGCCTGGGCTGG + Intronic
1086421762 11:86644424-86644446 CATACACAGACTCCCAGGCCTGG + Intronic
1088734005 11:112710145-112710167 TACACATAGACTGCAAGGGCAGG - Intergenic
1089362019 11:117897162-117897184 CAGTCAGAGTCTGCCAGGGCAGG + Intergenic
1089764249 11:120751548-120751570 CACCCAGAGCCTGGCAGGGAGGG - Intronic
1090623008 11:128578191-128578213 CACCCAAAGCTTGCCAGGGCAGG + Intronic
1090637112 11:128696088-128696110 CACACAGGGATTGGCATGGCAGG + Intronic
1090996368 11:131869334-131869356 CACACAATGACTGGCAGGGCCGG - Intronic
1091393758 12:141333-141355 CTCACAGAGAGAGCCCGGGCAGG - Intronic
1091828287 12:3531614-3531636 CACCAAGAGACAGCCAGGGCTGG + Intronic
1092160534 12:6313075-6313097 CACACAGCTCCTCCCAGGGCAGG - Intronic
1092601033 12:10064846-10064868 CACTCAGAGACTTACAGGCCAGG - Exonic
1092849213 12:12611907-12611929 CACCCAGAGACTGTCATGGAGGG + Exonic
1096636632 12:52964589-52964611 CACAGAGATAGTGACAGGGCTGG + Intergenic
1096801850 12:54115615-54115637 CAAACAGTGACTGACAGGGAAGG + Intergenic
1096850204 12:54430641-54430663 CACACAGGGACTCCCTGGGCTGG + Intergenic
1096879795 12:54658426-54658448 CACACAGGGACTGTCAGAACTGG - Intergenic
1101557027 12:105819664-105819686 CACACATAGATTGCCCGTGCAGG - Intergenic
1101573381 12:105975729-105975751 CACACAGAAAGGGCCAGGGAAGG - Intergenic
1102471072 12:113160234-113160256 CTCACAGAGACACCCAGGGGAGG + Intronic
1104045565 12:125160276-125160298 CACACACACACGGCCATGGCTGG - Intergenic
1105432795 13:20352307-20352329 CACACAGAGTCTTACAGTGCAGG - Intergenic
1107430203 13:40333538-40333560 CACACAGACACTGACAGGCTGGG + Intergenic
1111625917 13:90786512-90786534 CACACAGAGACTGAAAGTGAAGG - Intergenic
1112577972 13:100653797-100653819 AACTCAAAGCCTGCCAGGGCAGG + Intronic
1113448736 13:110390440-110390462 CACCCACAGACTCCCAGCGCTGG - Intronic
1113717996 13:112527862-112527884 AAAAGAGAGACTGCAAGGGCAGG - Intronic
1114334325 14:21672189-21672211 CACACACAGCCTTCCAGGGGTGG + Intergenic
1114650459 14:24281295-24281317 GATACAGACACTGCCATGGCTGG + Intergenic
1116078573 14:40144248-40144270 CACACAGATATTGACAGAGCTGG - Intergenic
1116522514 14:45867699-45867721 AACAGAGAGGCTGCCATGGCTGG - Intergenic
1117410134 14:55442897-55442919 CACACAGAGAAGGCCAGGTGAGG + Intronic
1117642410 14:57813792-57813814 ATCACAGAGACAGGCAGGGCTGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119479781 14:74952055-74952077 CCCTCAGGCACTGCCAGGGCTGG + Intronic
1119646685 14:76353443-76353465 CACACAGAGGCAGGCAGGGCGGG - Intronic
1121441405 14:93952014-93952036 CACAGAGAAGCTTCCAGGGCTGG - Intronic
1121491304 14:94363366-94363388 CACCCAGAGAGAGCCAGGCCAGG - Intergenic
1122255211 14:100471336-100471358 CCATCAGGGACTGCCAGGGCTGG + Intronic
1122881422 14:104692126-104692148 CACACAGACCCTGCCCAGGCTGG - Intronic
