ID: 915288180

View in Genome Browser
Species Human (GRCh38)
Location 1:154866033-154866055
Sequence GAATGTCCCTGAGCTCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915288173_915288180 -5 Left 915288173 1:154866015-154866037 CCCTCCCCAGGGTCCACTGAATG 0: 1
1: 1
2: 1
3: 27
4: 232
Right 915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 170
915288172_915288180 -1 Left 915288172 1:154866011-154866033 CCATCCCTCCCCAGGGTCCACTG 0: 1
1: 0
2: 7
3: 77
4: 624
Right 915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 170
915288175_915288180 -9 Left 915288175 1:154866019-154866041 CCCCAGGGTCCACTGAATGTCCC 0: 1
1: 0
2: 0
3: 20
4: 174
Right 915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 170
915288168_915288180 17 Left 915288168 1:154865993-154866015 CCAGCAAAAGAGTGTCACCCATC 0: 1
1: 0
2: 0
3: 8
4: 1030
Right 915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 170
915288171_915288180 0 Left 915288171 1:154866010-154866032 CCCATCCCTCCCCAGGGTCCACT 0: 1
1: 1
2: 3
3: 45
4: 377
Right 915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 170
915288176_915288180 -10 Left 915288176 1:154866020-154866042 CCCAGGGTCCACTGAATGTCCCT 0: 1
1: 0
2: 1
3: 15
4: 130
Right 915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 170
915288174_915288180 -6 Left 915288174 1:154866016-154866038 CCTCCCCAGGGTCCACTGAATGT 0: 1
1: 0
2: 1
3: 11
4: 139
Right 915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG 0: 1
1: 0
2: 1
3: 25
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915288180 Original CRISPR GAATGTCCCTGAGCTCTCCT GGG Intronic
900074405 1:801415-801437 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
900172175 1:1274386-1274408 GGATGCCCCTGACCTCCCCTTGG + Intergenic
901390599 1:8943534-8943556 GAACGCCCCAGAGCTCTCCTGGG + Intergenic
902104832 1:14026208-14026230 AAAAATCCCTGAGCTCTCATTGG - Intergenic
902336484 1:15757788-15757810 CAATGTCCCTGAGGCCTCCAGGG + Intronic
902977195 1:20097630-20097652 CACTGTCCCTGAGGTCTCCCTGG + Intergenic
905969913 1:42133912-42133934 GAATGTCCCTGAGCTATGCCTGG + Intergenic
906033901 1:42739220-42739242 GATTGTCCCTGGGGGCTCCTGGG + Intronic
908350448 1:63281805-63281827 GAATGTCCCTGAATTCCCATGGG + Intergenic
910208611 1:84772472-84772494 GAATTTCCCTGAGAGGTCCTTGG + Intergenic
912453694 1:109783751-109783773 GAATGTCCCCCAGCCTTCCTGGG + Intergenic
912550354 1:110481475-110481497 GAGGGTCCCTGAGCTGTCCGAGG + Intergenic
912552952 1:110496253-110496275 CACTGTCCCTAAGTTCTCCTGGG - Intergenic
915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG + Intronic
919793667 1:201308411-201308433 TCATTTCCCTGAGCTCTCCAGGG - Intronic
919931626 1:202224908-202224930 GACTGTCCCTGGGCTCCCCTTGG - Intronic
921251319 1:213300997-213301019 GAAGGTCCCTGAGCCTTTCTGGG + Intergenic
922270252 1:224026319-224026341 GAGTGACCCTGAGCCCTCCCAGG - Intergenic
923844307 1:237712116-237712138 GACTGACCCTGACCTCTCCCCGG - Intronic
1062894665 10:1094065-1094087 CAATGTCCCTGGGCTATCATGGG - Intronic
1062937345 10:1398364-1398386 GAAAGACCATGAGCGCTCCTCGG + Intronic
1063251775 10:4281945-4281967 GAATGACAGTGAGCTCTGCTTGG - Intergenic
