ID: 915285856

View in Genome Browser
Species Human (GRCh38)
Location 1:154851615-154851637
Sequence GACAAAAGGTCATGGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915285856_915285862 16 Left 915285856 1:154851615-154851637 CCTGCACACCATGACCTTTTGTC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 915285862 1:154851654-154851676 CCCTCCTTTTAAATAGCCCAAGG 0: 1
1: 0
2: 4
3: 11
4: 138
915285856_915285864 17 Left 915285856 1:154851615-154851637 CCTGCACACCATGACCTTTTGTC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 915285864 1:154851655-154851677 CCTCCTTTTAAATAGCCCAAGGG 0: 1
1: 0
2: 2
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915285856 Original CRISPR GACAAAAGGTCATGGTGTGC AGG (reversed) Intronic
903015597 1:20359657-20359679 GACTAATTGTCGTGGTGTGCCGG + Intergenic
904074786 1:27831738-27831760 GACAAAAGGCCATTTTGTCCAGG - Intronic
905796632 1:40819674-40819696 GTCACAAGGTCTTGATGTGCGGG - Intronic
905825374 1:41022526-41022548 GAAAAGAGGCTATGGTGTGCGGG + Exonic
906116938 1:43363472-43363494 GGCCAAAGGTCAGGGTGGGCGGG - Exonic
907255039 1:53172838-53172860 CAAAAAAGGGCATGGTGTTCTGG - Intergenic
912626942 1:111213180-111213202 GAAAGAAGGTCATGGTGGACAGG + Intronic
913594497 1:120360447-120360469 GACAAAAATGAATGGTGTGCAGG - Intergenic
914092766 1:144518539-144518561 GACAAAAATGAATGGTGTGCAGG + Intergenic
914305763 1:146415336-146415358 GACAAAAATGAATGGTGTGCAGG - Intergenic
914364587 1:146966920-146966942 GAAAACAGGTCATTCTGTGCCGG - Intronic
914365353 1:146973207-146973229 GAAAACAGGTCATTCTGTGCCGG - Intronic
914596293 1:149157470-149157492 GACAAAAATGAATGGTGTGCAGG + Intergenic
915285856 1:154851615-154851637 GACAAAAGGTCATGGTGTGCAGG - Intronic
916512879 1:165488650-165488672 GACAAAACTTCAAGGTGTTCAGG - Intergenic
916948501 1:169755517-169755539 AACAAAAGGCCATTGTGGGCTGG - Intronic
919567321 1:199204987-199205009 GACAAAGGGTCATCTTTTGCTGG - Intergenic
920231600 1:204474285-204474307 GACAAAAAGTCAAGGGGAGCCGG - Intronic
920929206 1:210371052-210371074 GACAAAAGGTCATGTACTGATGG + Intronic
921876357 1:220200945-220200967 GATAAAAGTGTATGGTGTGCTGG + Intronic
922114286 1:222595662-222595684 TACTAAAGGTCATGCAGTGCTGG - Intergenic
922583365 1:226715230-226715252 CACAAACGTTCATGGTGTACTGG - Intronic
1063321788 10:5058312-5058334 GAGAAAAGGTCAAGCTCTGCAGG + Intronic
1067926321 10:50512215-50512237 GACAGAAGGAGATGGTGTGAGGG + Intronic
1069216978 10:65833161-65833183 GAGAAAAGGTCTTGGTGGGTAGG - Intergenic
1071094400 10:81956624-81956646 GGCAAGAGGTGATGGTGTTCAGG - Intronic
1074254287 10:111784813-111784835 GACACAAGGTCAGGATGGGCTGG + Intergenic
1081744666 11:45464463-45464485 GACAAAAGGTCTGGCTGGGCTGG + Intergenic
