ID: 915286603

View in Genome Browser
Species Human (GRCh38)
Location 1:154857336-154857358
Sequence GGCTGAGGAAAGTCTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915286603_915286606 -7 Left 915286603 1:154857336-154857358 CCCACAGGAGACTTTCCTCAGCC 0: 1
1: 0
2: 0
3: 26
4: 218
Right 915286606 1:154857352-154857374 CTCAGCCCCAGAGCCCAGCACGG 0: 1
1: 2
2: 11
3: 74
4: 568
915286603_915286610 0 Left 915286603 1:154857336-154857358 CCCACAGGAGACTTTCCTCAGCC 0: 1
1: 0
2: 0
3: 26
4: 218
Right 915286610 1:154857359-154857381 CCAGAGCCCAGCACGGCACCTGG 0: 1
1: 0
2: 17
3: 143
4: 849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915286603 Original CRISPR GGCTGAGGAAAGTCTCCTGT GGG (reversed) Intronic
901289186 1:8109413-8109435 TGCAAAGGAAAGTCTCCTGAAGG + Intergenic
902522784 1:17030507-17030529 GGCTAAGAAAATTCTCATGTCGG - Intronic
904379548 1:30101699-30101721 GGATGAGGACGGCCTCCTGTGGG - Intergenic
904699187 1:32348181-32348203 GGGTCAGGAAAGTCTTCTGGAGG - Intergenic
906069776 1:43008069-43008091 CGCCCAGGAAAGTCTTCTGTGGG + Intergenic
907273768 1:53305762-53305784 GGCTGAGGAGAGACTAGTGTGGG - Intronic
912265202 1:108150419-108150441 GGCTCAGTTAAGTCTCCTTTAGG - Intronic
913289787 1:117261550-117261572 GGCTGAGGAAACTTTCCTTTTGG - Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
916817398 1:168367229-168367251 GGCTGAGGAAAGTGGCATGAAGG + Intergenic
920765952 1:208833700-208833722 GTCCGAGGAAAGTGTACTGTGGG - Intergenic
921708118 1:218346858-218346880 GGCTCAGGATAGTCTTCTGGGGG - Exonic
921830964 1:219727141-219727163 GGGTGAGGTGAGTCTCTTGTAGG - Intronic
923545852 1:234922874-234922896 GGCTGAGGAGAGCCTCCAGTGGG - Intergenic
1066982327 10:42429227-42429249 GGCAGAGGAAACTCTCCTAGCGG + Intergenic
1067372129 10:45694652-45694674 GGCAGAGGAAACTCTCCTAGTGG - Intergenic
1067387651 10:45831502-45831524 GGCAGAGGAAACTCTCCTAGTGG + Intronic
1067418477 10:46125768-46125790 GGCAGAGGAAACTCTCCTAGCGG - Intergenic
1067446624 10:46353110-46353132 GGCAGAGGAAACTCTCCTAGCGG - Intergenic
1067503830 10:46832345-46832367 GGCAGAGGAAACTCTCCTAGTGG - Intergenic
1067590759 10:47507657-47507679 GGCAGAGGAAACTCTCCTAGCGG + Intronic
1067637878 10:48015756-48015778 GGCAGAGGAAACTCTCCTAGCGG + Intergenic
1067684265 10:48457582-48457604 CTCTGAGGACAGCCTCCTGTGGG - Intronic
1067875612 10:50004589-50004611 GGCAGAGGAAACTCTCCTAGCGG - Intronic
1070134475 10:73680180-73680202 GGCAGAGGAAACTCTCCTAGCGG + Intronic
1070289553 10:75105438-75105460 GGCCTAGGCAATTCTCCTGTAGG - Intronic
1071584101 10:86802245-86802267 GGCTGAGGATGGTGTCTTGTTGG + Intronic
1071607247 10:87004229-87004251 GGCAGAGGAAACTCTCCTAGCGG - Intergenic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1073273790 10:102290274-102290296 GGCTGAGGATACTCTTCAGTGGG + Intronic
1074310569 10:112319295-112319317 GGATGAGGAAACTTTTCTGTAGG + Intergenic
1076616211 10:131756583-131756605 GGCTGAGGAAAGTCCCCAGAAGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077169618 11:1160388-1160410 GGCTGAGGAGATGCTCCTGGAGG + Intronic
