ID: 915281092

View in Genome Browser
Species Human (GRCh38)
Location 1:154822677-154822699
Sequence CAGGAGATGAGAGCAGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 561}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915281092_915281109 28 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281109 1:154822728-154822750 AGGGACGGCAGAGGAGCTACTGG 0: 1
1: 0
2: 2
3: 20
4: 219
915281092_915281099 -4 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281099 1:154822696-154822718 CCTGGCTTAGGCCAAGGGCAGGG 0: 1
1: 0
2: 2
3: 26
4: 284
915281092_915281102 1 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281102 1:154822701-154822723 CTTAGGCCAAGGGCAGGGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 451
915281092_915281103 4 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281103 1:154822704-154822726 AGGCCAAGGGCAGGGGAGGGAGG 0: 1
1: 1
2: 14
3: 199
4: 1566
915281092_915281096 -9 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281096 1:154822691-154822713 CATCTCCTGGCTTAGGCCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 128
915281092_915281095 -10 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281095 1:154822690-154822712 TCATCTCCTGGCTTAGGCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 148
915281092_915281097 -5 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281097 1:154822695-154822717 TCCTGGCTTAGGCCAAGGGCAGG 0: 1
1: 0
2: 2
3: 17
4: 240
915281092_915281101 0 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281101 1:154822700-154822722 GCTTAGGCCAAGGGCAGGGGAGG 0: 1
1: 0
2: 9
3: 38
4: 349
915281092_915281108 19 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281108 1:154822719-154822741 GAGGGAGGCAGGGACGGCAGAGG 0: 1
1: 1
2: 15
3: 319
4: 2061
915281092_915281107 13 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281107 1:154822713-154822735 GCAGGGGAGGGAGGCAGGGACGG 0: 1
1: 12
2: 213
3: 3472
4: 17096
915281092_915281106 9 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281106 1:154822709-154822731 AAGGGCAGGGGAGGGAGGCAGGG 0: 1
1: 2
2: 37
3: 442
4: 3096
915281092_915281100 -3 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281100 1:154822697-154822719 CTGGCTTAGGCCAAGGGCAGGGG 0: 1
1: 0
2: 4
3: 52
4: 568
915281092_915281105 8 Left 915281092 1:154822677-154822699 CCGGCAGCTGCTCTCATCTCCTG 0: 1
1: 0
2: 2
3: 60
4: 561
Right 915281105 1:154822708-154822730 CAAGGGCAGGGGAGGGAGGCAGG 0: 1
1: 2
2: 15
3: 234
4: 1822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915281092 Original CRISPR CAGGAGATGAGAGCAGCTGC CGG (reversed) Intronic
900334361 1:2154190-2154212 CTGGAGATGGGAGGAGATGCGGG + Intronic
900399287 1:2466447-2466469 CAGGTGGTGACTGCAGCTGCTGG + Intronic
900621518 1:3589650-3589672 CAGGAGGTCAGGGCAGGTGCAGG + Intronic
900686321 1:3950297-3950319 CAAGAGAAGAGAGCATGTGCAGG - Intergenic
900694786 1:4002923-4002945 CGGGGGATGAGAGTGGCTGCTGG + Intergenic
900926524 1:5709603-5709625 CTGGAGCTGACAGCGGCTGCAGG - Intergenic
901176273 1:7301800-7301822 CAGGAAGTGAGAGCACTTGCTGG - Intronic
901461207 1:9392877-9392899 CAGGAAATGACAGCACCTTCGGG + Intergenic
901860613 1:12072194-12072216 CAAGTGCTGAGAGCAGCTTCTGG + Intronic
903381035 1:22896994-22897016 CAGGAGGTGAGAAAAGCAGCAGG + Intronic
903570110 1:24297946-24297968 GAGGAGGGGAGAGCAGCTGGAGG + Intergenic
903690276 1:25168341-25168363 TAGGAGGTGAGGGCAGCAGCGGG + Intergenic
903777272 1:25800746-25800768 CAGGAGAGGACAGAAGGTGCAGG + Intronic
903976320 1:27152811-27152833 CAGGAGCTGAGCGGTGCTGCCGG - Intronic
904495063 1:30881914-30881936 CAGGGGGTGAGGGCAGCTGCGGG - Intronic
905269184 1:36775808-36775830 CAGGGGTAGAGAGCAGGTGCAGG - Intergenic
905376047 1:37521029-37521051 CAGCAGATTAGTGCAGCTTCAGG - Intergenic
905479085 1:38248889-38248911 CAGGAGATGTGGGCAGGTGCGGG - Intergenic
905526202 1:38641852-38641874 TAGGAGAAGAGTCCAGCTGCCGG - Intergenic
905530834 1:38677489-38677511 CAGGAGAAGAGAGAAGCTGTGGG - Intergenic
905871637 1:41407805-41407827 CAGGAGGGGAGAGCAGCTGCGGG - Intergenic
907456695 1:54580954-54580976 CTGGAGCTGAGAGTGGCTGCTGG + Intronic
907808074 1:57841278-57841300 CAGCCCATGAAAGCAGCTGCAGG - Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908634807 1:66151363-66151385 CAGGAGATGAATGAAGCTGGAGG - Intronic
908801842 1:67888712-67888734 AAGGAGCTGAAAGAAGCTGCAGG + Intergenic
909005447 1:70270692-70270714 CAGGAGATGAGCTGAGCGGCAGG - Intronic
910191871 1:84603423-84603445 GGGGAGATGCCAGCAGCTGCAGG + Intergenic
910247705 1:85159047-85159069 CAGGAGACTGGAGCAGCTGTGGG - Exonic
910434038 1:87187315-87187337 AAGGAGATGAGGGCAGATGAAGG + Intergenic
911102200 1:94103873-94103895 CAGGTGTTGAGAGGAGCTGGAGG - Intronic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
912468332 1:109889399-109889421 CGGTAGATAAGAGAAGCTGCAGG + Intergenic
912861103 1:113214695-113214717 CAGCCTGTGAGAGCAGCTGCAGG - Intergenic
913313829 1:117533159-117533181 AAGGGGATGAGAGCAGCTCTGGG + Intergenic
915281092 1:154822677-154822699 CAGGAGATGAGAGCAGCTGCCGG - Intronic
916476397 1:165173498-165173520 AAGGAGCTGAGAGCAACTCCTGG + Intergenic
916951582 1:169785547-169785569 CTGGAGAGGAGATCGGCTGCTGG - Intronic
917284141 1:173407005-173407027 CAGGATATTACAGCAGCAGCAGG + Intergenic
917838276 1:178957891-178957913 CAGGACATGAGCCCAGCTCCAGG - Intergenic
917925097 1:179782612-179782634 AAGGAGATGGCAGCAGCTTCAGG - Intronic
917958287 1:180122662-180122684 CAGAAGATGGGAGGATCTGCTGG + Intergenic
918042071 1:180919561-180919583 CAGGGGGTGGGGGCAGCTGCAGG - Intronic
918051534 1:180977078-180977100 AAGGAGATGAAAGCTACTGCTGG + Intronic
918067856 1:181113521-181113543 CAGCAGATGATAGCCGCAGCTGG + Intergenic
918667700 1:187172287-187172309 CAGGAAGTGACAGCTGCTGCAGG - Intergenic
918916254 1:190642422-190642444 ATGGTGATGAGAGCAGCTGTTGG - Intergenic
