ID: 915279867

View in Genome Browser
Species Human (GRCh38)
Location 1:154815044-154815066
Sequence TCGGGCCACTCGTACTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 18}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915279867_915279876 16 Left 915279867 1:154815044-154815066 CCCCTTCAGTACGAGTGGCCCGA 0: 1
1: 0
2: 0
3: 3
4: 18
Right 915279876 1:154815083-154815105 TGCTCATCACACCTGAGTTAAGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915279867 Original CRISPR TCGGGCCACTCGTACTGAAG GGG (reversed) Intronic
904415112 1:30356177-30356199 TTGGGCCATTTGAACTGAAGGGG - Intergenic
915279867 1:154815044-154815066 TCGGGCCACTCGTACTGAAGGGG - Intronic
1074714786 10:116208228-116208250 TCTGGCCACTCCTTCTGCAGTGG + Intronic
1129369194 15:75077717-75077739 TGGGGCCAAGCGGACTGAAGTGG - Intronic
1156127439 18:33923928-33923950 TGGTGCCACTAGTACTTAAGGGG + Intronic
1162310732 19:9905660-9905682 TTGAGCCACTAGTGCTGAAGGGG + Intronic
1165793686 19:38506765-38506787 CCGGGCCACTCTCACTGAAGTGG - Intronic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
938025381 2:127943229-127943251 TCAGGTCACTGCTACTGAAGAGG + Intronic
1173595744 20:44257668-44257690 TGGGGCCACTCATGCTGAAGGGG - Intronic
1174271661 20:49373825-49373847 TCTGCCCACTCGCACAGAAGGGG - Exonic
1181028375 22:20138376-20138398 TCGGGCCACACGGCCTGCAGCGG - Intronic
950186050 3:10946167-10946189 TCTGTCCACTTGTACAGAAGAGG - Intergenic
955215495 3:56981977-56981999 TGGGGCCACTCCCACTGAACAGG - Intronic
967411956 3:189175389-189175411 TAGGGCCAGTGGAACTGAAGTGG + Intronic
967814035 3:193784031-193784053 TCGGACCACTGGTGCAGAAGAGG - Intergenic
972808875 4:42561342-42561364 TGGGGCCACTCACACTGAGGTGG + Intronic
980859475 4:138482170-138482192 TCGGGCCACACCTACGGATGAGG + Intergenic
1020193272 7:6016978-6017000 GTGGGCCACTGGCACTGAAGAGG + Intronic
1035028190 7:155840645-155840667 TAGGGCCACTCCTTCTGAAGAGG - Intergenic
1042374748 8:68037508-68037530 ACTGGCCACTAGAACTGAAGAGG - Intronic
1047302379 8:123624680-123624702 GGAGGCCACTCGTATTGAAGGGG + Intergenic