1123491198 15:20783913-20783935 TAGACAGAGGCTGGCAGGGCTGG - Intergenic
1123547700 15:21353004-21353026 TAGACAGAGGCTGGCAGGGCTGG - Intergenic
1124372472 15:29111448-29111470 CACCCTGAGAGTGCCAGGGAGGG + Intronic
1124607142 15:31178181-31178203 CAAACAGAAGCTCCCAGGGCGGG - Intergenic
1126918492 15:53492889-53492911 CACACAGAGGATGGCAGAGCAGG + Intergenic
1128729623 15:70012152-70012174 CACACAGTAACTGCCAAGTCAGG - Intergenic
1128748120 15:70129287-70129309 TACACAGAGACCCTCAGGGCAGG + Intergenic
1130945381 15:88546824-88546846 CTCACAGAGATTGCCAGGTTAGG - Intergenic
1130970068 15:88725399-88725421 CCCACAAATACTGCCAGGGAAGG + Intergenic
1131222699 15:90598288-90598310 CACAAAGAAAGGGCCAGGGCGGG + Intronic
1202956030 15_KI270727v1_random:80234-80256 TAGACAGAGGCTGGCAGGGCTGG - Intergenic
1132950163 16:2557324-2557346 TACACAGAGACGCCCAGTGCTGG - Intronic
1132964183 16:2642846-2642868 TACACAGAGACGCCCAGTGCTGG + Intergenic
1134242940 16:12519008-12519030 CCCACGGAGGCTGCCAGGACGGG + Intronic
1136115475 16:28091710-28091732 CTCACAGAGCCTGCCTGGGGAGG - Intergenic
1136374808 16:29859138-29859160 CACAGCAAGACTCCCAGGGCAGG + Exonic
1137398482 16:48134059-48134081 GACACACAGAGTGTCAGGGCTGG - Intronic
1137446786 16:48536757-48536779 CACACCGAGGATGCCAGGGCTGG - Intergenic
1138904101 16:61309624-61309646 CACAGAGAGACTACCAGTGAGGG + Intergenic
1142595921 17:1029998-1030020 CACACAGAGCAGCCCAGGGCCGG + Intronic
1142692768 17:1616857-1616879 CCCACTGGGAATGCCAGGGCTGG + Intronic
1143010738 17:3864990-3865012 CACACAGAGCAGGCCAGGGTGGG + Intronic
1143301675 17:5915229-5915251 TACACAGATCCTGTCAGGGCAGG - Intronic
1143778255 17:9213270-9213292 GAGACAGAAGCTGCCAGGGCTGG - Intronic
1144620707 17:16816738-16816760 AGCAAAGTGACTGCCAGGGCAGG + Intergenic
1144630616 17:16870326-16870348 AACAAAGAGGCTGCCAGGGCCGG + Intergenic
1144650708 17:17005129-17005151 AACAAAGAGGCTGCCAGGGCCGG - Intergenic
1144884935 17:18451409-18451431 AGCAAAGTGACTGCCAGGGCAGG - Intergenic
1145069071 17:19787857-19787879 CACACAGCTGCTGCCAGGGGAGG - Intronic
1145272543 17:21412558-21412580 CAGAAAGAGGCAGCCAGGGCCGG - Intronic
1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG + Intronic
1146405285 17:32531319-32531341 CACACAGAGACTGAGAGGAGTGG + Intronic
1147572097 17:41577636-41577658 AGCAAAGTGACTGCCAGGGCAGG + Intergenic
1147865443 17:43548978-43549000 CACTCAGCCTCTGCCAGGGCTGG - Intronic
1148328525 17:46798590-46798612 CACACAGTGACTGCCAGCCCTGG + Intronic
1148746384 17:49920545-49920567 CACACAGCTACTGGCAGAGCTGG - Intergenic
1150007592 17:61479346-61479368 CACACAGGGACTGGCAAGGTGGG + Intronic
1151617745 17:75225350-75225372 CACCCAGACACTGACAGAGCTGG + Exonic
1151814858 17:76466806-76466828 CACTCACAGGCTGCCAGGACAGG + Intronic
1151821096 17:76497326-76497348 CACACACACACTGGCAGGCCAGG + Intronic