1081933491 11:46888830-46888852 TAGAAAAAGTCATCGTGTGCTGG + Intronic
1083996802 11:66276943-66276965 GACAAAGGGGCACGGTGGGCAGG - Exonic
1088256091 11:107904785-107904807 AACAAAAAGGCATGGTTTGCTGG - Intronic
1088889138 11:114031012-114031034 GACAGAAGGTCTTGGAGAGCGGG - Intergenic
1089034919 11:115378600-115378622 TACAAAAGCACATGGTGAGCTGG - Intronic
1089233730 11:117004605-117004627 GACAAAAGATAATGGGGTGGAGG + Intronic
1090132537 11:124159723-124159745 GAATAAATGTCATGGTGTGAGGG - Intergenic
1097840948 12:64320583-64320605 AAAGAAAGGTCATGGTGAGCTGG - Intronic
1099704509 12:86134603-86134625 GACAAAACGGCATGGGGTTCAGG - Intronic
1099728306 12:86463119-86463141 CACAAAAGGACAGGGTGTCCCGG - Intronic
1099792364 12:87351729-87351751 GACTAATGATCATGATGTGCTGG - Intergenic
1109024836 13:57143603-57143625 GACAAAAGGTGTTGGGGTGGGGG + Exonic
1109025823 13:57150173-57150195 GACAAAAGGTGTTGGGGTGGGGG + Exonic
1109026813 13:57156746-57156768 GACAAAAGGTGTTGGGGTGGGGG + Exonic
1109027805 13:57163317-57163339 GACAAAAGGTGTTGGGGTGGGGG + Exonic
1109028791 13:57169882-57169904 GACAAAAGGTGTTGGGGTGGGGG + Exonic
1111563152 13:89978924-89978946 GACAAAGGGTCATGGAGACCAGG - Intergenic
1112698644 13:101978920-101978942 GAGAAATGGCCATGGTGTGATGG + Intronic
1112787573 13:102968147-102968169 GACAAAGGCTCCAGGTGTGCTGG + Intergenic
1113372816 13:109738296-109738318 GAGCAAAGGTCAAGGTGTGCTGG - Intergenic
1114630796 14:24158222-24158244 GAGAAGAGGAGATGGTGTGCTGG + Intronic
1114816821 14:25968897-25968919 AAGAAAAAGTCATGATGTGCAGG + Intergenic
1115341732 14:32300103-32300125 GATAAAATGTCATAGTGAGCAGG - Intergenic
1115778237 14:36739941-36739963 GACAAGAGGGAATGGTGTGCTGG + Intronic
1120152675 14:81055042-81055064 GAAAAAATGGCATGGTGGGCTGG + Intronic
1130909760 15:88262964-88262986 TACAAAAGGGCAAGGTGTGCTGG - Intergenic
1132283706 15:100643441-100643463 GACAAAAGGTTATGGAATGGGGG - Intronic
1135289228 16:21220454-21220476 GACAAAAAGGCAAGGTGTGGTGG - Intergenic
1136577025 16:31131068-31131090 AACAAAAGGGCAGGCTGTGCTGG - Exonic
1138524026 16:57591478-57591500 GACAGAAGATCAGAGTGTGCTGG + Intronic
1140789087 16:78373153-78373175 GCTAAAATGTCATTGTGTGCTGG - Intronic
1141358006 16:83366787-83366809 CACAGAAGGTCATGGTGTGGTGG + Intronic
1141399374 16:83733666-83733688 GAGCAAAGGCCATGGTGTGTCGG + Intronic
1143761965 17:9111230-9111252 GATAAAAGATCATGCTGGGCAGG - Intronic
1145242935 17:21250189-21250211 GTCAAGAGGTCATGGGGAGCAGG - Intronic
1145243552 17:21253125-21253147 GACAAAAGGTCGGGGCGGGCCGG + Intronic
1147711195 17:42466798-42466820 GACAAAAACTGATGGTGTGCTGG - Intronic
1149514394 17:57269171-57269193 TAGGAAAGGTCAGGGTGTGCAGG + Intronic