1077894505 11:6443553-6443575 GGCTGAGGAAAGAAGCTTGTCGG + Intergenic
1080636132 11:34125251-34125273 GGAGGAGGAAAGGCTGCTGTTGG + Intronic
1081403069 11:42665277-42665299 GGTTGAGGAATGAGTCCTGTAGG - Intergenic
1081805566 11:45888126-45888148 GGCTGAGGAGAGCCGCCTGTAGG + Intronic
1082926032 11:58548413-58548435 GGAGGAGGAAAGTCTCCTGGAGG + Intronic
1083448127 11:62724292-62724314 GGCTGTGGTAAGCCTCCTCTCGG + Exonic
1084077422 11:66791227-66791249 GACTGAGGAAAGTTTCATTTAGG + Intronic
1084249395 11:67884876-67884898 GGCTGAGGAAAGGAGACTGTGGG + Intergenic
1084528557 11:69712892-69712914 GGCTGAGGAAATCCTCTTGAAGG - Intergenic
1086989480 11:93287501-93287523 GCCTAAGGAAAGGCTCCTGGAGG + Intergenic
1087564738 11:99840055-99840077 GGGTGAGTAAAGAATCCTGTGGG + Intronic
1089106902 11:116017132-116017154 GGCTAAAGTGAGTCTCCTGTAGG + Intergenic
1089441672 11:118522813-118522835 GGCTGAGATAAGGCTCCTGGGGG - Exonic
1090256592 11:125288646-125288668 GGCAGAGGCACGTCTCCCGTAGG + Intronic
1091201682 11:133785307-133785329 AGGTGATGACAGTCTCCTGTGGG - Intergenic
1091595197 12:1873755-1873777 GGCTGAGAAAGGCCTCCTGCAGG - Intronic
1092602450 12:10081972-10081994 AGCAGAGGAAAGAGTCCTGTAGG + Intronic
1096202702 12:49696898-49696920 GGGTGAGGAAACTCTACTGCAGG - Intronic
1096914874 12:55020388-55020410 GGGTGAGGAAAGTCTCTTCTGGG + Intronic
1101433239 12:104644344-104644366 GGCTGAGGAAAGACATCAGTAGG - Intronic
1103635723 12:122303632-122303654 GGCTGAGGATGTTCTCCTGTGGG - Intronic
1108003459 13:45925264-45925286 GATAGAGCAAAGTCTCCTGTGGG + Intergenic
1112381299 13:98893114-98893136 GGCAGAGGGAAGTCCCCAGTGGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114206643 14:20578440-20578462 AGCTCTGGAAAGTCTCCTGCTGG - Intergenic
1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG + Intronic
1119727861 14:76933037-76933059 GGCTGATGAAAATCTCCTGGGGG - Intergenic
1120967339 14:90179418-90179440 GGCTGAGTGAAGTGTTCTGTGGG + Intronic
1121887896 14:97561505-97561527 GCCTGAGCAAACTCTCCTGGAGG + Intergenic
1122629305 14:103099970-103099992 GTCTCAGGAAAGGCTCCTGATGG + Intergenic
1122904062 14:104793933-104793955 GGCTGTGGAAAGACCCATGTTGG - Exonic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1126097470 15:45099731-45099753 GGTTGAGGAAAGTCTCTCGCAGG + Exonic
1129705424 15:77791486-77791508 GGAGGAGGAGAGTCACCTGTTGG + Intronic
1131069638 15:89457834-89457856 GGCTGAGGAAAAAATTCTGTAGG + Intergenic
1131476126 15:92741788-92741810 GACAGAGAAAAGTCTCCTGTTGG + Intronic
1131861392 15:96657241-96657263 GGGGGAGGAAAGACTCCTTTTGG + Intergenic
1133170435 16:3979573-3979595 CCCTGAGGAGAGTCTCCTGGGGG + Intronic
1134251219 16:12575433-12575455 GGCTGCGCAAAGGCTGCTGTGGG + Intergenic
1134269677 16:12722745-12722767 GGCTGAGGAAACTATGCTGGTGG - Intronic
1136382510 16:29902050-29902072 GGCTGAGGAAATGCTGCTGTGGG - Intronic
1138275529 16:55731345-55731367 GGCTGAGGTAGGTCTCCCGCTGG + Intergenic
1138281239 16:55773505-55773527 GGCTGAGGTAGGTCTCCGGCTGG + Intergenic
1138287300 16:55820356-55820378 GGCTGAGGTAGGTCTCCGGCTGG - Exonic