1151874047 17:76856482-76856504 CACACAGCCACCCCCAGGGCCGG - Intergenic
1152405700 17:80096712-80096734 GACACAGTGACTCTCAGGGCTGG - Intronic
1152610121 17:81311343-81311365 CACGCAGGGCCTGTCAGGGCTGG + Exonic
1153227195 18:2907931-2907953 CATGCAGACACTGGCAGGGCTGG + Intronic
1153280452 18:3409876-3409898 CACAAAGAGACTCTCAGAGCGGG - Intergenic
1153817810 18:8806491-8806513 CACACAGTGACTGGCAGCCCTGG + Intronic
1154325356 18:13387196-13387218 CCCACAGGGGCTGCCAGGGTGGG - Intronic
1154957243 18:21270983-21271005 CACACAGTAAGTGCCAGAGCTGG + Intronic
1155158478 18:23177479-23177501 CACACATAGACCGGCGGGGCTGG - Intronic
1155801915 18:30116430-30116452 ACCAAAGAGACTGCCTGGGCCGG - Intergenic
1156770768 18:40720765-40720787 CACACAGAAACTGTAAGGGAAGG + Intergenic
1160658624 19:287909-287931 CCCACACAGACCTCCAGGGCAGG + Intronic
1161533260 19:4803123-4803145 CACAATGAGACTGCAAGGCCGGG - Intergenic
1161735314 19:5988630-5988652 CACAGAGTGAATGGCAGGGCAGG - Intergenic
1162743159 19:12784301-12784323 CACAGAGAGACTGCCAGCCAGGG + Intronic
1163157650 19:15448235-15448257 CCCAGAGAGACTGCCTGGCCCGG - Exonic
1163182170 19:15612218-15612240 CACACAGACACTGACATGACAGG + Intergenic
1163251172 19:16127243-16127265 CACACAGCCAATGCCAGGGCTGG - Intronic
1163827978 19:19534413-19534435 GACACAGAGACGGCCAGAGACGG + Intronic
1164070978 19:21767674-21767696 CACTCAAAGCCTGACAGGGCGGG - Intergenic
1164767608 19:30783894-30783916 CACAGAGAGACAGACAGAGCAGG - Intergenic
1166077894 19:40424777-40424799 CACACAGAGAGTGACATGGTAGG + Intronic
1166143228 19:40817015-40817037 CACACAGAAACAGGCAGAGCTGG - Intronic
1166184335 19:41129798-41129820 CACACAGAAACAGGCAGAGCTGG + Intergenic
1166266713 19:41688893-41688915 CAGACAGAGGCTTCCAGGTCAGG - Intronic
1166820062 19:45573614-45573636 CACACAGAAAGTGGCAGAGCGGG + Intronic
1166997700 19:46727701-46727723 GACAGAGAGACAGACAGGGCAGG + Intronic
1167299640 19:48671346-48671368 GACACAGAGACAAGCAGGGCTGG + Intronic
1167408505 19:49330646-49330668 AAAACACAGACTGCCAGGCCAGG + Intergenic
1167713198 19:51124804-51124826 CACCCAGACACTGTCAGGCCCGG - Intergenic
1167715792 19:51142199-51142221 CACACAGACACTGTCAGGGCTGG - Intergenic
1167762538 19:51458536-51458558 CACACAGACACTGTCAGGGCCGG + Intergenic
1167768951 19:51501879-51501901 CACACAGACACTGTCAGGGCCGG + Intergenic
1168469225 19:56627454-56627476 CACACAGGGAAGCCCAGGGCAGG + Intergenic
925023019 2:587014-587036 CACACAGCGGCTCCCAGAGCCGG + Intergenic
925458748 2:4042153-4042175 AATGCAGAGACTGCCAGGGAAGG - Intergenic
925696866 2:6589665-6589687 GACACAGAAAATGCCAGGCCAGG - Intergenic
926288225 2:11507701-11507723 CACCCAGAGCCTCCAAGGGCAGG - Intergenic
926311599 2:11679720-11679742 CGCACAGAGACTGCCGGGGCAGG - Intronic