919179182 1:194059345-194059367 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
919307852 1:195866913-195866935 CAAGAGAAGAGAGCTTCTGCAGG + Intergenic
920394161 1:205631799-205631821 CGGGAGATGCGGGCGGCTGCGGG - Exonic
920564031 1:206959767-206959789 CAGAAGATGAAAGCAGCTCTCGG - Exonic
920895785 1:210048448-210048470 CAAGACAAGAGAGCTGCTGCGGG + Intronic
921536104 1:216350705-216350727 CAGCATATGAGAGCAGCCACTGG - Intronic
922232139 1:223696662-223696684 CCAGAGAAGAGAGCAGGTGCCGG - Intergenic
922336586 1:224623307-224623329 CAGCAGTGGAGAGCAGCAGCAGG - Intronic
922745010 1:228038606-228038628 CAGGAGATGGGGGCAGCACCAGG + Intronic
923072772 1:230581154-230581176 CATGAGATGAGAGAAGCTATCGG + Intergenic
923451866 1:234125582-234125604 CAGGAGCTGGGAACAGCTGGAGG - Intronic
923489243 1:234468784-234468806 CCTGAGATGGGAGCAGCTGTAGG - Intronic
923549914 1:234955374-234955396 CAGCAGTTGGGAGCAGCTGGAGG + Intergenic
924004804 1:239597762-239597784 CAGAAGATGAGAAATGCTGCTGG - Intronic
924645327 1:245872352-245872374 CAGGAGATGGGTGAAGCAGCAGG - Intronic
1062765197 10:57192-57214 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1062770447 10:96218-96240 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1062885452 10:1012489-1012511 GAAGAGCTGAGAACAGCTGCTGG + Exonic
1063035006 10:2278151-2278173 AAGGTGATCAGAGCAGCTTCTGG + Intergenic
1063046623 10:2398819-2398841 CAGGAGATGAGGGTGACTGCAGG - Intergenic
1063520640 10:6737580-6737602 CTGGAGCTGAGTGCAGCTGGAGG - Intergenic
1063577058 10:7271803-7271825 CAAGAGAAGAGAGCTTCTGCAGG + Intronic
1063630173 10:7726002-7726024 AGGGAGATGAGAGCACTTGCCGG + Intronic
1063698847 10:8364917-8364939 TAGGAGGTGAGAGCATTTGCAGG + Intergenic
1064790666 10:18954659-18954681 CAGTAGTTGAGAGCTGCTGCGGG - Intergenic
1066107209 10:32166560-32166582 CAGGTGCAAAGAGCAGCTGCTGG + Intergenic
1067093754 10:43285231-43285253 CAGGAGATGAGGGAAGCAGATGG - Intergenic
1067966749 10:50922294-50922316 CAGGTTATCAGAGCAGCTGTTGG - Intergenic
1069570832 10:69493338-69493360 CAAGAGAAGAGAGGAGATGCAGG - Intronic
1071335255 10:84595120-84595142 CAGGAGATGAGTTCTGCTGAGGG + Intergenic
1071476408 10:86029074-86029096 CTGGAGATGAGAGGAGAGGCTGG - Intronic
1072264057 10:93710693-93710715 CAGGAGATGAGAACAGAGACAGG + Intergenic
1073027153 10:100496380-100496402 CAGGAGCTTGGAGCAACTGCGGG - Exonic
1073330792 10:102668819-102668841 TAGGGGATGGCAGCAGCTGCAGG + Intergenic
1073433049 10:103499319-103499341 CTGGGGATGAGAGCAGGGGCAGG + Intronic
1073875207 10:107914697-107914719 CAGGAGGAGAGAGGAGCAGCAGG + Intergenic
1074058625 10:109944280-109944302 CAGGAGAGGCCAGCAGGTGCAGG - Intronic
1075401399 10:122163794-122163816 CTGCAGAGGGGAGCAGCTGCGGG - Intronic
1075418454 10:122282959-122282981 CAAGAGATGAAAGCAGCAGTTGG + Intronic
1075562067 10:123475081-123475103 CGGGAGTTGACAGCAGCTCCTGG - Intergenic
1075980732 10:126736977-126736999 CAGGAGGAGAAAGCAGCTCCTGG - Intergenic
1076163810 10:128266529-128266551 CAGGAGATGAGGGCAGAGACTGG + Intergenic
1076484178 10:130805165-130805187 CAGGAGTAGAGAGCAGCTGCAGG - Intergenic
1076491909 10:130867411-130867433 CTACAGATGAGAGCTGCTGCAGG + Intergenic
1076821027 10:132939652-132939674 CAGGAGAGGAGCGGAGGTGCGGG + Intronic
1077075314 11:698532-698554 CAGACAATGAGAGCAGCTGTTGG + Intronic
1077179211 11:1204659-1204681 CGGGAGCTCAGAGCTGCTGCTGG - Intergenic
1077179245 11:1204796-1204818 CGGGAGCTCAGAGCTGCTGCTGG - Intergenic
1077179265 11:1204864-1204886 CAGGAGCTCAGAGCTGCTGCCGG - Intergenic
1077598603 11:3556536-3556558 CAGGAGAGGTGAACAGTTGCAGG - Intergenic
1078513173 11:12001492-12001514 CAGGAGTTGAGATGAGCTGAGGG + Intronic
1079707336 11:23637410-23637432 CAGCCTATGAAAGCAGCTGCAGG - Intergenic
1079955173 11:26853190-26853212 CTGGAAATGTGAGCAGCTGATGG + Intergenic
1079959495 11:26905715-26905737 CAGAAATTGAGAACAGCTGCTGG + Intergenic
1080045001 11:27799257-27799279 CAGCCCACGAGAGCAGCTGCAGG + Intergenic
1082692648 11:56324872-56324894 CAGTCCATGAAAGCAGCTGCAGG + Intergenic
1082764669 11:57157555-57157577 CAGGAAGTGAGGGCATCTGCTGG - Intergenic
1083191031 11:61052634-61052656 CAGGAGCTCAGAGCAGCTGATGG + Intergenic
1083657322 11:64235750-64235772 CAGATGCTGGGAGCAGCTGCAGG + Intronic
1083667267 11:64282561-64282583 CATGAGATGAGGGCAGGGGCGGG - Intronic
1084248016 11:67873409-67873431 CAGGCGATGGCAGCAGCAGCTGG + Intergenic
1084549838 11:69834675-69834697 AGGGAGGTGGGAGCAGCTGCAGG - Intergenic
1084798545 11:71526009-71526031 CAACCCATGAGAGCAGCTGCAGG + Intergenic
1084803641 11:71564270-71564292 CAACCCATGAGAGCAGCTGCAGG + Intronic
1084818188 11:71663479-71663501 CAGGAGAGGTGAACAGTTGCAGG + Intergenic
1086154363 11:83649310-83649332 CAGGAGCTGGGAGAAGCTGGGGG - Intronic
1086392149 11:86375837-86375859 CAGGAGAAGAGAGGTGCTGCAGG + Intronic
1087023061 11:93622440-93622462 CTGGAGATGAGAGGACCTGGAGG + Intergenic
1087709522 11:101532929-101532951 CAGGAGCTCAGAGTGGCTGCTGG - Intronic
1088417210 11:109602546-109602568 CAGGAGATGACAGGAACTCCAGG - Intergenic
1089534014 11:119149691-119149713 AAGGAGATTAGAGAAGCCGCCGG + Intronic
1089759250 11:120711001-120711023 GAGGGGGTGTGAGCAGCTGCAGG + Intronic
1089810060 11:121124398-121124420 CAGGACAAGAGAGCAGAGGCAGG - Intronic
1089855187 11:121537364-121537386 CTGGAGGTGAGAGCTGATGCTGG + Intronic
1089986541 11:122819383-122819405 CAGGAGAAGAAAGGAGGTGCTGG - Intergenic
1091544434 12:1491897-1491919 CAGGAGATGTGAGTGTCTGCTGG - Exonic
1091922379 12:4315759-4315781 CAGGAGATGAGAATAGTTGAGGG - Intergenic
1092069849 12:5623644-5623666 CAGGAGAGGACGCCAGCTGCAGG + Intronic
1092219774 12:6705045-6705067 CAGGAGAAGAGTGATGCTGCAGG - Intergenic
1092424751 12:8365887-8365909 CAGGAGAGGTGAACAGTTGCAGG - Intergenic
1092654235 12:10667939-10667961 GAGGAGGTGAGAACAACTGCAGG + Intronic
1092944258 12:13438607-13438629 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1094616109 12:32037771-32037793 CAGGAGGTGAGAGAAACTGGAGG + Intergenic
1094795409 12:33966129-33966151 GAGGATGTGAGAGCAGCTCCTGG - Intergenic
1095101586 12:38190572-38190594 CAGTCCATGAGAGCAGCTGTGGG + Intergenic
1095108049 12:38259233-38259255 GAGGATGTGAGAGCAGCTCCCGG - Intergenic
1096550470 12:52368769-52368791 GTGGAGATTAGAGCAGATGCAGG - Intergenic
1097180966 12:57171720-57171742 CATGAGATGAGAGCATCAGCTGG + Intronic
1097288003 12:57892471-57892493 TGGGAGAGGAGAGCAGCTGTGGG + Intergenic
1098244085 12:68498680-68498702 TAGGAGATGTCAGCACCTGCTGG - Intergenic
1098253448 12:68592254-68592276 CAACCTATGAGAGCAGCTGCGGG - Intergenic
1098328199 12:69324505-69324527 CCAGTGATGAGAGCAGCTGTGGG - Intergenic
1098473850 12:70876943-70876965 CAGGAGATAAGAGTAGCAGTTGG + Intronic
1098498288 12:71162537-71162559 CAGGTTAAGAGACCAGCTGCTGG + Intronic
1098579484 12:72082083-72082105 GAGGCGATGAGAGCATCTGAGGG - Intronic
1101117952 12:101550289-101550311 CAAGAGATGAGAGCTCTTGCAGG + Intergenic
1101257911 12:102997928-102997950 CAGCACATGAAAGCAGCTGGGGG - Intergenic
1102245937 12:111355778-111355800 CTGGAGCTGAGAGCAGCCGAGGG - Intergenic
1103359999 12:120347845-120347867 CTGGAGAAGGGGGCAGCTGCGGG - Intronic
1103862747 12:124027452-124027474 CAGAAGATGGGAACAGATGCAGG - Intronic
1104052147 12:125202558-125202580 CAGGAACTGAGAGCAGCCTCTGG - Intronic
1104451009 12:128868160-128868182 CAGGAGAGGGAAGCAGATGCAGG - Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104943368 12:132405038-132405060 GAGCAGATGGCAGCAGCTGCAGG + Intergenic
1105257375 13:18753084-18753106 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
1105258712 13:18762917-18762939 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1105261381 13:18782220-18782242 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1105262721 13:18791761-18791783 CAGTCCGTGAGAGCAGCTGCAGG + Intergenic
1105296410 13:19090843-19090865 CTGGTGATGAGCGCAGCGGCAGG + Intergenic
1106115696 13:26815883-26815905 CAGGAGCTGAGAGGAGATGCAGG - Intergenic
1106714468 13:32373693-32373715 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1107126401 13:36851210-36851232 AGTGAGATGAGAGCAGCCGCAGG - Intronic
1108490453 13:50976262-50976284 CAGGGCCTGAGAGGAGCTGCTGG - Intergenic
1108533247 13:51346785-51346807 CAAAAGTTGAGAGCAGCTCCTGG + Intronic
1109225232 13:59685776-59685798 CAGGAGATCTAAGCAGCTACAGG + Intronic
1110227137 13:73131522-73131544 AAGGAGGTGAGAGCTCCTGCAGG - Intergenic
1110464647 13:75787350-75787372 CAGCAGAGGAGTGCTGCTGCAGG - Intronic
1111105088 13:83634842-83634864 CAAGAGATGTGAGCAGCATCTGG + Intergenic
1111144849 13:84166721-84166743 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1112179644 13:97065916-97065938 CAGGAGGTGAGAGCAACTGAAGG - Intergenic
1112268878 13:97950296-97950318 CAGGAGAAGAGAGCTTGTGCAGG - Intergenic
1112820809 13:103332754-103332776 CAAGAGAAGAGAGCATGTGCAGG + Intergenic
1113600144 13:111562889-111562911 AAGGGGGTGAAAGCAGCTGCAGG + Intergenic
1113681234 13:112246323-112246345 GAAGAGATGAGAGCACCTCCAGG - Intergenic
1113793775 13:113045074-113045096 CCGTAGATGAGAGCAGGTTCTGG + Intronic
1113949706 13:114065253-114065275 CACGTGATGGGAGCAGCCGCAGG - Intronic
1114433034 14:22678777-22678799 CAGCCGATGAAAGCATCTGCAGG + Intergenic
1115912368 14:38270628-38270650 CATGAGATGAGATTAGCTGGGGG - Intergenic
1115916505 14:38321145-38321167 CAGCCAATGAGAGCAGCTGTAGG - Intergenic
1116120670 14:40718362-40718384 CAAGAGAAGAGAGCTGATGCAGG - Intergenic
1119234489 14:73008114-73008136 TAGGATAGGAGAGGAGCTGCAGG - Intronic
1119850612 14:77863932-77863954 AAGGAAATGAGGCCAGCTGCTGG + Intronic
1119896260 14:78222264-78222286 CAGGGCCAGAGAGCAGCTGCTGG + Intergenic
1119918670 14:78426177-78426199 AAGGAAATGAGAGCAGAGGCTGG + Intronic
1120051302 14:79869869-79869891 CAGGGGAAGAGAGCAGAGGCAGG + Intergenic
1120128180 14:80772360-80772382 TTGGAGAGGAGATCAGCTGCTGG + Intronic
1120571015 14:86116564-86116586 CAGCATGTGAAAGCAGCTGCAGG + Intergenic
1120850125 14:89162514-89162536 GAGGAGATGAAAGAAGCGGCAGG - Exonic
1121079313 14:91095016-91095038 TAGGAGAGGTGACCAGCTGCTGG - Intronic
1121579105 14:95013474-95013496 GAGGAGAGGAGAGCCGCAGCAGG + Intergenic
1121801159 14:96775216-96775238 CAGGACATGAGAGGAGTTCCAGG + Intergenic
1121898723 14:97672873-97672895 CAGGAGGGGAGAGCTGCTTCTGG + Intergenic
1121914183 14:97820945-97820967 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
1122115335 14:99524744-99524766 CAGGAGCTGAAATCACCTGCTGG + Intronic
1122180919 14:99953979-99954001 CAGGAGCTGAGAGATGGTGCTGG - Intergenic
1122693985 14:103544058-103544080 CAGGGCATGCGAGCAGCTCCTGG + Intergenic
1122765441 14:104066331-104066353 CAGGCTGTGAAAGCAGCTGCAGG - Intergenic
1122852403 14:104543703-104543725 CAGGAGAAGAGAGCGGCAGCAGG - Intronic
1122889342 14:104725191-104725213 GGGGCGCTGAGAGCAGCTGCCGG - Intronic
1122983891 14:105203501-105203523 CAGGACCAGAGAGCAGCAGCAGG + Intergenic
1202834719 14_GL000009v2_random:69233-69255 CAGCCCATGAGAGCAGCAGCAGG - Intergenic
1124227015 15:27903322-27903344 CAGGAGAGGAGGGCAGCTGTGGG - Intronic
1124831877 15:33156900-33156922 GAGGAGATGAGAACAGCTAGAGG - Intronic
1125066041 15:35487123-35487145 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1125416743 15:39461707-39461729 CAAGAGATCTGAACAGCTGCTGG - Intergenic
1125921607 15:43528657-43528679 AAGGAGCTGAGAGGAGCTCCCGG + Exonic
1126684182 15:51232968-51232990 CAGGAGATGAGAGAAGCAATAGG - Intronic
1126929558 15:53632628-53632650 CAGCCCATGAGAGCAGCTGTGGG + Intronic
1126963790 15:54028544-54028566 CAGGAGATGAGGGAGGCAGCAGG - Intronic
1128062796 15:64745906-64745928 CAGGAGAAGGTAGCAGCTGAAGG - Intronic
1129225279 15:74166707-74166729 ATGGAGATGAAAGCAGCTGGTGG - Intergenic
1129253209 15:74319816-74319838 CAGGGGCTGAGGTCAGCTGCCGG + Intronic
1130133789 15:81164866-81164888 CAGTAGATGGGAGAAGCAGCTGG - Intronic
1130688602 15:86060734-86060756 CAGGGGATGTGAGCAGCATCTGG + Intergenic
1130715120 15:86325911-86325933 CTGAAGAAGAGAGCAGCTACTGG - Intronic
1130872409 15:87981856-87981878 GAGGAGATGAGAGGAGGTGGTGG + Intronic
1131144137 15:90000815-90000837 CTGGAGAGGAGAGCCGGTGCGGG - Intergenic
1132265861 15:100470207-100470229 CAGGAGGTGGGAGGAGTTGCTGG + Intronic
1132570790 16:643019-643041 CAGGAGTTCAGGGCAGCTACAGG + Intronic
1132573137 16:652721-652743 CAGGAGGTGACAGCAGCTGTGGG - Intronic
1132721703 16:1319802-1319824 GGGGAGATGGGAGGAGCTGCAGG - Intronic
1132802242 16:1760123-1760145 CCAGAGATGAGGACAGCTGCTGG - Intronic
1133043036 16:3070708-3070730 CAGCCCATGAAAGCAGCTGCGGG - Intronic
1133045121 16:3083643-3083665 CAGCCCATGAAAGCAGCTGCGGG - Intergenic
1133373490 16:5264155-5264177 CAGGAGAGGTGAACAGTTGCAGG + Intergenic
1133864976 16:9633785-9633807 AAGCAGATGTGAGCAGCTGGAGG - Intergenic
1133912511 16:10078743-10078765 CAAGAGAGGTGAGAAGCTGCTGG + Intronic
1134903524 16:17959890-17959912 AAGGAGTTGAGAGCAGCCTCGGG + Intergenic
1137067908 16:35868748-35868770 CAGGAGAGGAGAGGATCTTCAGG + Intergenic
1137405683 16:48187448-48187470 CAGACCATGAGAGAAGCTGCAGG + Intronic
1137407360 16:48200161-48200183 CCTGAGATGAGGACAGCTGCTGG + Intronic
1137735593 16:50720637-50720659 CAGGATAGGAGAGAGGCTGCTGG - Intronic
1138114744 16:54351330-54351352 CAGCGGATGAGAGCAGGCGCTGG + Intergenic
1139293490 16:65878898-65878920 CTGGAGCTGAGAGCATTTGCAGG - Intergenic
1142439460 16:90086123-90086145 CAGCCCATGAGAGCAGCTGTGGG + Intronic
1142471590 17:166117-166139 GAGGAGTAGAGAGCAGCAGCAGG - Intronic
1143056650 17:4167714-4167736 CTGGTGAGCAGAGCAGCTGCTGG + Exonic
1143432238 17:6895571-6895593 GAGGAGATGAGAGAAGGGGCTGG - Intronic
1143730895 17:8882119-8882141 CAAGAGCTGAGAGCACCTGCAGG + Intronic
1144291395 17:13830155-13830177 TAGGAGCTGAGAGCAGCCTCCGG + Intergenic
1144614539 17:16757180-16757202 CTGGAGATGACAGTAGCAGCTGG + Intronic
1144622918 17:16829946-16829968 CAGGAGGTGAGGCCAGCTGGTGG + Intergenic
1144883513 17:18442770-18442792 CAGGAGGTGAGGCCAGCTGGTGG - Intergenic
1144898166 17:18558494-18558516 CTGGAGATGACAGTAGCAGCTGG - Intergenic
1145134204 17:20387220-20387242 CTGGAGATGACAGTAGCAGCTGG + Intergenic
1145148715 17:20501616-20501638 CAGGAGGTGAGGCCAGCTGGTGG + Intergenic
1146927031 17:36752273-36752295 CAGCAGGTGAGTGCAGCAGCTGG - Intergenic
1147133421 17:38421784-38421806 GAGGAGAGGGGAGCAGCTGCAGG + Intergenic
1147378745 17:40039398-40039420 GAGGATTTGAGAGCAGCTGCAGG - Intronic
1147577243 17:41609882-41609904 CAGGAGGTGAGGCCAGCTGGTGG + Exonic
1148693642 17:49546662-49546684 CTGGAGCTGAGAGCAGCCACTGG - Intergenic
1148730590 17:49833427-49833449 CAGAGGATGAGAGCAACTGTTGG - Exonic
1149457096 17:56796998-56797020 CAGCAGATGAGTGCAGCTTTGGG + Intronic
1151275990 17:73034707-73034729 AAGGAGATGAGAGCAGAGGTTGG - Intronic
1151519673 17:74619052-74619074 CAGGAGGGGTGTGCAGCTGCGGG - Intronic
1151550418 17:74819522-74819544 CAGTACATGTGAGCAGCAGCAGG + Intronic
1152024842 17:77802270-77802292 CAGGAGATTAGGGAAGCTCCTGG + Intergenic
1152090233 17:78242411-78242433 CAGGAGATGAGGACAGATGGGGG - Intergenic
1152114779 17:78378803-78378825 CAGGAGGTGAGAGGGGCGGCCGG + Exonic
1152240568 17:79158750-79158772 CAGGACAGGAGCCCAGCTGCAGG + Intronic
1152514664 17:80816333-80816355 CAGGACCAGAGAGCAGCTGAGGG + Intronic
1152958111 18:57533-57555 CAGCCCATGAGAGCAGCTGTGGG - Intronic
1152963631 18:96239-96261 CAGCAGCTGTGAGCAGCTGGAGG + Intergenic
1153772357 18:8426087-8426109 CAGGGGATGAGCTCAGCTGCTGG - Intergenic
1154425975 18:14272353-14272375 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1154427319 18:14281938-14281960 CAGCTCATGAGAGCAGCTACAGG - Intergenic
1154428718 18:14291946-14291968 CAGCCCGTGAGAGCAGCTGCAGG - Intergenic
1154430047 18:14301474-14301496 CAGCCCATGAGAGCAGCTACAGG - Intergenic
1154430992 18:14308291-14308313 CAGCCCATGAGAGCAGATGCAGG - Intergenic
1154432334 18:14317814-14317836 CAGCCCATGAGAGCAGCTACAGG - Intergenic
1154433665 18:14327593-14327615 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1155360111 18:24991325-24991347 CAGGAGGGGAGCGCAGCAGCCGG - Intergenic
1155798826 18:30074249-30074271 CAAGCCATGAGAGCAGCTGTAGG + Intergenic
1157633849 18:49129731-49129753 CAGGAGGTGATAACTGCTGCTGG + Intronic
1157730258 18:49997816-49997838 CAGGAGGTGTCTGCAGCTGCTGG + Intronic
1157855387 18:51100412-51100434 CTGGAGAAGAGTCCAGCTGCTGG + Intergenic
1159913244 18:74165874-74165896 TAGGAGGGGTGAGCAGCTGCTGG + Intergenic
1160096320 18:75876881-75876903 CAGGAGAAGAGAGCTTGTGCAGG - Intergenic
1162794817 19:13081595-13081617 CAGGAGAGGAGGGGAGCTGCCGG - Intronic
1163915678 19:20238559-20238581 CAGAAGATGTGATCAGATGCTGG + Intergenic
1163969188 19:20776157-20776179 CAGAAGATGTGATCAGCTGCTGG - Intronic
1163977207 19:20863443-20863465 CAGAAGATGTGATCAGGTGCTGG + Intergenic
1163983399 19:20923109-20923131 CAGAAGATGTGATCAGATGCTGG - Intergenic
1163999216 19:21082055-21082077 CAGAAGATGTGATCAGTTGCTGG - Intergenic
1164005143 19:21141892-21141914 CAGAAGATGCGAACAGATGCTGG - Intergenic
1164070983 19:21767698-21767720 CAGAAGATGTGATCAGATGCGGG + Intergenic
1164096107 19:22011063-22011085 CAGAAGATGTGATCAGATGCTGG + Intergenic
1164115607 19:22215892-22215914 CAGAAGATGTGATCAGATGCTGG + Intergenic
1164182517 19:22832147-22832169 CAGAAGATGTGATCAGATGCTGG - Intergenic
1164489388 19:28692731-28692753 CAGCCAGTGAGAGCAGCTGCAGG + Intergenic
1164598595 19:29546519-29546541 CAGGGGCCGAGTGCAGCTGCTGG + Intronic
1165403115 19:35614291-35614313 CAGGTGATGAGATCACCTGAGGG + Intronic
1167117563 19:47497109-47497131 CTGCAGAGGAGAGCAGCAGCTGG + Intronic
1202637983 1_KI270706v1_random:58460-58482 CAGCCCATGAGAGCAGCAGCAGG + Intergenic
925309474 2:2872249-2872271 CAGGAGCTGAGAGAACCTCCTGG - Intergenic
925487280 2:4349336-4349358 CAGCCAATGAGAGAAGCTGCAGG - Intergenic
925737613 2:6978086-6978108 CAGGAGAGGAGAGGAGGTGTGGG + Intronic
925950699 2:8907587-8907609 CAGAAAAGGAGAGCAGATGCTGG - Intronic
926201945 2:10807283-10807305 CAGGAGGTCAGGGCTGCTGCAGG - Intronic
926212779 2:10883475-10883497 GAGGAGATGACAGCAGCAGGTGG + Intergenic
926368382 2:12154872-12154894 CAGGAGCTCACAGCTGCTGCTGG - Intergenic
926757948 2:16251086-16251108 CAGGAGATGGGAGCGGCTCCAGG - Intergenic
926769058 2:16351794-16351816 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
927188186 2:20497509-20497531 CAGGAGGTGAGTCCACCTGCAGG + Intergenic
927866589 2:26591815-26591837 CAGGAGCTGAGGGCAGCCTCCGG + Intronic
928101152 2:28438085-28438107 CAGGAGAGGAAACCAGCGGCTGG - Intergenic
928698176 2:33871780-33871802 CTGTAGAGGAGATCAGCTGCTGG + Intergenic
928728136 2:34199187-34199209 GAGAAGATGAGAGCTTCTGCAGG - Intergenic
929537946 2:42796009-42796031 CAGGTGATGAGATCAGCAGCTGG - Intergenic
932048565 2:68376080-68376102 CAAGAGATGGAAGCAACTGCAGG + Intronic
933691486 2:85182408-85182430 CAGGATCAGAGAGCAGCTGCTGG - Intronic
933985862 2:87591709-87591731 CAGTCCATGAGAGCAGCTGTGGG + Intergenic
934493628 2:94779393-94779415 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
934569564 2:95360404-95360426 CAGAAGATGAGAAGAGCTGTAGG - Intronic
934709535 2:96505875-96505897 CAGAAGAGGAGAGGAGCTGATGG + Intronic
935064336 2:99634878-99634900 CAGGAGAACAGAGCAGCCCCTGG + Intronic
935156476 2:100487824-100487846 CACGAGTTGAGAGGAGCAGCTGG - Intergenic
935351152 2:102152665-102152687 CCAGATATGAAAGCAGCTGCTGG - Intronic
935571811 2:104670061-104670083 CAGTAGATAACAGCTGCTGCTGG - Intergenic
935629331 2:105199770-105199792 CAGGAGAAGAGAGCTTGTGCAGG - Intergenic
935798777 2:106671509-106671531 CAGCCCTTGAGAGCAGCTGCAGG + Intergenic
936153083 2:110032271-110032293 CAAAAGATGAGAGCAGCATCAGG - Intergenic
936191597 2:110339141-110339163 CAAAAGATGAGAGCAGCATCAGG + Intergenic
936283262 2:111161021-111161043 CAGGGGATGACAGCATCTACAGG - Intronic
936307977 2:111359095-111359117 CAGTCCATGAGAGCAGCTGTGGG - Intergenic
936549660 2:113426325-113426347 CAGGAGAAGAGAGCTTATGCAGG - Intergenic
937489903 2:122355725-122355747 CAGAAGATGTGGGCAGCTTCGGG + Intergenic
938341014 2:130536645-130536667 CAAGTGGAGAGAGCAGCTGCAGG - Intergenic
938348816 2:130584064-130584086 CAAGTGGAGAGAGCAGCTGCAGG + Intronic
938814184 2:134882954-134882976 AGGGAGATGTGTGCAGCTGCTGG + Intronic
941261853 2:163307256-163307278 CAGCCCATGAGAGCAGCTCCAGG + Intergenic
941805697 2:169710120-169710142 TAGGAGCTGAGAGCAGTTCCTGG + Intronic
945377547 2:209096949-209096971 TAGGAGAGGAGTTCAGCTGCTGG + Intergenic
946027092 2:216678479-216678501 CAGCAGAAGAGAAAAGCTGCAGG - Intronic
946153962 2:217794727-217794749 CTGCAGATCAGATCAGCTGCGGG - Intergenic
946319630 2:218944517-218944539 ACGGAGATGGGAGCAGCAGCAGG + Intergenic
946903590 2:224395201-224395223 CAGGAGATGAATGCATCAGCAGG + Intronic
947477880 2:230467586-230467608 CAAGAGAAGAGAGCTTCTGCTGG + Intronic
947703552 2:232256235-232256257 CAGGACATGAGAGGAGATGCTGG - Intronic
948292371 2:236835319-236835341 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
948608035 2:239148371-239148393 CAGGAGAAGAGAGAATCAGCAGG + Intronic
948663487 2:239520738-239520760 CAGGAGGAGAGAGCAGCTCTAGG - Intergenic
1169066753 20:2698210-2698232 CAGGTGAGCAGGGCAGCTGCTGG + Intronic
1169114387 20:3054019-3054041 CTGGAGATAAGGGGAGCTGCAGG - Intergenic
1169731040 20:8785802-8785824 CAGCACATGTGAGCAGATGCTGG + Intronic
1171085229 20:22232575-22232597 CAGGCAATGAGTGCAGCTGCTGG + Intergenic
1171227388 20:23452894-23452916 CAGGATTTAAGAGCAGCTGGTGG + Intergenic
1171818677 20:29812525-29812547 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1171884553 20:30642535-30642557 CAGCCCATGAGTGCAGCTGCAGG + Intergenic
1171884777 20:30644009-30644031 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1171899124 20:30840500-30840522 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1172060773 20:32185883-32185905 CATGAGATGAGAATATCTGCAGG + Intergenic
1172119250 20:32588162-32588184 GAGGAGAGGAGGGCAGCTGCAGG + Intronic
1172223338 20:33288426-33288448 CAGGGGATGAGTGCAGGTCCAGG + Intronic
1173808714 20:45943071-45943093 CAGGACAGGAGAGCTGCTGAAGG - Intronic
1173919252 20:46731553-46731575 CAGGATGTGACTGCAGCTGCGGG + Intronic
1174080663 20:47968871-47968893 CAGGAGATGTGAGCTGCTCGGGG - Intergenic
1174687281 20:52468103-52468125 AAGGAGAGGAGAGGAGCTGAAGG - Intergenic
1175261844 20:57679664-57679686 CAGGATGTGAAAGCAACTGCTGG + Intronic
1175633230 20:60559568-60559590 CAGGTGATGACAGCGCCTGCTGG + Intergenic
1175863885 20:62164276-62164298 CAGGAACGCAGAGCAGCTGCAGG + Intronic
1176844701 21:13867937-13867959 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1176847444 21:13887501-13887523 CAGCCCATGAGAGCAGCTACAGG + Intergenic
1177367165 21:20153345-20153367 CAGGCTATGAAAGCAGCTGCAGG - Intergenic
1177402397 21:20623153-20623175 CAGCCTATGAAAGCAGCTGCAGG - Intergenic
1178888344 21:36499825-36499847 CAGGAGATGACAGCAGCCCTGGG - Intronic
1179288829 21:40000784-40000806 CAGGAGAAGAGAGCTTGTGCAGG - Intergenic
1179380858 21:40897756-40897778 CAGCCTATGAGAGCAGCTGTGGG + Intergenic
1179827294 21:43973335-43973357 GAGGGGATGATAGCAGCTGGTGG + Intronic
1180219981 21:46352385-46352407 CTGGAGAAGAGAGAAGCTGAGGG + Intronic
1180322122 22:11331899-11331921 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1180332791 22:11547803-11547825 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1180728915 22:17966547-17966569 CAGGAGATGAGGGTAGCAGAGGG + Intronic
1180926607 22:19559514-19559536 CAAGACAGGAGGGCAGCTGCGGG - Intergenic
1181603033 22:23963601-23963623 TAGGAGATGAGAGCTACTGGTGG + Intergenic
1181605481 22:23977706-23977728 TAGGAGATGAGAGCTACTGGTGG - Intronic
1182414167 22:30210367-30210389 CAGAACATGAGGGCAGCAGCAGG + Intergenic
1182571392 22:31241496-31241518 GAGGAGAAGACAGCACCTGCAGG - Intronic
1182650097 22:31844761-31844783 CAGGAGTTGAGACCAGCTTGGGG - Intronic
1182866810 22:33611282-33611304 CAACCCATGAGAGCAGCTGCAGG + Intronic
1182958304 22:34448002-34448024 TAGGAGCTGAGAGCAGCCCCTGG + Intergenic
1183124803 22:35766761-35766783 CAAGAGCTGAAACCAGCTGCTGG + Intronic
1184654040 22:45932286-45932308 CAGGGGATGTGAGCAGCGCCTGG - Intronic
1184813183 22:46851381-46851403 CTAGAGATGAGTGCAGCAGCAGG - Intronic
1185003935 22:48264132-48264154 CAAAAGCTGAGAGCAGGTGCAGG + Intergenic
949568735 3:5270755-5270777 CAGGAAATGAGGGCAGCCGCTGG - Intergenic
949692333 3:6654659-6654681 CAGCTTATGAAAGCAGCTGCAGG - Intergenic
950145940 3:10649837-10649859 CAGGAGAAGAGAGCTTGTGCAGG - Intronic
950479994 3:13238202-13238224 CAGGAGAGGAAAGCAGGTGGAGG - Intergenic
951798265 3:26566529-26566551 TTGGAGATGGGAGCAGATGCCGG + Intergenic
951942256 3:28092437-28092459 CAGGAGATGAGAGCTACAGCAGG + Intergenic
952169556 3:30791887-30791909 CAGCAGGTAAGAGCATCTGCAGG - Intronic
952195893 3:31075091-31075113 CTGGAGAAGGGAGTAGCTGCTGG + Intergenic
952979835 3:38725852-38725874 CAGCTGATAACAGCAGCTGCTGG + Intronic
953210120 3:40868231-40868253 CAGGAGCTGAGGGGAGATGCTGG + Intergenic
953738629 3:45517362-45517384 CAGAAGATCAGACCAGCAGCTGG + Intronic
953898444 3:46823031-46823053 CAGCCCATGAAAGCAGCTGCGGG - Intergenic
954086408 3:48247486-48247508 CAGGAGGTGAGAGGAGCTCAGGG + Intronic
954676249 3:52317282-52317304 CAGGTGCTGAGAGCAGATGAGGG + Intronic
955446918 3:59021781-59021803 TCAGAGATGAGAGTAGCTGCGGG + Intronic
956128774 3:66036082-66036104 CATAGGATGGGAGCAGCTGCAGG - Intronic
956420273 3:69080119-69080141 AAGGAGAATAGAGGAGCTGCTGG - Exonic
956482850 3:69689987-69690009 CAGGAAATCAGAGAAGCTACTGG + Intergenic
956489241 3:69753563-69753585 CAGCCCTTGAGAGCAGCTGCAGG + Intronic
956563958 3:70614958-70614980 CAACATGTGAGAGCAGCTGCGGG - Intergenic
956612890 3:71142574-71142596 TAGATGCTGAGAGCAGCTGCAGG + Intronic
957068767 3:75548991-75549013 CAGGAGAGGTGAACAGTTGCGGG - Intergenic
957087820 3:75698923-75698945 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
957412850 3:79862722-79862744 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
958583958 3:96061864-96061886 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
959255370 3:104004468-104004490 CTGGAAAAGAGAGCAGTTGCAGG + Intergenic
959610917 3:108294066-108294088 GAGGATGTGAGAGCAGCTACCGG - Intergenic
960256470 3:115516370-115516392 CAGCCCATGAGAGCAACTGCAGG - Intergenic
960443155 3:117714357-117714379 CAGGAGGTGAGTGGAGCAGCAGG + Intergenic
960724687 3:120658505-120658527 CAGCCCATGAGAGCAGCCGCAGG - Intronic
961497480 3:127304944-127304966 CAGGAGTGGAGAGCAGAGGCAGG - Intergenic
961818846 3:129565013-129565035 CAGGAGATGAAATCAGCCCCTGG - Intronic
962353530 3:134673732-134673754 TAGGAGATGAGGTCATCTGCTGG - Intronic
963777546 3:149454287-149454309 CAGGAGATGGGAGCAAGAGCAGG - Intergenic
964912775 3:161802144-161802166 CAGGAGAAGAGAGCTTGTGCAGG + Intergenic
965869885 3:173252793-173252815 CAGTTCATGAGAGCAGCTGCAGG - Intergenic
966346857 3:178990009-178990031 CAGTCCATGAGAGCAGCTGCAGG - Intergenic
966465266 3:180224831-180224853 GAGGTGGTGAGAGCAGCTGGAGG - Intergenic
967133766 3:186496193-186496215 CAGGAAAAGCGGGCAGCTGCAGG - Intergenic
969249906 4:5960449-5960471 CAGGAGGCAAGAGCAGCCGCAGG + Intronic
969407924 4:7007219-7007241 CAGGAGAGCAGTGCAGCTGAGGG + Intronic
969705274 4:8788325-8788347 CAGGAGATGAGAGCAGGGAGGGG + Intergenic
969740751 4:9024262-9024284 CAGGAGAGGTGAACAGTTGCAGG + Intergenic
970049550 4:11898018-11898040 CAGCTCATGAGAGTAGCTGCAGG + Intergenic
970447582 4:16136941-16136963 CAGCAGATGGGAGCAGCTGGCGG - Intergenic
970503150 4:16699137-16699159 CAGGAGATGATGGCATCTTCAGG + Intronic
970654766 4:18218877-18218899 AAGGAGATGAGAAAAGTTGCAGG + Intergenic
971048523 4:22832490-22832512 CAGGTGCTCAGAGCAGCTGCAGG - Intergenic
971545421 4:27879762-27879784 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
971856698 4:32053695-32053717 CAGCCAATGAAAGCAGCTGCAGG - Intergenic
973368205 4:49224821-49224843 CAGCCCATGAGAGCAGCTGCAGG + Intergenic
973392842 4:49570604-49570626 CAGCCCATGAGAGCAGCTGCAGG - Intergenic
973780350 4:54283033-54283055 CAGCCCCTGAGAGCAGCTGCAGG - Intronic
974488759 4:62536706-62536728 GAGAATATGAGTGCAGCTGCAGG - Intergenic
974529865 4:63093920-63093942 CAGGAGATGAGATCACTTGAGGG + Intergenic
975671892 4:76788163-76788185 CAGGTGCTCAGAGCAGCTGTAGG - Intergenic
975926659 4:79463616-79463638 AAGGAGCTGAGAGCAGCCTCTGG - Intergenic
976000730 4:80370768-80370790 CAGCACATGAGAGCAGCTGTGGG - Intronic
976489401 4:85651154-85651176 CAGGAGAGGAGAACAGAGGCAGG + Intronic
976853466 4:89576113-89576135 CAGCCCATGAAAGCAGCTGCTGG + Intergenic
977160941 4:93634260-93634282 TTGGATATGAGAGCAGGTGCAGG + Intronic
977378368 4:96237708-96237730 CAGCTCATGAGAGCAGCTGTGGG + Intergenic
977696121 4:99968575-99968597 CAGAAGATGGGTGCAGATGCAGG - Intergenic
978035099 4:103983460-103983482 CAGGAGATGAGAGGAAATTCTGG - Intergenic
979025193 4:115562789-115562811 AAGGAGATGAGAGAAGCCTCAGG + Intergenic
979177271 4:117680039-117680061 CAAGAGAAGAGAGCATGTGCAGG - Intergenic
980089469 4:128427560-128427582 CAGAGGATGGGAGCAGATGCAGG + Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
982616548 4:157644431-157644453 CAGGAGATGAAGGAAGCGGCTGG - Intergenic
983489330 4:168369304-168369326 CAAGAGAAGAGAGCATGTGCAGG - Intronic
983572457 4:169224671-169224693 CAGGGGATAACAGTAGCTGCAGG + Intronic
983925655 4:173399143-173399165 AAGGAGAAGAGAGGAGGTGCTGG + Exonic
984937639 4:184903198-184903220 CAGGACATTTCAGCAGCTGCTGG + Intergenic
1202765306 4_GL000008v2_random:144317-144339 CAGCCCATGAGAGCAGCAGCAGG + Intergenic
985591151 5:766208-766230 TGGGAGGTGAGAGCAGATGCAGG + Intronic
985599168 5:816855-816877 CAGGAGAACAAAGCAGCAGCGGG + Intronic
986672014 5:10150884-10150906 CAGGTGAAGAGAGGAGGTGCTGG + Intergenic
986799817 5:11247198-11247220 CAGGAGCTGAGAGCAGTTGGGGG + Intronic
986949121 5:13060379-13060401 CAAAATGTGAGAGCAGCTGCAGG - Intergenic
987031283 5:13979072-13979094 TAGGAGATGAGACCAGCAGGGGG - Intergenic
987861428 5:23492479-23492501 CAGGAGAGGACAGCAGATGGGGG + Intergenic
988386631 5:30574054-30574076 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
988551193 5:32202549-32202571 CAGTAGATGAGATCAGTTGTTGG + Intergenic
988671350 5:33385282-33385304 CAGCCCATGAGAGCAGCTGCAGG - Intergenic
989254368 5:39350758-39350780 CAGCCCATGAAAGCAGCTGCAGG - Intronic
989735082 5:44694098-44694120 CTGGAGAGGAGATCAGCCGCTGG + Intergenic
989746881 5:44839682-44839704 CAGCCCATGAAAGCAGCTGCAGG + Intergenic
990237052 5:53779678-53779700 CAGGACATCAGAACAGCTGTTGG + Intergenic
990406640 5:55497773-55497795 CTGTAGATGATAGCAGCTTCAGG - Intronic
991087445 5:62660991-62661013 TCGGAGAGGAGATCAGCTGCTGG + Intergenic
991987156 5:72300729-72300751 CAGGAGATGAGAGATACTGGTGG - Intronic
992828690 5:80573191-80573213 CAGGAGAGGAGGGCTGATGCTGG + Intergenic
994205741 5:97033647-97033669 CAGAAGAGGAGAGCTGCTACAGG - Exonic
995683496 5:114745874-114745896 CAGCCTGTGAGAGCAGCTGCAGG + Intergenic
995751886 5:115460694-115460716 CAGGAGCTGAGTGGAGCTGGAGG - Intergenic
995915641 5:117241895-117241917 CAGCCGGTGAGAGCAGCTGCAGG + Intergenic
997091522 5:130864294-130864316 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
998294293 5:140952169-140952191 CAACCCATGAGAGCAGCTGCAGG - Intronic
998545968 5:143027937-143027959 CTGGAGTTGAGAGCCGCTACTGG + Intronic
999036207 5:148353488-148353510 CAGGGGATGTCAGCTGCTGCTGG - Intergenic
999105268 5:149064910-149064932 CAGGAGATGAGAGCTGGGGCAGG + Intergenic
999754483 5:154654012-154654034 CCAGAGATAAGAGGAGCTGCAGG - Intergenic
999906198 5:156143523-156143545 CAGTCCATGAGAGCAGCTGCAGG + Intronic
1001104334 5:168840212-168840234 CAGGAGATGAGAGCATTTTCAGG + Intronic
1001784356 5:174399147-174399169 CAGGACGTGAGAGCAGGTCCAGG - Intergenic
1003303842 6:4908787-4908809 CTGGGGATGTGAGAAGCTGCAGG - Intronic
1003817907 6:9862578-9862600 CAGGCCATGAAAGCAGCTGTGGG - Intronic
1005027994 6:21482447-21482469 ATGGAGAATAGAGCAGCTGCAGG + Intergenic
1005104149 6:22205216-22205238 CAGGAGATGAGAGAAGTAGCAGG - Intergenic
1007293861 6:40806320-40806342 CAAGAGATGGGAGCAGCAGCTGG - Intergenic
1007385937 6:41520151-41520173 CAGGGGCTGAAAGGAGCTGCAGG + Intergenic
1007965993 6:46004198-46004220 CAGGAGGTGAGAGAGGCTGCAGG + Intronic
1008129450 6:47703865-47703887 CAGGAGCTGTGTGCAGCTGGAGG + Intronic
1008204149 6:48632362-48632384 CAGGAGTAGTGAGCAGCTGAGGG + Intergenic
1009755437 6:67933477-67933499 CACAAGATGGCAGCAGCTGCGGG + Intergenic
1010860130 6:80900074-80900096 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
1012224277 6:96686891-96686913 CAGGAGAAGAGAGCTTGTGCAGG - Intergenic
1012887475 6:104861562-104861584 CAGCAGCTGAGAGAAGCTGAGGG - Intergenic
1013088320 6:106875591-106875613 CAGCTCATGAGAGCAGCTGTAGG - Intergenic
1013143268 6:107361864-107361886 ATGGAGGTGAGAGCAGCTGCTGG - Intronic
1013716358 6:112967682-112967704 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1014492411 6:122078627-122078649 CAGGAGTTGTGAGCGGCAGCAGG - Intergenic
1015826731 6:137320728-137320750 CAGGAGAGGAAAGCATCTTCTGG - Intergenic
1016253086 6:142070918-142070940 CAAGAGAAGAGAGCATGTGCAGG - Intronic
1016438144 6:144058855-144058877 CAGCCTGTGAGAGCAGCTGCAGG - Intronic
1016644253 6:146386900-146386922 AAGGAGAAGTGAGCTGCTGCTGG + Exonic
1016896581 6:149059836-149059858 TTGGAGATGAGGGCAGCTGTTGG - Intronic
1019082813 6:169446529-169446551 CAGGATTTGGGAGCATCTGCAGG + Intergenic
1019613984 7:1950640-1950662 GAGGAGGTGAGAGCTGCAGCTGG - Intronic
1019649031 7:2146582-2146604 CGGGTCATGAGAGCAGCTGCTGG - Intronic
1020225582 7:6277178-6277200 GGGGAGATGAGAGCTGCTCCAGG - Intergenic
1021892941 7:25204806-25204828 CCCGAGAAGAGAACAGCTGCCGG - Intergenic
1022170697 7:27826564-27826586 CATGACATGAGAGCAGCTAACGG + Intronic
1022535230 7:31094348-31094370 CAGGAGATGAGGCGAGCAGCGGG - Intronic
1022705954 7:32802230-32802252 CAGCCCATGAGAACAGCTGCAGG - Intergenic
1023655990 7:42421682-42421704 CAGGAGAGGAGGGCAGATACTGG - Intergenic
1024250524 7:47502576-47502598 CAGGCGATGAGGGCAGCAGGGGG + Intronic
1025865053 7:65373707-65373729 CGGGAGATGTGATCAGATGCTGG - Intergenic
1027256016 7:76431178-76431200 CAGGAGCTAAGAGCAGTTGGAGG + Intronic
1027441209 7:78220930-78220952 CAGCAGATAGGTGCAGCTGCCGG + Intronic
1029017068 7:97325884-97325906 TCGGAGAGGAGATCAGCTGCAGG - Intergenic
1029040261 7:97565855-97565877 CAAGAGCTGGGAGGAGCTGCTGG + Intergenic
1030064782 7:105651390-105651412 CGGTGGATGAGAGCAGATGCTGG - Intronic
1031979754 7:128116882-128116904 CAGGACAGGAGGGCAGCAGCAGG + Intergenic
1032346249 7:131119371-131119393 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1032366817 7:131307479-131307501 CAGCCCATGAAAGCAGCTGCAGG + Intronic
1032916177 7:136492656-136492678 CAGGAGAGGAGAGAGGCTTCTGG + Intergenic
1033242055 7:139688511-139688533 CAGGAGCTGATGGCTGCTGCCGG + Intronic
1033950465 7:146779020-146779042 GAGAAGAGGAGAGCAGGTGCTGG + Intronic
1034069149 7:148165921-148165943 CATGAGATGAGAGCGGTTGCAGG - Intronic
1034852057 7:154502532-154502554 CAAGAGAAGAGAGCTGGTGCAGG - Intronic
1035105553 7:156439545-156439567 CTGGAGGTGGGAGCAGATGCGGG - Intergenic
1035128654 7:156630279-156630301 CAGCCTGTGAGAGCAGCTGCAGG + Intergenic
1035860223 8:3020441-3020463 CAGGAGGTCAGGGCTGCTGCTGG - Intronic
1036245953 8:7116829-7116851 CAGGAGAGGTGAACAGTTGCAGG + Intergenic
1036254840 8:7197633-7197655 CAGGAGAGGTGAACAGTTGCAGG - Intergenic
1036362647 8:8089874-8089896 CAGGAGAGGTGAACAGTTGCAGG + Intergenic
1036888317 8:12577198-12577220 CAGGAGAGGTGAACAGTTGCAGG - Intergenic
1036895908 8:12635298-12635320 CAGGAGAGGTGAACAGTTGCAGG - Intergenic
1036914643 8:12793411-12793433 CAGTCTGTGAGAGCAGCTGCTGG - Intergenic
1037559285 8:20058037-20058059 CAGATGGTGAGAGCTGCTGCTGG + Intergenic
1037810214 8:22082314-22082336 CAGGTGAGGAAAGCAGCTGGGGG - Exonic
1038261350 8:25998340-25998362 CAGGAGAAGAGAGAAACTGGTGG + Intronic
1038850225 8:31268474-31268496 CAGGAGACGAGAGGAGCTGAAGG - Intergenic
1039150989 8:34505230-34505252 CAGGAGCTGAGAGAAGCCTCTGG + Intergenic
1039642619 8:39240662-39240684 CAGGAGAAGAGAGCTTGTGCAGG + Intronic
1040072661 8:43201096-43201118 CATGAGAACAGAGCAGCTGCAGG - Exonic
1041374764 8:57202632-57202654 CTGGAGAAGAGAGGAGGTGCTGG + Intergenic
1041377622 8:57219123-57219145 CTGGAGAAGAGAGGAGGTGCTGG + Intergenic
1042182910 8:66110021-66110043 CAGGAGTTCAAAGCTGCTGCGGG - Intergenic
1042220676 8:66470654-66470676 CTGGAGATGAGGGCAGAAGCTGG + Intronic
1042409052 8:68441348-68441370 TAGGAGATGAGAGTAGCTCCTGG - Intronic
1042548187 8:69969889-69969911 CATGAGATGAAATCAGCTCCTGG + Intergenic
1045987135 8:108261758-108261780 CAGCAGGTGAGAGCAGGTGCAGG - Intronic
1046582513 8:116110812-116110834 TTGGAGAGGAGATCAGCTGCGGG + Intergenic
1046632387 8:116633975-116633997 CAGGAGATGACTGCAGCTAGGGG - Intergenic
1046689540 8:117267414-117267436 CAGCCCATGAAAGCAGCTGCTGG - Intergenic
1046771408 8:118120092-118120114 GATGAGATCAGAGAAGCTGCAGG + Intergenic
1046818812 8:118614759-118614781 CAGGACAGGACAGCAGCTGTTGG - Intronic
1048418603 8:134254005-134254027 CAAGTCATGAAAGCAGCTGCTGG - Intergenic
1048855669 8:138684956-138684978 CATGAGATGGGAGCATCTCCAGG + Intronic
1049295648 8:141834361-141834383 CAGAAGATGACATCAGCTGCAGG + Intergenic
1049331597 8:142056946-142056968 CAGGAGGTGAGCTCAGCTGAAGG - Intergenic
1049679830 8:143913184-143913206 GAGGAGAGGAGAGCAGCTCATGG + Intergenic
1049734426 8:144197142-144197164 CAGAAGGTGAGAGCAGCTCAGGG + Intronic
1049903284 9:190502-190524 CAGGAGAAGAGAGCTTATGCAGG + Intergenic
1050040516 9:1488174-1488196 CAGGAGAAGAGAGCTTGTGCAGG + Intergenic
1052158504 9:25226116-25226138 CATGAGATGAGCACAGCTGGTGG - Intergenic
1052375410 9:27713175-27713197 CAGGAAATGAGAGCAGTTCATGG + Intergenic
1053663456 9:40300638-40300660 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053663959 9:40304535-40304557 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053664926 9:40310741-40310763 CAGCCCATGAGGGCAGCTGCGGG + Intronic
1053739821 9:41126953-41126975 AAGGTGAAGTGAGCAGCTGCGGG + Exonic
1053914501 9:42935791-42935813 CAGCCCATGAGGGCAGCTGCGGG + Intergenic
1054376085 9:64450769-64450791 CAGCCCATGAGGGCAGCTGCGGG + Intergenic
1054519688 9:66065543-66065565 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054520655 9:66071750-66071772 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054521158 9:66075647-66075669 CAGCCCATGAGGGCAGCTGCGGG - Intergenic
1054992117 9:71340522-71340544 CAGGAGAAGAGAGCTTGTGCAGG - Intronic
1056224544 9:84482485-84482507 CAGGACATAAGAGCGGCTCCAGG - Intergenic
1056527231 9:87454794-87454816 CAGCACATGAGAGCAGCTATGGG - Intergenic
1056844940 9:90029592-90029614 CAGGAGCTGAGAGCAGCCCCTGG - Intergenic
1056920989 9:90789274-90789296 GAGGAGATGAGAGCAGGTCATGG - Intergenic
1056953828 9:91066779-91066801 CACTGGATGAGAGCAGCGGCTGG - Intergenic
1057369079 9:94453561-94453583 CAGAATATGAGAGCTTCTGCTGG - Intronic
1057677848 9:97149768-97149790 CAGTCCATGAGAGCAGCCGCGGG + Intergenic
1058373669 9:104298788-104298810 CAGCAGATGAAACCTGCTGCAGG + Intergenic
1058703523 9:107620292-107620314 CAGGAGGACAGAGCAGCTGCAGG - Intergenic
1058721682 9:107770021-107770043 CAGGACAGGAGAGAAGATGCTGG - Intergenic
1060155048 9:121313772-121313794 CTGGACATGTGAGCAGATGCAGG + Intronic
1060205246 9:121678927-121678949 ACGGAGATGGGAGCAGCTGAGGG - Intronic
1061504772 9:131025571-131025593 AAGGAGAGGAGAGCAGGTGGAGG + Intronic
1061573267 9:131490672-131490694 CAGGAGAACAGGGTAGCTGCAGG - Intronic
1061592690 9:131608240-131608262 CAGGAGAGGACGGCTGCTGCTGG - Intronic
1061854935 9:133436885-133436907 CAGGGGAGGAGCGCAGCGGCTGG - Exonic
1062669946 9:137702580-137702602 CAGCCCATGAAAGCAGCTGCAGG - Intronic
1062734469 9:138127487-138127509 CAGCAGCTGTGAGCAGCTGGAGG - Intergenic
1062740053 9:138167068-138167090 CAGCCCATGAGAGCAGCTGTGGG + Intergenic
1203370333 Un_KI270442v1:297791-297813 CAGCCCATGAGAGCAGCTGTGGG - Intergenic
1203546055 Un_KI270743v1:129206-129228 CAGCCCATGAGAGCAGCAGCAGG + Intergenic
1185469466 X:373901-373923 GAGGAGAGGAGAGCAGCGCCGGG - Intronic
1185716522 X:2347246-2347268 CAAGAGAAGAGAGCATGTGCAGG + Intronic
1186767063 X:12781796-12781818 AAGGAGAGGAGAGAAGCTGAAGG + Intergenic
1186907415 X:14126701-14126723 CAGGAGTTGAGGGCTGCTGTGGG - Intergenic
1186990471 X:15061665-15061687 CAGGAGTTGGGATCAGCTGGTGG + Intergenic
1187111659 X:16307911-16307933 TAGGAGTTGAGAACAGCTTCTGG + Intergenic
1187925142 X:24242939-24242961 CAGGAACTGAGAACAGCTTCTGG + Intergenic
1188748344 X:33874350-33874372 CAGGAGAAGAGAGCTTGTGCAGG + Intergenic
1192207732 X:69107298-69107320 CAGGAGATGACAGCATCAGCAGG + Intergenic
1192389397 X:70709893-70709915 GAAGAGAGGAGAGCAGCAGCAGG - Intronic
1192553590 X:72072596-72072618 CAGGAGAAGATAGCAGGTGGAGG - Intergenic
1194855176 X:98919034-98919056 CAGCCCATGAGAGCAGCTGCAGG + Intergenic
1194864392 X:99048339-99048361 CAGCTCATGAAAGCAGCTGCAGG - Intergenic
1195453006 X:105036641-105036663 CATGACATTAGAGCAGGTGCAGG - Intronic
1195688085 X:107603263-107603285 CAGCAGGTGGCAGCAGCTGCAGG + Exonic
1196826127 X:119741682-119741704 CAGGAGAAGAGAGCTTGTGCAGG - Intergenic
1197892302 X:131279356-131279378 AAAGAGATGAGAGGAGTTGCTGG + Intronic
1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG + Intergenic
1199713616 X:150490144-150490166 CAGGAGATGTCAGCAGCCACTGG + Intronic
1199823162 X:151471107-151471129 CAGCCCATGAAAGCAGCTGCAGG - Intergenic
1199869737 X:151887888-151887910 CCTCTGATGAGAGCAGCTGCAGG - Intergenic
1200758424 Y:7013656-7013678 CAGATGGTGAGAGCAACTGCAGG + Intronic