1138551390 16:57750754-57750776 GGCAGAGGAAGGGCTGCTGTGGG - Intronic
1139282956 16:65785492-65785514 GCCTGAGGAAGGGATCCTGTGGG + Intergenic
1139401486 16:66685382-66685404 GGCTCAGGGAAGACTGCTGTGGG + Intronic
1140325878 16:74003016-74003038 GGGTGAAGAAAGTTTCTTGTAGG + Intergenic
1141907245 16:87035106-87035128 GGCTGAATGAAGTGTCCTGTGGG + Intergenic
1143046883 17:4088516-4088538 AGCTGAGGAAAGTGAGCTGTTGG - Intronic
1143511362 17:7396993-7397015 GGCTGAGGCAGGTGTACTGTTGG - Intronic
1146238662 17:31192696-31192718 TGCCGTGCAAAGTCTCCTGTGGG - Intronic
1149756527 17:59191004-59191026 GCTTGAGGAATGTATCCTGTAGG - Intronic
1151569169 17:74917562-74917584 GGCTGAGGAACTTCCCCTCTGGG + Exonic
1151957869 17:77389441-77389463 AGCTGAGGAAAGCCTCATTTTGG + Intronic
1152251850 17:79216541-79216563 GGCTGAGCCCAGTCTCCTGCAGG + Intronic
1152369594 17:79878106-79878128 GGATGGGGAAGGTCTCCTGATGG + Intergenic
1153403224 18:4704835-4704857 GGCTGTGGGAAGTCTCCGGGAGG - Intergenic
1153922024 18:9800292-9800314 GGCTGAAGAAAGTTTCAGGTTGG - Intronic
1154299888 18:13183877-13183899 GGCTGGGGAAAGTGTCATGTTGG + Intergenic
1155336095 18:24766894-24766916 GGATGGGGAAAATCCCCTGTTGG + Intergenic
1156742004 18:40342796-40342818 GGCTGAGGAGATACTCCTTTAGG + Intergenic
1157108216 18:44794589-44794611 GGATGAGGAAAGTAACCTGCTGG + Intronic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1157973939 18:52304069-52304091 AGCTGAAGAAAGTCTCTTGTAGG - Intergenic
1160576156 18:79854919-79854941 CGCTGAGGACTGTCTCCTGGAGG - Intergenic
1161235709 19:3197014-3197036 GGGTGGGGAAAGTGTCCTGGAGG + Intronic
1163036515 19:14572221-14572243 GGCTCAGGGAAGTCCCCTCTCGG - Intergenic
1163425777 19:17240378-17240400 GGCTGGGGAAAGTCCCTTGTGGG + Intronic
1165869905 19:38964297-38964319 GGTAGAGGAAAGTATCCTGAAGG - Intronic
1167259219 19:48448990-48449012 GTCGGAGGAAAGAATCCTGTGGG + Intronic
1167650704 19:50727042-50727064 GGCTGAGAAATGTCTCCTGAAGG - Intergenic
925461579 2:4067689-4067711 AGCAGAGGAAAGTCTTCTGGAGG - Intergenic
925809064 2:7680545-7680567 AGATGAGGAAAATCTCCTGTAGG - Intergenic
926525488 2:13974556-13974578 GGTTTGGGAAAGTTTCCTGTGGG + Intergenic
926799097 2:16643313-16643335 GGCAGCTGAAAGGCTCCTGTAGG + Intronic
926907143 2:17816527-17816549 GGCTGAGGAAAGTCTCGCGCAGG - Exonic
929948979 2:46391796-46391818 GAGTGAGGAAAGTTTCCAGTAGG + Intergenic
931461830 2:62456723-62456745 GGCTGAAGGAAGTCTTCTGGAGG + Intergenic
937549568 2:123070284-123070306 GACTCAGGAAGGTCTCCTGGTGG + Intergenic
942136388 2:172930297-172930319 GGGTGAGGAAGGTGTCTTGTTGG - Intronic
943526467 2:189022530-189022552 TGCTGAGGACAGTCTCCAGGTGG - Intergenic
946148510 2:217748699-217748721 GGCAGAGGAAATTCTCTTTTTGG - Intronic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
947624722 2:231612527-231612549 GGCAGAGGAAACGCTGCTGTGGG + Intergenic
1169989992 20:11491695-11491717 TGCTTAGGAAAGTCAGCTGTTGG + Intergenic
1171103378 20:22407863-22407885 GGCTGAGGCAAGTATCCTCTGGG - Intergenic
1171364069 20:24611640-24611662 GGCTGAGGAGGGGCTCCTGGAGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172592262 20:36126185-36126207 GGATGAGGAAGGCCTCCTGTGGG + Intronic