926524736 2:13964954-13964976 CACACAGAGACTGAAAATGCAGG - Intergenic
926724227 2:15984743-15984765 CGCCCAGAGACTGGCAGGCCAGG - Intergenic
927652838 2:24922690-24922712 CACACTGAGAATCACAGGGCTGG - Intergenic
928402068 2:30986214-30986236 CACACAGACCCAGCCAGGCCAGG + Intronic
928441899 2:31299221-31299243 CACATGGAAACTGCCAGGCCTGG + Intergenic
928455619 2:31418242-31418264 CACACATAGACTGCAAGCGAAGG - Intergenic
928605923 2:32945567-32945589 GAGACACAGACTGCTAGGGCTGG + Intergenic
928823620 2:35392163-35392185 GAAACAGAGACTGCAGGGGCAGG + Intergenic
929014064 2:37476397-37476419 CACAGTGAGACAGCGAGGGCTGG - Intergenic
929828057 2:45325397-45325419 CATTCAAAGACTGCCAGGGGAGG + Intergenic
930003543 2:46878859-46878881 CACACAGTGTCCGCCTGGGCTGG + Intergenic
930033460 2:47071905-47071927 CTCCCAGAGAGGGCCAGGGCCGG - Intronic
931830683 2:66047944-66047966 CAAAGAGAAACTGCCAGAGCTGG - Intergenic
932279374 2:70476461-70476483 CACACAGAGACTGCAAAGGCAGG - Intronic
932414546 2:71565678-71565700 AGCACAGAGGATGCCAGGGCTGG + Intronic
934662828 2:96152409-96152431 GACAAGGAGCCTGCCAGGGCTGG + Intergenic
936803681 2:116298488-116298510 CACACATAGACTGCAAGTGAAGG + Intergenic
937009348 2:118548188-118548210 CAGACAGGGGCTGCCAGTGCAGG + Intergenic
937955579 2:127420188-127420210 CACACAGGGGCTGCCAGGGCAGG + Intronic
938619013 2:133030300-133030322 CACTCAGTGCCTGCAAGGGCTGG + Intronic
939800301 2:146699734-146699756 CACACAGCTGCTGCCAGGGGTGG - Intergenic
942792646 2:179778336-179778358 CCCACTACGACTGCCAGGGCTGG + Intronic
947288093 2:228540843-228540865 CACTCAGAGACTGCTAATGCAGG + Intergenic
948425726 2:237885713-237885735 CACACAGAGAGGGGCACGGCAGG - Intronic
948791833 2:240383251-240383273 CAGCCAGAGAGTGCGAGGGCCGG + Intergenic
948845361 2:240680417-240680439 GTCACAGAGGCGGCCAGGGCAGG + Exonic
948848500 2:240694462-240694484 GTCACAGAGGCGGCCAGGGCAGG - Exonic
1168761082 20:349805-349827 AACACAGTGAGGGCCAGGGCCGG - Exonic
1170071243 20:12371432-12371454 CAGACAGAGGTTGCCAGGGCTGG + Intergenic
1171794861 20:29558851-29558873 CAAACAGTGACTGACAGGGAAGG - Intergenic
1172880372 20:38195803-38195825 TACCCAACGACTGCCAGGGCAGG - Intergenic
1173335465 20:42109230-42109252 CTGACACAAACTGCCAGGGCAGG + Intronic
1173456923 20:43210161-43210183 CACACAGAGTCTCACAGGCCAGG + Intergenic
1173560771 20:44003841-44003863 CATACAAGGACTTCCAGGGCTGG + Intronic
1174080306 20:47966695-47966717 CACAAAGAGCCAGCCAGGGAAGG + Intergenic
1174137283 20:48388523-48388545 CACAAAGAGCCAGCCAGGGAAGG - Intergenic
1175917643 20:62434321-62434343 CACACAGAGGCTGCCAGAGCTGG - Intergenic
1176187573 20:63789551-63789573 CACACGGGGGCTGCCTGGGCTGG - Intronic
1176266772 20:64213462-64213484 CACACACAGACACCCAGGACAGG + Intronic
1176968894 21:15243329-15243351 CACATAGGGATTACCAGGGCTGG + Intergenic