1149900854 17:60476618-60476640 GACATAAGGTCTTGGTATACAGG + Intronic
1156250454 18:35347146-35347168 GACAAAAGCTCATGGAGAGCTGG + Intergenic
1161606661 19:5218840-5218862 GAAGAAAGGTGAGGGTGTGCCGG + Intronic
1164269538 19:23659369-23659391 GACAAATTGTCTTGCTGTGCAGG - Intronic
1166868991 19:45859308-45859330 AAAAAAAGGGCATGGTGTGGTGG + Intronic
1167032194 19:46970116-46970138 GAAAGAAAGTCATGGGGTGCAGG + Intronic
932479215 2:72028606-72028628 TACAAAAGGGCATGGGGTGGGGG - Intergenic
933384415 2:81591737-81591759 GACAAATGGTCAAGGTCAGCTGG - Intergenic
942788308 2:179728491-179728513 TAAAAGAGGTCATGGTGTGGTGG - Intronic
945300164 2:208208536-208208558 GACACAAGGCAATGGTGGGCAGG - Intergenic
946320358 2:218950483-218950505 GAAAAAAGGTCAGGGGGTGGGGG + Intergenic
947890245 2:233611867-233611889 GACAGAAGGTGATGGGGAGCTGG + Intergenic
947891884 2:233630641-233630663 GACAGAAGGTGATGGAGAGCTGG + Intronic
948742109 2:240054959-240054981 AACAGAAGGTCAGGGTGGGCTGG + Intergenic
1168938268 20:1686630-1686652 AACATATGGTCAAGGTGTGCAGG - Intergenic
1171902164 20:30868194-30868216 GACTACAGGTCACTGTGTGCAGG - Intergenic
1173427946 20:42958762-42958784 GACAATACATCTTGGTGTGCTGG - Intronic
1173471343 20:43325895-43325917 GTCATGAGGGCATGGTGTGCAGG + Intergenic
1175711317 20:61223377-61223399 GTCAAAAGGGCATGATGTGGAGG + Intergenic
1178783919 21:35634548-35634570 CACAGAATATCATGGTGTGCGGG + Intronic
1183202353 22:36394353-36394375 GATAAAAGGGCAGGGTGTGGTGG + Intergenic
949601469 3:5603130-5603152 CACAAAAGATCAAGGTGTTCAGG + Intergenic
950493853 3:13322093-13322115 GACAGACGGCCATGGTGAGCTGG + Intronic
950932619 3:16805609-16805631 GACAAAAGATCATGACATGCGGG + Intronic
955378124 3:58415139-58415161 GACCAAATGTCAGGGTGTGGGGG + Intronic
955398189 3:58572520-58572542 AACAAAAAGACATAGTGTGCTGG + Intronic
961486494 3:127220993-127221015 GACAAAAGGTGCTGGTATGAGGG + Intergenic
962728561 3:138258442-138258464 TACTAAAGGTCATGGAGGGCTGG + Intronic
963007698 3:140741288-140741310 GACAAGAGGTGATGGTGACCAGG - Intergenic
963764215 3:149316924-149316946 GACAAAAGGTAAGGCAGTGCTGG + Intergenic
965799467 3:172476514-172476536 GACAAAAGGGGATGGGTTGCAGG + Intergenic
967941214 3:194768078-194768100 GACTACAGGTCCTGGTGGGCAGG - Intergenic
971828874 4:31663741-31663763 GATCAAAGGTCATGGAGTTCGGG + Intergenic
972293145 4:37710109-37710131 GACAAAAGGGCCGGGTGTGGTGG - Intergenic
986371232 5:7082314-7082336 GGCAGAAAGTCCTGGTGTGCTGG + Intergenic
991649742 5:68839595-68839617 GAGAAAAGGTCTTGGTCTGAGGG + Intergenic
995973484 5:118002514-118002536 AACAAAAGATCATGGTATGCTGG - Intergenic
999725965 5:154437966-154437988 GGCAAAAGATGATGGTGTGATGG + Intergenic