1172652352 20:36512828-36512850 GGCTGAGGGAAGCCACCAGTGGG + Intronic
1173732493 20:45338454-45338476 GCCTGAGACAAGTCTCCTGATGG - Intronic
1174709436 20:52689220-52689242 GGCTCAGGAAATTAGCCTGTGGG + Intergenic
1175481416 20:59313931-59313953 TGCTTATGAAAGTCTGCTGTGGG - Intronic
1175567385 20:59991202-59991224 GAATTAGGAAAGGCTCCTGTTGG - Intronic
1177205854 21:18010355-18010377 AACTCAGGAAAGTCTCCTGGTGG + Intronic
1177639828 21:23832768-23832790 GGCTTGGCAAAGCCTCCTGTAGG - Intergenic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1180132823 21:45837498-45837520 GCCTGTGGAAATTCTCCTGCGGG + Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180622111 22:17169111-17169133 GGCAGAGGGAAGGCTCCTGGGGG + Intergenic
1182501957 22:30754477-30754499 GGCTGAGGAGAGACTCATGTGGG + Intronic
1184317260 22:43704975-43704997 AAGTGAGGCAAGTCTCCTGTGGG - Intronic
949509792 3:4758014-4758036 GGCTGAGGAAAATTCTCTGTGGG - Intronic
950181456 3:10916427-10916449 AGCTGAGGAGACTCTCCTGCAGG + Intronic
954865433 3:53725177-53725199 GTCTGTGGAAAGTCTCCTATAGG - Intronic
957321857 3:78641712-78641734 GTCTGTGGAAAATCTCCTCTTGG - Intronic
959249799 3:103927175-103927197 CGCGGAGGAATGTCTCCTGGAGG - Intergenic
960704234 3:120466684-120466706 GGGTGAGGAAAGTATGATGTGGG - Intergenic
961082197 3:124035769-124035791 GACTGGGGTCAGTCTCCTGTGGG + Intergenic
961927086 3:130492589-130492611 GGCTGAGGAAATTCTGATGGAGG - Intergenic
964992169 3:162827925-162827947 GGTTGAGGAAAGGGTCATGTAGG - Intergenic
965706502 3:171513337-171513359 GGCTGAGGATAGTTTTCTTTGGG - Intergenic
966095284 3:176193239-176193261 GCATGACAAAAGTCTCCTGTAGG + Intergenic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
968746307 4:2362392-2362414 GGCTGAGGAACAGCTGCTGTGGG - Intronic
976879024 4:89895505-89895527 GGCTGAGGTATGTTTCCCGTGGG - Exonic
977283443 4:95070589-95070611 GGCTCAGGAAAGGATACTGTAGG + Intronic
984024744 4:174529644-174529666 AGAAGAGGCAAGTCTCCTGTAGG + Intergenic
985215020 4:187642721-187642743 AGCTGAGGTGAGTCTCTTGTAGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985519667 5:367659-367681 GGCTGGGGAAGGCCTCCTGAGGG - Intronic
991421965 5:66451353-66451375 TGCTGAGGAAAGTCCACTCTGGG - Intergenic
994941589 5:106330364-106330386 GGCTGAGGATTCTCTCATGTGGG - Intergenic
995935503 5:117506518-117506540 AGTTGAGGAAAGTTTCCTGGAGG - Intergenic
997052907 5:130403420-130403442 ATCTTAGGAAAGTGTCCTGTTGG - Intergenic
997602039 5:135147011-135147033 GGCTGAGGGAAGGCACCTGGGGG + Intronic
998845096 5:146300710-146300732 GCCTGAAAAAAGTGTCCTGTTGG - Intronic
999502604 5:152161776-152161798 GGCTGAGAGAAGTTTACTGTAGG - Intergenic
1000152959 5:158521091-158521113 GGTTCAGGAAGGACTCCTGTAGG - Intergenic
1001240482 5:170065867-170065889 AGGTGAGGTAAGTCTCTTGTAGG - Intronic
1003806295 6:9729031-9729053 GGCAGGGGAAATTCTCCAGTGGG - Intronic
1005956374 6:30666160-30666182 GGCTGAAGATTGCCTCCTGTTGG - Intronic
1006386397 6:33733431-33733453 GGATGAGGACAGCCTCCTGAAGG + Intronic