1177223217 21:18220193-18220215 CACACATAGACTGCAAGTGAAGG - Intronic
1179039951 21:37793803-37793825 CACACAGCTTCTGCAAGGGCCGG + Intronic
1180006904 21:45027027-45027049 CACAGAGACCCTGCCTGGGCTGG - Intergenic
1180716078 22:17873332-17873354 CACACAGAGGCGGCCTGTGCAGG - Intronic
1181469386 22:23128410-23128432 CACACACAGGCTGCCAGCCCAGG - Intronic
1181583778 22:23842096-23842118 CACACTGTGGCTGCCAGGGTGGG - Intergenic
1181931383 22:26404387-26404409 CACACAGAGAGAGGCAGGGATGG - Intergenic
1183262389 22:36804012-36804034 CAAACAGGGAATGCCAGTGCTGG - Intronic
1183685899 22:39361281-39361303 CATGCAGGGACTGGCAGGGCGGG + Intronic
1183724788 22:39582515-39582537 ATCTCAGAGACTGCCTGGGCTGG - Intronic
1183936920 22:41267893-41267915 AGCACAGAGACTGACAGGGGAGG - Intronic
1184161951 22:42702221-42702243 GAGACAGAGAGGGCCAGGGCCGG + Intronic
1184233613 22:43171461-43171483 CACCCTGTGAGTGCCAGGGCAGG - Intronic
1184514049 22:44950055-44950077 GACGGAGAGACTGCCATGGCTGG - Intronic
1184607026 22:45580036-45580058 CTCACAGACACTGCCAGCGACGG + Intronic
1185024810 22:48402823-48402845 CATACAGTCAGTGCCAGGGCGGG - Intergenic
1185099479 22:48830024-48830046 CACTCAGACACTCCCAGGGGTGG - Intronic
1185315889 22:50178966-50178988 CCCACAGAGCCAGCCCGGGCAGG + Exonic
949360036 3:3221898-3221920 CACCCAGAGAAAGCCAGGGAAGG - Intergenic
950468261 3:13168566-13168588 CCCACAAAGACTGCAAGGTCTGG + Intergenic
951843342 3:27058665-27058687 CACACAGAGAGGACCAGAGCTGG - Intergenic
951858421 3:27224123-27224145 CACACAGAGAATGCCAGGTGAGG + Intronic
952851211 3:37731139-37731161 GACACAGAGACTGCAGGGTCTGG - Intronic
952872950 3:37918369-37918391 GACACAGAGACTTCCAAAGCTGG - Intronic
953577254 3:44122887-44122909 CACCCAGGGACTGCCAGACCAGG - Intergenic
953843281 3:46406892-46406914 CACACCGTGACTGTCATGGCAGG + Intergenic
954793567 3:53149830-53149852 CCCATAGAGACTTCCAGGGCAGG + Intergenic
956016467 3:64889079-64889101 GTCACAGAGGCTGCCAGGGTTGG + Intergenic
956151831 3:66251619-66251641 CACACAGATAATGCCAAGCCAGG - Intronic
956294519 3:67697194-67697216 CACCCAGGGCCTTCCAGGGCTGG + Intergenic
957626110 3:82654186-82654208 AACACAGAGAATGCAAGGTCGGG - Intergenic
959776661 3:110172662-110172684 CACACAGTAAATGGCAGGGCAGG + Intergenic
960668897 3:120137788-120137810 AACACAGAAGCTGCCAGGACAGG + Intergenic
961084687 3:124056741-124056763 CATCCAGAGACTGGCAAGGCTGG - Intergenic
961089167 3:124094663-124094685 CACACAGAGGCTGACTGTGCCGG - Exonic
961397824 3:126609403-126609425 CAGGCAGAAGCTGCCAGGGCTGG + Intronic
961726801 3:128936093-128936115 CAGACCGCGAGTGCCAGGGCAGG - Intronic
961737378 3:129010626-129010648 CACCCAAAGGCTGCCAGGTCAGG - Intronic
963903156 3:150751921-150751943 CTTACAGAGACTCCCAGGGCTGG + Intronic
964412571 3:156414250-156414272 CACAAAGAGAATGCCAGAGAAGG + Intronic
964623527 3:158738088-158738110 CACACTGAAACTTCCAGGGAAGG + Intronic
966489947 3:180516715-180516737 CACACACATGCTGGCAGGGCAGG - Intergenic
966863720 3:184244704-184244726 TTCACAGAGACTGCCAGGCTGGG + Exonic
967110657 3:186290662-186290684 CTCAGAGAGACTTCCAGGGTTGG - Intronic
967967823 3:194975828-194975850 GAGAGAGAGACTGTCAGGGCGGG - Intergenic
968004212 3:195228361-195228383 CACCCTGAGACTGGAAGGGCAGG - Intronic
968854228 4:3106822-3106844 AACACACAGAGTGACAGGGCAGG - Intronic
968985780 4:3873624-3873646 AACACAGAGAAGCCCAGGGCTGG - Intergenic
969973199 4:11069751-11069773 CACACTGAGATTGTCAGGTCAGG - Intergenic
970436105 4:16037048-16037070 CACAAAGACCCTGCCAGGGACGG + Intronic
970661092 4:18286742-18286764 CACACAGAGAGTCCCAATGCTGG + Intergenic
971701487 4:29983733-29983755 CTCACAGCCACTGCCAGGGGTGG - Intergenic
972237008 4:37146545-37146567 CACATGGAAACTGCCAAGGCTGG - Intergenic
975611885 4:76212004-76212026 CACACAGAGAATCTAAGGGCTGG + Intronic
978924726 4:114229318-114229340 GACACAGAGACTACTAGAGCAGG - Intergenic
980610923 4:135162447-135162469 AACACAGAGACAGGCATGGCGGG + Intergenic
985482923 5:128688-128710 CAGACAGATTCTGCCAGTGCAGG + Intergenic
985498522 5:225293-225315 CACACAGTGACTCCCAGTGAGGG - Intronic
985548302 5:520832-520854 CTTGCAGAGACTGCCAGGCCTGG - Intronic
985660527 5:1154966-1154988 CACACAGAGGCCACCAGGCCTGG - Intergenic
985998722 5:3613373-3613395 CACACAGAGGCTCCCATGGCAGG - Intergenic
986030736 5:3890457-3890479 TACTCAGAGCGTGCCAGGGCAGG - Intergenic
986337552 5:6766703-6766725 CAGACAGAGAGTGCCAGCGAGGG - Intergenic
986873721 5:12081071-12081093 CTCACAGCCACTGCCATGGCTGG + Intergenic
988047464 5:25974614-25974636 CACACACAGGCTGGCAGGGCTGG + Intergenic
988692273 5:33584737-33584759 CACAATTAGATTGCCAGGGCTGG + Intronic
990122268 5:52469960-52469982 AGCACAGAGACTCCCTGGGCTGG - Intergenic
993137052 5:83982582-83982604 TACAAAGAGAATGCCAGGGAAGG - Intronic
997568122 5:134905036-134905058 CGCAGGGAGACTACCAGGGCTGG + Intronic
997693722 5:135845250-135845272 CACACAGAGACTCAGAGGGGAGG - Intronic
998015804 5:138731195-138731217 CAGACAGAAAGTGCCAGCGCAGG - Intronic
999452282 5:151687170-151687192 GACTCACAGAGTGCCAGGGCTGG + Intergenic
1001325132 5:170718577-170718599 GACGCAGAGGCTGACAGGGCAGG + Intronic
1002955493 6:1859098-1859120 CAATCAGCTACTGCCAGGGCTGG - Intronic
1003756370 6:9125566-9125588 CAGACAGAGAGGGGCAGGGCTGG + Intergenic
1005496178 6:26389821-26389843 ACCTCAGTGACTGCCAGGGCCGG - Intronic
1007165420 6:39825504-39825526 CACACACACACTGGCAGAGCTGG - Intronic
1007378183 6:41470443-41470465 CCCTCAGGGACGGCCAGGGCCGG + Intergenic
1007625309 6:43243347-43243369 CAGCCAGAGAGTCCCAGGGCTGG + Intergenic
1007815991 6:44525997-44526019 CACACACAGATTGGCAGGGTGGG - Intergenic
1008688059 6:53946001-53946023 CACATACACACTGGCAGGGCAGG - Intronic
1010137043 6:72567402-72567424 AAGACAGAGATTGCCAGAGCAGG + Intergenic
1010775277 6:79878245-79878267 TACACGGCCACTGCCAGGGCTGG - Intergenic
1011166045 6:84447694-84447716 CACAGAGAAACTCCCAGGCCTGG + Intergenic
1012573585 6:100762313-100762335 AACACAGTTACTGCCAGGACAGG + Intronic
1012636136 6:101544458-101544480 CACTCACACACTTCCAGGGCAGG - Intronic
1013737914 6:113248890-113248912 CACACACACACTGGCAGAGCAGG - Intergenic
1013795834 6:113887733-113887755 CTCACAGAAGCAGCCAGGGCAGG - Intergenic
1013903958 6:115192271-115192293 CACACAGAGACTGCTCCTGCAGG - Intergenic
1017436039 6:154416716-154416738 CACAGAGAAACCCCCAGGGCTGG + Intronic
1019530351 7:1500012-1500034 TACACAGAGCCTGCCAGGGAGGG + Exonic
1020189004 7:5980317-5980339 TACACAGGGGCTGGCAGGGCAGG + Intronic
1020293912 7:6744436-6744458 TACACAGGGGCTGGCAGGGCAGG - Intergenic
1020761826 7:12277287-12277309 CACATAGAGACTGAAAGGGATGG - Intergenic
1020872133 7:13644644-13644666 CACACAGAGAAGAACAGGGCTGG - Intergenic
1021785942 7:24152643-24152665 CACATAGGGACTGCCAGGCTGGG + Intergenic
1023188804 7:37557446-37557468 CATACAGAGCCTGGCAGAGCAGG - Intergenic
1024479375 7:49848283-49848305 CACTCAGAGCCTCCCACGGCAGG + Intronic
1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG + Intronic
1027261800 7:76470072-76470094 GACCTAGAGACTGCAAGGGCGGG - Intronic
1027313180 7:76968171-76968193 GACCTAGAGACTGCAAGGGCGGG - Intergenic
1029633311 7:101767144-101767166 AACACAGAGTCTGCCCAGGCCGG + Intergenic
1034385304 7:150736193-150736215 CACACAGAGACTGGGAGGTGGGG - Intronic
1034746721 7:153529627-153529649 TACAGAGAGACTGTCAGGGAAGG - Intergenic
1035032579 7:155871028-155871050 CACACAGAGACGGCCATGTGAGG - Intergenic
1035636192 8:1146096-1146118 CACACACCCACTGCCAGGCCAGG + Intergenic
1035703217 8:1653204-1653226 CACGCAGATGCTGCCAGGCCTGG + Intronic
1036585622 8:10120741-10120763 CACAGTGAGTCTGCAAGGGCAGG - Intronic
1038394030 8:27233411-27233433 GGCACAGAGACTCCCAGGGGAGG + Intergenic
1039277617 8:35950974-35950996 CACCCAGAGAGTGTCAGTGCTGG + Intergenic
1040595874 8:48837150-48837172 CACACAGAGACCGCAAGAGGAGG - Intergenic
1040661675 8:49582582-49582604 CTCCCAGAGACTCCCCGGGCAGG + Intergenic
1044077298 8:87838292-87838314 CACACAGAGACTGAAAGTGAAGG + Intergenic
1045505392 8:102774532-102774554 CTCACTGAGACAGCCAGGGAGGG - Intergenic
1048125524 8:131630834-131630856 CACACAGTAACTGACAGAGCAGG - Intergenic
1048234005 8:132673220-132673242 CACACAGTAACTATCAGGGCTGG - Intronic
1048981763 8:139706272-139706294 CACGGAGAGGCTTCCAGGGCTGG - Intergenic
1049106803 8:140619109-140619131 CAGACAGAGGCTGCCATGGAAGG + Intronic
1049250669 8:141587259-141587281 GACACAGAGGTTGGCAGGGCAGG + Intergenic
1051774084 9:20615193-20615215 CACACACAAACTGCCAGGCATGG + Intronic
1052137988 9:24939487-24939509 GAAACACAGACTGCCAGAGCTGG + Intergenic
1052221305 9:26026581-26026603 CCCACAGAGACTGGCAGGTAAGG + Intergenic
1053275472 9:36780292-36780314 CACACCAGGACAGCCAGGGCTGG - Intergenic
1053791400 9:41688712-41688734 CAAACAGTGACTGACAGGGAAGG + Intergenic
1054161364 9:61673991-61674013 TACCCAAAGACTGCCAGGGAGGG + Intergenic
1054179749 9:61900405-61900427 CAAACAGTGACTGACAGGGAAGG + Intergenic
1054473541 9:65557178-65557200 CAAACAGTGACTGACAGGGAAGG - Intergenic
1054657792 9:67680415-67680437 CAAACAGTGACTGACAGGGAAGG - Intergenic
1055822397 9:80282656-80282678 CACACAGATACTTTCAGGGCTGG - Intergenic
1056436939 9:86583682-86583704 CACACTGAGAGTGTCAGGCCTGG - Intergenic
1056822637 9:89854307-89854329 CACACAGGGGCTCCCAGGGAAGG + Intergenic
1057328219 9:94086510-94086532 ATAACAGAGACTGTCAGGGCAGG - Intronic
1057453944 9:95190664-95190686 CACCCACACAGTGCCAGGGCGGG - Intronic
1058823189 9:108751700-108751722 CACAAAGACAATGTCAGGGCTGG - Intergenic
1059696674 9:116736473-116736495 CACACACAGACTGTCAGTGTTGG + Intronic
1060394421 9:123305462-123305484 CACACAGTCACTGGGAGGGCAGG + Intergenic
1060623526 9:125089811-125089833 TACTCAGAGACTGCCATGGGAGG - Intronic
1061009314 9:127945832-127945854 CTCACAGAGCCTCCCATGGCAGG + Intronic
1061040332 9:128137977-128137999 CACACAGGGGCTCCCAGGGAAGG - Intergenic
1061192175 9:129088271-129088293 CAGACGGAGGCTGCCGGGGCTGG + Intronic
1061328345 9:129877534-129877556 GAAAAAGAGACTGTCAGGGCTGG + Intronic
1061879954 9:133563626-133563648 CACCCAGAGAATGGCAGGGAGGG + Intronic
1061881312 9:133570607-133570629 CTCACAGAGGCTGTCAGGGAGGG - Intronic
1061947484 9:133916863-133916885 CACACAGACAATGGCAGAGCCGG - Intronic
1062282294 9:135757436-135757458 CGCACAGTGTCTTCCAGGGCCGG - Intronic
1188938740 X:36211034-36211056 CATAGAGACAGTGCCAGGGCAGG + Intergenic
1189881942 X:45503206-45503228 CACACAGAGACTAGCACAGCAGG - Intergenic
1190452308 X:50594246-50594268 CACAATGAGACTGCCCTGGCAGG + Exonic
1190735239 X:53251324-53251346 CACAGAGAGCCTGTCAGGGCTGG - Intronic
1191634080 X:63357304-63357326 CACACATAGACTGAAAGGGAAGG + Intergenic
1192659667 X:73029266-73029288 CCCACAGACACTGCCACTGCTGG + Intergenic
1193499206 X:82252373-82252395 CACACAGACACTTCCAGAGCTGG - Intergenic
1194646278 X:96462695-96462717 CTCACAGAAACACCCAGGGCTGG - Intergenic
1195728057 X:107937214-107937236 CACCCACAGGCTGTCAGGGCCGG - Intergenic
1196022326 X:111003241-111003263 TACACAGAGACTGGGAGGGAGGG + Intronic
1196794943 X:119494745-119494767 CAAACAGAGGCTGCCTGGGCTGG + Intergenic
1198415459 X:136415342-136415364 CACAGAGTGACTGACAGAGCTGG - Intronic
1198687585 X:139243996-139244018 CACACTGGGGCTGCCAGGGCAGG + Intergenic
1200247382 X:154533368-154533390 CACATAGTGACTGTCAGGCCTGG + Intronic