1001960456 5:175877507-175877529 GACAAAAGGCCTTGGGGAGCAGG + Intronic
1003961893 6:11216395-11216417 GACACAAGGGCATTGTGTCCAGG - Intronic
1004827902 6:19443528-19443550 AAAAAAAGGTCCTGGTCTGCGGG - Intergenic
1007028136 6:38599101-38599123 GACAAAATGTAATGATGTTCTGG - Intronic
1008139940 6:47820732-47820754 GAAAATAGGTCATGGTGTAGTGG + Intronic
1008157639 6:48036288-48036310 GACAAAAGGTCAAAGTGCTCAGG + Intronic
1008660117 6:53659174-53659196 GACAAACAGTCATGAGGTGCAGG + Intronic
1012111304 6:95238406-95238428 GGCAGAAGGTCATGGTGGCCTGG + Intergenic
1014439625 6:121459457-121459479 GACAAAAGGGCCTGGTGTGGTGG - Intergenic
1018544124 6:164916953-164916975 GAGAAGAGGTCTTGGTGTGCTGG - Intergenic
1019308113 7:345974-345996 GACAGATGGTCAGGGTGGGCAGG + Intergenic
1023680641 7:42683882-42683904 GACACAAAGTCATGATATGCGGG - Intergenic
1024275625 7:47674489-47674511 GACAAAAGCTCATGGTGGTTGGG + Intergenic
1024541020 7:50475225-50475247 GATGAAAGGTCAGGGTGAGCTGG + Intronic
1030044436 7:105482217-105482239 GTCATAAGGTCCTGGTGAGCTGG - Intronic
1031014469 7:116558115-116558137 GAAATTAGATCATGGTGTGCTGG - Intronic
1032453122 7:132051830-132051852 GACATAAGGGCATGGACTGCTGG + Intergenic
1032471124 7:132180052-132180074 GACAAGAGGGCATGGGGGGCTGG + Intronic
1035328550 7:158081531-158081553 AAACAAAGGTCATGGTGTGAAGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043191927 8:77235625-77235647 AAGACAAGGTCATGTTGTGCTGG - Intergenic
1044465430 8:92498198-92498220 GCCAAAATGTCATGGTTTGGTGG - Intergenic
1044520155 8:93189635-93189657 GAAAAGAGGTCAGGGTGGGCAGG + Intergenic
1048125645 8:131632482-131632504 TACAAAAATTCATGGTTTGCGGG + Intergenic
1048633832 8:136274061-136274083 GACTAAAGATCATGGTGTTTTGG - Intergenic
1048710044 8:137199724-137199746 GACAGAAGCTCATGGTGCTCTGG + Intergenic
1049404850 8:142447768-142447790 GACAAAAGGGCAGGGTGCCCGGG - Intergenic
1051550776 9:18326497-18326519 AAAAATAGGTCATAGTGTGCTGG + Intergenic
1052572084 9:30239656-30239678 AAGAAAAGGTCAAGGTGTGAGGG - Intergenic
1055009415 9:71547995-71548017 GAGAGAATGTCATAGTGTGCCGG - Intergenic
1055070174 9:72157934-72157956 CATAAAAGGACATGATGTGCTGG - Intronic
1059802492 9:117764280-117764302 GACAAAACGTCACTGTGTTCAGG - Intergenic
1187683144 X:21788552-21788574 GAGAAAAGGTCATGAGGTCCTGG - Intergenic
1189409750 X:40759835-40759857 GAGAACAGTACATGGTGTGCAGG + Intergenic
1191670086 X:63740812-63740834 GAAACCAGGTCATGGTGTCCTGG - Intronic
1194413233 X:93579994-93580016 GAAAAAAGGTTATGGGGTACAGG - Intergenic
1194863386 X:99033509-99033531 AAAAAAAGTTCATGGTGAGCAGG + Intergenic
1195222785 X:102762462-102762484 GGCAGAAGGTCAAAGTGTGCTGG + Intergenic
1196122893 X:112069440-112069462 GACAAAAGGTCAGGGTAAGATGG + Intronic