1006439378 6:34043644-34043666 GGCTGAGGCCAGCCTCCTGGGGG - Intronic
1006446892 6:34084659-34084681 GGCTGAGGAGAGTTTCTTTTAGG - Intronic
1006777800 6:36609736-36609758 GGCTTAAGAAAGGCTCCTTTGGG + Intergenic
1007472252 6:42098634-42098656 GGCTGGGGAAGGCTTCCTGTAGG + Intergenic
1009619716 6:66059039-66059061 GGCTGAGAAATGTGTCGTGTGGG - Intergenic
1011280779 6:85675279-85675301 GGCAGAGGAAAAATTCCTGTTGG + Intergenic
1013100351 6:106981251-106981273 GGGGGAGGAAAGCCTCCGGTGGG + Intergenic
1016670998 6:146707730-146707752 AGGTGAAGTAAGTCTCCTGTAGG + Intronic
1017919332 6:158857618-158857640 GGCTGACCAAAGTGTGCTGTGGG + Intergenic
1019432853 7:1007424-1007446 GGCTGAGGACACTCCCCTGTGGG + Intronic
1021273128 7:18616760-18616782 GGGAGAGGACAGTCTCCTGTTGG + Intronic
1023236248 7:38092026-38092048 ACCTGAAGAAAGTCTCTTGTAGG - Intergenic
1023944144 7:44790161-44790183 GGCTGTGGACAGTGTCCTTTTGG + Intergenic
1024252646 7:47518136-47518158 GGCTGAGGAAATGGTGCTGTGGG - Intronic
1024587197 7:50852103-50852125 GGCTGAGGGAAGCCTCCTGCAGG + Intergenic
1027055483 7:75046611-75046633 GGCTGAGGGCAGTCTCCTCTTGG - Intronic
1030971265 7:116059818-116059840 GGTTGAGAAAGTTCTCCTGTAGG - Intronic
1030992220 7:116314355-116314377 GGATGAGGAAAGCCTTCTGAAGG + Intronic
1031351714 7:120740436-120740458 GGCTTAGATAAGTTTCCTGTAGG - Intronic
1034402585 7:150874770-150874792 GCCTGAGGAAGGAATCCTGTAGG + Intergenic
1035219514 7:157397524-157397546 TGAGGAGGAAAGTCTCCTGTTGG - Intronic
1035299099 7:157885533-157885555 GTCAGGGGAAACTCTCCTGTTGG - Intronic
1035562433 8:616337-616359 TGCTGAAGACAGGCTCCTGTCGG + Intronic
1035813906 8:2517495-2517517 GGCTGGGGAGTGGCTCCTGTGGG - Intergenic
1035820391 8:2585080-2585102 TGATGAGCAATGTCTCCTGTGGG - Intergenic
1038109307 8:24477849-24477871 GGGTGAGGAAAGAATCTTGTTGG - Intronic
1040079635 8:43274345-43274367 GGCTGAGGAGGGTCCCCTCTGGG - Intergenic
1040905073 8:52460308-52460330 GCCTGAGGCAAGTCTCCTAGGGG - Intronic
1043498451 8:80828830-80828852 GACTCTGGAAAGTCTCATGTTGG - Intronic
1043658997 8:82710954-82710976 GCCTCAAGAAATTCTCCTGTCGG - Intergenic
1051497327 9:17737956-17737978 GGCTGGGAAAAGCTTCCTGTAGG - Intronic
1051502521 9:17793434-17793456 GGCTGAGTACTGTCTCCAGTTGG - Exonic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057490414 9:95516154-95516176 GGCTGAGGAACGGCTCCGGGGGG - Intronic
1058999932 9:110337813-110337835 TGCTGATGAAAATCCCCTGTTGG + Intronic
1061250694 9:129424730-129424752 GGGTGAGGAAGGTCCCCTGAGGG - Intergenic
1061280087 9:129592994-129593016 GGTTGAAGAGAGTCCCCTGTGGG + Intergenic
1062421848 9:136486432-136486454 GGCTGAGGACAGTGTCCGGCAGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1187514501 X:19955420-19955442 TCCTGAGCAAATTCTCCTGTAGG + Exonic
1189391884 X:40583341-40583363 GGCTGAGGAAAATTTCCCATGGG + Intronic
1190088813 X:47419703-47419725 TGCTGAGGAAACTGTACTGTTGG - Intergenic
1196884394 X:120229021-120229043 GCCTCAGGAAATTGTCCTGTTGG - Intergenic
1200138598 X:153886418-153886440 GGCTGAGGACACTCTCCGGCCGG - Intronic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic