ID: 915279883

View in Genome Browser
Species Human (GRCh38)
Location 1:154815128-154815150
Sequence CAGGCTGAGAAGTCTGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915279875_915279883 27 Left 915279875 1:154815078-154815100 CCATCTGCTCATCACACCTGAGT 0: 1
1: 0
2: 0
3: 25
4: 187
Right 915279883 1:154815128-154815150 CAGGCTGAGAAGTCTGTCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 245
915279877_915279883 11 Left 915279877 1:154815094-154815116 CCTGAGTTAAGGAGCTGACATGC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 915279883 1:154815128-154815150 CAGGCTGAGAAGTCTGTCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915279883 Original CRISPR CAGGCTGAGAAGTCTGTCTG GGG Intronic
900489712 1:2941690-2941712 GGGGCTGAGCAGTGTGTCTGGGG + Intergenic
900945884 1:5831135-5831157 CAGGCTGAAAAGGGGGTCTGAGG + Intergenic
901199614 1:7459220-7459242 CAGGCTCAGCAGTTTGTCTAAGG - Intronic
902816700 1:18920611-18920633 CAGCCTGAGCAGGCTCTCTGTGG - Intronic
903221860 1:21873716-21873738 CAGGCTAGGATGTGTGTCTGAGG + Intronic
903811878 1:26039148-26039170 CTGGCTGAGCAGTCAGTCTGAGG + Exonic
905008942 1:34733771-34733793 AAGGCTGAGAACTGGGTCTGGGG + Intronic
905193735 1:36257509-36257531 GAGGCTGACAAGTATGCCTGTGG + Intronic
905917001 1:41691540-41691562 GAGGATGAGAAGTCTTTCTTTGG - Intronic
906717192 1:47979059-47979081 GAGGCTGAGAAGGCTCTCAGTGG + Intronic
906913768 1:49984611-49984633 CAGGCTGGGAAGTGTGCCTCTGG - Intronic
907114071 1:51953242-51953264 CATTCTGAGAAGTCTCTCTGGGG + Intronic
909519570 1:76551838-76551860 GAGGCTGTGAAGTGTGTGTGTGG - Intronic
910542230 1:88372846-88372868 CAGGCTGAAAAATCGTTCTGAGG - Intergenic
910745583 1:90570613-90570635 CAAGCTGATAAGACTGTCTGAGG - Intergenic
912323240 1:108734228-108734250 CAGACTGAGAATTATGACTGAGG + Intronic
912558595 1:110534080-110534102 CAGGGTGAGAAGGCTTTCTATGG + Intergenic
913126384 1:115794093-115794115 GAGGCTGGAAAGTCTGGCTGAGG + Intergenic
913606803 1:120474865-120474887 AAGACAGAAAAGTCTGTCTGGGG + Intergenic
914209629 1:145565276-145565298 TAGACAGAAAAGTCTGTCTGGGG - Intergenic
914268549 1:146057645-146057667 AAGACAGAAAAGTCTGTCTGGGG - Intergenic
914368543 1:147003218-147003240 AAGACAGAAAAGTCTGTCTGGGG + Intergenic
915093709 1:153444476-153444498 CAGGCTGTGAAGCCTGGCCGTGG + Intergenic
915279883 1:154815128-154815150 CAGGCTGAGAAGTCTGTCTGGGG + Intronic
916312666 1:163414221-163414243 CATGCCGTGATGTCTGTCTGGGG + Intergenic
916877363 1:168983737-168983759 GAGGCTGAGAAACCTGGCTGTGG - Intergenic
917135432 1:171784375-171784397 CAGGCTGGGGAGTGTGTCTCTGG + Exonic
917281712 1:173383464-173383486 AAAGCTGATATGTCTGTCTGTGG + Intergenic
917613278 1:176711517-176711539 CAGCCAGGGAAGTCTGTCTGGGG - Intronic
920260960 1:204687388-204687410 CAGGCTCAGCAGTTTATCTGTGG + Intergenic
1063094635 10:2898811-2898833 CAGGCTGAGAAACCTCACTGTGG - Intergenic
1063560712 10:7124111-7124133 ATGGCTGTGTAGTCTGTCTGGGG - Intergenic
1065377964 10:25061809-25061831 CAGTCTGAGAAGTTAGTCTGAGG + Intronic
1066696725 10:38085522-38085544 CAGGCTGAGAAGAATGCCTCTGG + Intergenic
1066995837 10:42562210-42562232 CAGGCTGAGAAGAATGCCTCTGG - Intergenic
1069579462 10:69555553-69555575 GAGGCTGGGAACTCTGCCTGAGG + Intergenic
1069691796 10:70358591-70358613 CAGGCAGTGGTGTCTGTCTGGGG - Intronic
1069813897 10:71181309-71181331 CAGTCTCAGCACTCTGTCTGAGG - Intergenic
1069987298 10:72293151-72293173 CATGCTTAGAAGTCTGTCCAGGG + Intergenic
1071243456 10:83736705-83736727 GAGTCTGAAAATTCTGTCTGTGG + Intergenic
1072201688 10:93165670-93165692 CAGGCTGAGGAGTCTGAGTTTGG - Intergenic
1073164349 10:101431365-101431387 AAGGCTGAGGGGTCTGTGTGCGG - Intronic
1073740616 10:106401969-106401991 CAGGCTGAGAAGTGTAGTTGGGG + Intergenic
1074780525 10:116798946-116798968 CAGGCTGCGGAGGATGTCTGTGG - Intergenic
1081658810 11:44875240-44875262 CAGGCTTAGAGGTCTGGTTGGGG - Intronic
1083105565 11:60355135-60355157 CAGTCTGTGAATTCTGACTGGGG - Intronic
1083980601 11:66165325-66165347 AAGGCTTAGAAGTCTGGCAGAGG - Intronic
1085223509 11:74896416-74896438 CAGGCAGAGGAGCCTCTCTGTGG - Intronic
1086566675 11:88234674-88234696 TTGGCTGTGAAATCTGTCTGGGG + Intergenic
1089520741 11:119061412-119061434 CAGGCTGAGAACTGTAGCTGTGG - Intergenic
1089634912 11:119805833-119805855 CAGGCTGAGAAGCCAGGCAGTGG - Intergenic
1089791034 11:120944078-120944100 CTGGCTGAGGAGTCTGGCTTTGG + Intronic
1090258646 11:125303331-125303353 CAGGCTGAGGAATGTGCCTGGGG + Intronic
1090315742 11:125786411-125786433 GAGGCTGAGAAGTAGGTCAGAGG + Intergenic
1091934229 12:4422781-4422803 GATTCTGAGAAGTCTTTCTGAGG + Intergenic
1096217776 12:49808059-49808081 CAGGCTGTGAGGACTGGCTGCGG + Intronic
1098198425 12:68027455-68027477 GAGGCTGACAATTCTCTCTGTGG - Intergenic
1099702782 12:86108890-86108912 TAGGCTGGGAAGTGTGTCTCCGG - Intronic
1103233359 12:119350977-119350999 CAGGCTGGGAAGTGCTTCTGGGG - Intronic
1106173517 13:27309041-27309063 AAGGATGAGAAGTTTGGCTGGGG - Intergenic
1106640346 13:31578000-31578022 CACAATGAAAAGTCTGTCTGTGG - Intergenic
1108545376 13:51488186-51488208 TAGGAGGAGAAGTCAGTCTGGGG - Intergenic
1108604593 13:52024795-52024817 CCAACTGAGAAGGCTGTCTGAGG + Exonic
1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG + Intergenic
1111965147 13:94853723-94853745 CAAGCTGAGAATTCTGAATGTGG + Intergenic
1112660510 13:101502310-101502332 CAGGCTAAGAAATTAGTCTGTGG + Intronic
1115250863 14:31345787-31345809 CAGTATGAGAAGTGTGTATGGGG + Intronic
1118822228 14:69353011-69353033 CAGGCTGAGACCTCTCTCTCGGG + Intronic
1119388947 14:74277022-74277044 CAGACTGAGAAGACTTGCTGGGG + Intergenic
1119555785 14:75551313-75551335 CAGGATGAGAAGTGTGGGTGGGG + Intergenic
1119686888 14:76640204-76640226 AAGGCTGAGAAATATGTCAGTGG - Intergenic
1122680126 14:103453863-103453885 GAGGCTGGGAAGTCTCACTGTGG + Intronic
1124836771 15:33202976-33202998 CAGTCTGAGAAGGCTTCCTGAGG + Intergenic
1125139847 15:36392787-36392809 CAGGCTTAGGAATATGTCTGTGG - Intergenic
1125720426 15:41842588-41842610 CAGGGTGAGAGGCCTGGCTGGGG + Exonic
1127535158 15:59883312-59883334 CAGGCAGAGAAGTCTGATGGTGG + Intergenic
1127874905 15:63103640-63103662 CAGGCTGGGCAGTCTCTCAGAGG - Intergenic
1128539327 15:68515414-68515436 CAGGGTTAGATGTCAGTCTGTGG + Intergenic
1130633932 15:85598418-85598440 CCCGCTGACAAGTCAGTCTGTGG - Intronic
1132572819 16:651426-651448 GAGGGTGGGAAGTCTGTGTGAGG + Intronic
1133366495 16:5214545-5214567 GTGTCTGAGAAGTTTGTCTGTGG + Intergenic
1134135278 16:11673182-11673204 CATGGTGGGAAGGCTGTCTGTGG + Intronic
1135591722 16:23710022-23710044 CATTGTGAGAAGGCTGTCTGAGG - Intronic
1136012008 16:27369869-27369891 CAGGATCAGAAGTCAGTCTGTGG - Intergenic
1136633935 16:31507531-31507553 GAGACTCAGAAGTCTGTGTGGGG + Intronic
1139160915 16:64507692-64507714 CAAGCAGAGAAGTTTGTCTTTGG + Intergenic
1139335486 16:66228078-66228100 AGGGCTGAGAACTCTGTCTCTGG - Intergenic
1139529598 16:67536616-67536638 CAGGCTGAGCACTCCCTCTGTGG + Intronic
1140948353 16:79792360-79792382 CAGGCGGAGATGTGTGTCTTTGG + Intergenic
1143410622 17:6706371-6706393 CAGGCTTGGAAGGCTTTCTGGGG - Intronic
1144764932 17:17727478-17727500 AGGGCCGAGAAGCCTGTCTGGGG - Intronic
1144807408 17:17977155-17977177 CAGGCTGACAGGCCTGGCTGGGG + Intronic
1146894153 17:36529082-36529104 CTGGCTCAGACGGCTGTCTGAGG + Intronic
1147936111 17:44012269-44012291 CAGGCTCAGAAGCCTGTCTGGGG + Intronic
1148987794 17:51638737-51638759 GAGGCTGTGAGTTCTGTCTGGGG + Intronic
1152258408 17:79253680-79253702 CTGGCTGGCCAGTCTGTCTGCGG + Intronic
1155743221 18:29316400-29316422 CAGGCTGAAAATTCTGGCAGGGG - Intergenic
1158640489 18:59199403-59199425 CAGTCTGAGAAGTCAGTACGTGG + Intergenic
1158835345 18:61325035-61325057 GTGGCTAAGAAGTCTGCCTGAGG - Intergenic
1159069286 18:63605432-63605454 CAGCCACAGTAGTCTGTCTGAGG + Intergenic
1159284876 18:66336455-66336477 CAAGCAGAGGAGTCTTTCTGTGG + Intergenic
1159621291 18:70641654-70641676 CAGGGTCAGAAATATGTCTGTGG - Intronic
1159809826 18:73004444-73004466 CAGGTTGAGAAATCTTTCTATGG - Intergenic
1160756209 19:758246-758268 AAGGCTGAGAATTCTAGCTGGGG - Exonic
1160841672 19:1149181-1149203 CAGGCTGAGACCCCTGTTTGTGG - Intronic
1161091663 19:2363301-2363323 CAGGCTGGGGACTCTGTCCGCGG + Intergenic
1162064509 19:8117002-8117024 CAGGGTGAGCAGCCTGCCTGGGG + Intronic
1165370152 19:35400279-35400301 CAGGCTGGGAAGTGTGCCTTCGG - Intergenic
1166099820 19:40565371-40565393 CAGGCTGAGGAGGCTCCCTGTGG + Intronic
1166298128 19:41898528-41898550 CAGGCTGTGCAGGGTGTCTGGGG - Exonic
1166651870 19:44581004-44581026 CAGGATGAGACTTCTGGCTGAGG - Intergenic
1202708691 1_KI270714v1_random:4613-4635 AAGACAGAAAAGTCTGTCTGGGG + Intergenic
925482150 2:4287238-4287260 CATGTTGAGAACTCTGACTGTGG + Intergenic
927053493 2:19350888-19350910 CAAGCAGAGAATTGTGTCTGAGG + Intergenic
927183486 2:20465829-20465851 GAGGCTGGGCAGGCTGTCTGTGG - Intergenic
927420064 2:22921307-22921329 CAAGCTGAAAGATCTGTCTGAGG + Intergenic
927706459 2:25299349-25299371 CAGGCTGAGGAGTCTCTGTGAGG - Intronic
927734424 2:25506125-25506147 GAGGCTGAGAAGGGTGTGTGAGG + Intronic
928660030 2:33492682-33492704 GAGGCTGAGAAGTCCCTGTGAGG - Intronic
929253143 2:39780679-39780701 CTGACTGTCAAGTCTGTCTGGGG + Intergenic
931647649 2:64439500-64439522 CAGGCTGAAGAGTATGTGTGTGG + Intergenic
932497173 2:72151625-72151647 CAGAGTCAGAAGTCTATCTGAGG - Intergenic
933245367 2:79969026-79969048 CAGGGTAAGCAGTTTGTCTGTGG + Intronic
935183178 2:100707899-100707921 CAGGTTGATATGTCTGACTGTGG - Intergenic
935676726 2:105600772-105600794 CAGGCTCAGAAGTGTGCCTCTGG + Intergenic
935720938 2:105978682-105978704 CAGATTGAGAATTATGTCTGAGG + Intergenic
936116844 2:109709525-109709547 CAGGCTCAGTGGTCTGTCTAGGG - Intergenic
938551200 2:132383971-132383993 CAGGCTGAGAGGTCTGCCTAAGG + Intergenic
938551439 2:132386056-132386078 CAGGCTGAGAGGTCTGCCTAAGG + Intergenic
941934294 2:170971196-170971218 CATACTAAGAAGTCTGCCTGAGG + Intergenic
942451504 2:176110920-176110942 AAGGCTGAGAATTCTGGCGGGGG + Intronic
944106709 2:196086926-196086948 CAGAGTGAGAAGCCTGTCTTGGG - Intergenic
944228882 2:197373675-197373697 CAGAGTGAGAACTCTGTCTCGGG - Intergenic
946031472 2:216708423-216708445 CAGGATGAGAAGGCTGACTCAGG + Intergenic
946217782 2:218199005-218199027 AAGACTGAGAAGTGTGCCTGGGG - Intergenic
946509303 2:220337038-220337060 CAGACAGGGAAGTGTGTCTGTGG + Intergenic
948459489 2:238122288-238122310 AGGGATGAGAAGTCTGGCTGTGG - Intronic
1170125435 20:12958011-12958033 GAGGCTGAGAAGAGTGTGTGTGG - Intergenic
1172132430 20:32664615-32664637 CACGCTGAGGAGCCTGCCTGTGG - Intergenic
1175895694 20:62334689-62334711 CAGACTGAGAAGCCTGCCTGGGG + Intronic
1176033515 20:63025239-63025261 CTGGCTGAGCAGTTTCTCTGTGG + Intergenic
1177103505 21:16924859-16924881 CAGGGTGAGAAGACTATTTGTGG + Intergenic
1178894107 21:36544442-36544464 CAGGCAGGGATGACTGTCTGAGG - Intronic
1180622005 22:17168658-17168680 CATGCTTAGAACTCTGTCAGGGG - Intergenic
1182055571 22:27351840-27351862 CAGGCTGAGAAGTATTACTTAGG + Intergenic
1182408119 22:30155938-30155960 CAGGGTGAGGAGGCAGTCTGGGG - Intronic
1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG + Intronic
1183099974 22:35578032-35578054 CAGGCAGAGAGGTCTGTTTTGGG + Intergenic
1183272401 22:36870407-36870429 CAGGCTGAGCAGGCTCTGTGTGG - Exonic
1183314043 22:37127572-37127594 CAGGCTGAGAAGTGGGGCTGAGG + Exonic
1184087976 22:42276966-42276988 CTGGCTCAGAAGTCTGTCAGTGG + Intronic
949850408 3:8414774-8414796 CAGACTGAAAATTCTGCCTGTGG + Intergenic
950250139 3:11458239-11458261 CAGGCTTAGAAGTCAGACTTGGG + Intronic
950556660 3:13700102-13700124 GAGGGTGGGAAGGCTGTCTGGGG + Intergenic
951536150 3:23742708-23742730 GAGGCTGAGAAGTTTCTCAGGGG + Intergenic
951788495 3:26452278-26452300 GAGGCTAAGTAGTTTGTCTGAGG + Intergenic
952220239 3:31317120-31317142 CAGCCTGAGCAGTCTGGGTGTGG + Intergenic
953272074 3:41455576-41455598 CAGGCCCAGAAGTCTGGCTCAGG - Exonic
953653730 3:44830988-44831010 TAGGCTGAGAATACTTTCTGAGG + Exonic
953786855 3:45917461-45917483 CAGGCTGAGATGGCTGGCAGAGG - Intergenic
958106386 3:89079040-89079062 AAGGCTGACAAGTGTATCTGAGG + Intergenic
959440421 3:106367444-106367466 AAGACTAAGAAGTCTGTTTGGGG + Intergenic
962259601 3:133894600-133894622 GAGGCTGTGAAGTCTGGCTCTGG - Intronic
962612073 3:137086286-137086308 CAGGCAGAGAAATCTGACAGAGG - Intergenic
963236224 3:142959708-142959730 CAAGAAGAGAATTCTGTCTGTGG + Intronic
963313278 3:143731534-143731556 CTGGCTCAGAAGTATGACTGAGG - Intronic
963421310 3:145064241-145064263 TAAACTGAGAAGTCTGTCGGTGG + Intergenic
965715681 3:171599956-171599978 CAAGCTGAGAAGTCATTTTGCGG - Intergenic
968228101 3:196988565-196988587 CAGGCTGAAAAGTTTTGCTGTGG + Intergenic
969874222 4:10124053-10124075 CAGGCTGTGAAGACTGTTTCAGG + Intergenic
971358445 4:25914960-25914982 CAGGCTGAGAATGGTGACTGGGG + Intronic
971648921 4:29246352-29246374 TAGACTGGGAAGTCTGACTGGGG + Intergenic
971954134 4:33394175-33394197 CAGGCTCAGATGTCTTTTTGAGG - Intergenic
975142629 4:70934051-70934073 CAGAATGAGAAGTATGTATGTGG - Intronic
975507713 4:75157309-75157331 CACACTGAAAAGTCTCTCTGTGG - Intergenic
975792483 4:77969265-77969287 CAGCCAGAGAAGGCTGGCTGCGG + Intergenic
978307670 4:107349481-107349503 CAGGAAGAGAGGGCTGTCTGTGG - Intergenic
978814372 4:112886097-112886119 CAGTCACAGAAGTCTGTCTGGGG + Intronic
982132233 4:152239975-152239997 GAGGCTGAGTAATTTGTCTGAGG + Intergenic
982305896 4:153930254-153930276 TAGGCTGAGATATTTGTCTGAGG + Intergenic
985829126 5:2215030-2215052 AAGCCTGAGAACACTGTCTGTGG - Intergenic
990636831 5:57737457-57737479 CAGTCTGATAAGTCTTTCTTGGG + Intergenic
993952060 5:94188036-94188058 GAGGATGAGAAATCTCTCTGGGG - Intronic
998625200 5:143838629-143838651 CAGGAGGAGGAGTGTGTCTGGGG + Intergenic
999074424 5:148780928-148780950 CAGCCAGAGAACACTGTCTGGGG - Intergenic
999116803 5:149171492-149171514 CAGACTGAGAGGTCTGTGAGAGG + Intronic
999416918 5:151406266-151406288 CAGGCTTCGAAGTATGTCTGTGG + Intergenic
999849741 5:155525120-155525142 GAGGCAGTGAAGTCTGGCTGAGG + Intergenic
1000546586 5:162610577-162610599 CCCGCTGAGAACTCTGTCTTGGG - Intergenic
1001705091 5:173735777-173735799 CAGGCTGAGATGTCAGGGTGAGG - Intergenic
1002025403 5:176393228-176393250 TAGGCTGGGAAGACTTTCTGAGG - Intronic
1002497784 5:179627149-179627171 CAAACTGAGAAGAATGTCTGGGG - Intronic
1002597858 5:180335717-180335739 TAGGCTGAGAAGTCAGTTAGAGG + Intronic
1005041167 6:21601798-21601820 AAGGCTGAGAAATCTGTCCAAGG - Intergenic
1005161111 6:22864969-22864991 TGGGCTGAGAAGACTGTATGAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007191839 6:40025914-40025936 GAGGCTGGGAAGTCTGTCAAGGG - Intergenic
1007268825 6:40620265-40620287 AAGGCAGAGCAGTCTGTCTCTGG + Intergenic
1007281231 6:40713841-40713863 CAGTCAGGGAAGTCTCTCTGTGG + Intergenic
1007303327 6:40885096-40885118 CAAAATGAGAAGTATGTCTGGGG + Intergenic
1010355551 6:74928413-74928435 CAGGTTGAGGTGTCTGCCTGAGG + Intergenic
1011353441 6:86448248-86448270 CATGCTGGGAACTCTGTATGAGG + Intergenic
1011744923 6:90400216-90400238 CGGGCTGAGAAATCTTCCTGTGG - Intergenic
1013122357 6:107151914-107151936 CAGGCTGAGAGGTGTGATTGAGG + Intergenic
1014134522 6:117873181-117873203 CAGCCAGAGAAGTTTGGCTGTGG + Intergenic
1014899038 6:126940835-126940857 CAGGTTAAGAAGGCTGTCTCTGG - Intergenic
1018352071 6:162970307-162970329 CAGTCTGAGGAGGGTGTCTGGGG + Intronic
1021768054 7:23968964-23968986 CTGGCTGAGAAGGCTCTCTGTGG - Intergenic
1021804440 7:24341170-24341192 CAGGCTCAGCAGTCTGACTTTGG - Intergenic
1022465026 7:30647892-30647914 CAGCGGGAGAAATCTGTCTGTGG - Intergenic
1023504970 7:40889603-40889625 CAGGCTGAGATCTCTTTCTGTGG + Intergenic
1024376960 7:48651248-48651270 CAGGCAGAGAAGGCAGTCGGAGG - Intergenic
1024377080 7:48652340-48652362 AAGGCTGAGGGGTCTCTCTGGGG - Intergenic
1024671690 7:51601348-51601370 CAGGGTGTGAAGTTTGTGTGAGG + Intergenic
1026116768 7:67502410-67502432 CAGGGAGAGAAGACTGTCTTGGG + Intergenic
1026435239 7:70391017-70391039 AAGGCTGAGAAAACTGTCTAGGG - Intronic
1026764802 7:73153958-73153980 CAGGCTGAGAACTCTTTTTCAGG - Intergenic
1027041275 7:74963728-74963750 CAGGCTGAGAACTCTCTTTCAGG - Intergenic
1027049382 7:75012175-75012197 CAGTCTGAGAAGACTCTCAGGGG + Intronic
1027055817 7:75048624-75048646 CAGGCTGGAATGTTTGTCTGTGG + Intronic
1027082365 7:75238648-75238670 CAGGCTGAGAACTCTCTTTCAGG + Intergenic
1028221433 7:88201520-88201542 CAAGCACAGAAGTCTGTCTTAGG - Intronic
1029383644 7:100229477-100229499 CAGTCTGAGAAGACTCTCAGGGG - Intronic
1031193848 7:118588215-118588237 CATGCTGAAAACTCTGTGTGGGG + Intergenic
1032471076 7:132179853-132179875 CAGGCTGAGCGGGCTGTCCGGGG + Exonic
1034072282 7:148198101-148198123 CAGGCTGAGAAGCCTGAGGGTGG + Intronic
1035348887 7:158229035-158229057 CAGTGTGAGAAGGCTGGCTGGGG - Intronic
1036074225 8:5476724-5476746 CAGACTCAGTGGTCTGTCTGAGG - Intergenic
1037818849 8:22125910-22125932 CAGGCTGAGCAGGGAGTCTGAGG + Intronic
1040552459 8:48449095-48449117 CAGGCTGATGAGGCTGTCAGTGG - Intergenic
1041315654 8:56559492-56559514 CAGGCTGAGGAGTCTGGCCCCGG + Intergenic
1041483074 8:58344734-58344756 CAAGAAGAGAAGCCTGTCTGGGG + Intergenic
1041794759 8:61735725-61735747 CAGGCTGAGAAGTGTGCCTCAGG + Intergenic
1041820826 8:62030759-62030781 TAAGCTGAGAAGTCTGACTGAGG + Intergenic
1041966357 8:63682970-63682992 CAGGCTTAAAAGGCTGTCTGGGG - Intergenic
1042097293 8:65230917-65230939 GGAGATGAGAAGTCTGTCTGAGG - Intergenic
1043745432 8:83868990-83869012 CAGGCTGAGCTGCCAGTCTGAGG + Intergenic
1044790205 8:95839189-95839211 CAGACAGAGAGGTCAGTCTGGGG + Intergenic
1047274831 8:123397853-123397875 CTGGCTGAGAAGTCTGACAAAGG + Intronic
1048098133 8:131316525-131316547 CAGGCTGAGCAGTATGTACGGGG - Intergenic
1048547635 8:135402573-135402595 TGGGCTGAGAAGGCTGGCTGGGG - Intergenic
1049285890 8:141775005-141775027 CATGCAGAGAAGTCAGCCTGGGG + Intergenic
1049538975 8:143197867-143197889 CAGGGTGAGTAGACTGTCAGGGG - Intergenic
1049634738 8:143681527-143681549 GAGGCTGTCAAGGCTGTCTGAGG + Intergenic
1049657260 8:143804389-143804411 CATACTGAGGAGTCTGGCTGTGG + Intronic
1050367326 9:4884608-4884630 CAGGCTGAGAGATCTGGCTCAGG - Intronic
1051681041 9:19608529-19608551 CAGGCTCAGAAGTCAGACTTGGG + Intronic
1052043347 9:23766671-23766693 CAAGCGGAGAAGACTGTCTGGGG - Intronic
1052664750 9:31480990-31481012 CAGGATGAGAAATCAGTCGGGGG + Intergenic
1054920304 9:70536706-70536728 CCGGCTTGGAGGTCTGTCTGTGG + Exonic
1055300146 9:74874284-74874306 GAGACTCAGAAGTCTGTCAGTGG + Intronic
1056921327 9:90791970-90791992 CAGGCTAAGGAGTCTGTTTCTGG + Intergenic
1057141193 9:92727709-92727731 GAGGCTGAGACGACTGTCTTGGG - Intronic
1057185045 9:93052808-93052830 CAGGCTTTGGAGCCTGTCTGGGG - Intergenic
1058881271 9:109287896-109287918 CTGGCTGGCAAGTCTTTCTGTGG + Intronic
1059235726 9:112759245-112759267 GAGGCTGAGGAGTATGTCAGAGG - Intronic
1060146780 9:121259890-121259912 CAGGCTTGAAAGTCTTTCTGGGG + Intronic
1061752942 9:132793216-132793238 AGGGGTGAGAAGTCTCTCTGGGG + Intronic
1186041824 X:5487474-5487496 CAGGTTGAGAAGTCAGTTTGTGG - Intergenic
1188248222 X:27859377-27859399 AAGGCAGAGAAGTCTGGGTGGGG + Intergenic
1188860058 X:35244897-35244919 CAGGGTGGGCAGTGTGTCTGTGG + Intergenic
1196759635 X:119189908-119189930 AAGGCAGAGAAATCAGTCTGGGG + Intergenic
1197618154 X:128717442-128717464 CAGGCTGGGAAGTGTGCCTCCGG + Intergenic
1198307667 X:135398961-135398983 CAGGCTGGGAAGTGTGCCTCTGG + Intergenic
1198972108 X:142293428-142293450 CAAGCTGAGATGTGTGTGTGGGG + Intergenic
1199894537 X:152117806-152117828 CAGCCTGAGAAGTCTGCCCTGGG + Intergenic
1200017777 X:153179458-153179480 CAGGCTGAGACGTCTTCCCGCGG - Intronic
1201510922 Y:14761687-14761709 GAGGCTGACAAATCTGACTGTGG - Intronic