1063917029 10:10893662-10893684 GAAGCTTCCTGAGGTCTCCTTGG - Intergenic
1069075486 10:64034557-64034579 GACTTTCCCTCAGCTCTCCTAGG - Intergenic
1076466123 10:130682830-130682852 GAATGTCCCTGAGGTCACACTGG - Intergenic
1078553053 11:12293644-12293666 GAATTTCCCTGGGTGCTCCTTGG - Exonic
1078896944 11:15605218-15605240 GACTGACCCTGAGCTCTACTGGG - Intergenic
1079777653 11:24553895-24553917 GAGTTTCCTTGAGCTCTCTTGGG + Intronic
1080765837 11:35295972-35295994 GAATGTCCTGGAGCTGGCCTTGG + Intronic
1081068023 11:38571896-38571918 GACTGTCCTTGACCTTTCCTTGG - Intergenic
1081585654 11:44382067-44382089 GAGTGTCCCTCAGAGCTCCTGGG - Intergenic
1081612385 11:44570385-44570407 GTGTTTCCATGAGCTCTCCTGGG + Intronic
1081616644 11:44595174-44595196 GTATCTCCCTGAGCTCTCATAGG + Intronic
1083694957 11:64436601-64436623 GGTTATCCCTGAGGTCTCCTTGG + Intergenic
1083796528 11:65020105-65020127 GATGATCCCTGAGCTCTCCGTGG - Intronic
1084187616 11:67483221-67483243 GAAAGTCCGGGAGCTCTCCTCGG - Exonic
1084603651 11:70160691-70160713 GGATGTCCCTGAGCTCACCATGG + Intronic
1084894723 11:72257766-72257788 GAATGTCCCCGGGCCCTCCTAGG - Intergenic
1084951036 11:72665562-72665584 GAACGTGCCTCAGCTCTCTTGGG - Intronic
1086303888 11:85459506-85459528 GAATGTCTCTGAGTTTCCCTGGG - Intronic
1086831569 11:91571956-91571978 GAGTGTCCCTGATCTCCCATGGG + Intergenic
1089377508 11:118005029-118005051 GAATGTTCCTGTTCTCTCCAGGG - Intergenic
1092385435 12:8032937-8032959 GGCTGTCCCTGAGCTGGCCTGGG - Exonic
1093259578 12:16918439-16918461 GAAAGTCTCTGTGCTCTACTGGG - Intergenic
1093416359 12:18925303-18925325 GATTGTCCTTGACCTCTCCAGGG - Intergenic
1094199605 12:27782025-27782047 GAATGACGCTGAGGCCTCCTAGG - Intronic
1095161601 12:38923940-38923962 GGATGTACCGGAGATCTCCTGGG + Intergenic
1095352426 12:41229797-41229819 GAATGTCATTGACCTCACCTTGG - Intronic
1097274071 12:57799699-57799721 CAATGTGCCGGAGCTGTCCTAGG + Intronic
1099816439 12:87654830-87654852 GAAACTCCCTGAACTCTCCAAGG + Intergenic
1100700668 12:97144476-97144498 GAATGGCCCTGCTCTCTCCTAGG + Intergenic
1101991428 12:109488710-109488732 AAAGGTCCCTGAGCTCTCTATGG - Intronic
1102968058 12:117143700-117143722 GAATGTCTCTCACCTCTCTTCGG - Intronic
1104864129 12:131942756-131942778 GAATCTCCCTGAGCCCTGCCTGG - Intronic
1105801096 13:23903740-23903762 GCCTGTCCCGGAGCTCCCCTGGG - Intergenic
1107401553 13:40074342-40074364 GCCTTTCCCTGAGCTGTCCTTGG + Intergenic
1109522061 13:63526333-63526355 GGCTTTCCCTGAGCTCTCTTTGG - Intergenic
1112459074 13:99587180-99587202 GAATTTCACTGAGATCTGCTAGG + Intergenic
1115370575 14:32609469-32609491 GATGGTCCCTGAGCTCTGCCCGG - Intronic
1118480579 14:66161097-66161119 AAATGTGGCTGAGCTCACCTAGG + Intergenic
1118711508 14:68523288-68523310 GAATGTCAGGGAACTCTCCTTGG - Intronic
1119045032 14:71311203-71311225 GAATCTCACTGCGCACTCCTTGG + Intergenic
1119776179 14:77250245-77250267 GGGTGTCTCTGAGCTCCCCTGGG - Intronic
1120826776 14:88963265-88963287 GGAAGTCCCTGAACCCTCCTGGG + Intergenic
1121697286 14:95924205-95924227 GAATCACCATGAGATCTCCTGGG - Intergenic
1121741938 14:96259695-96259717 GAATGTCCCAAAGCCCTGCTTGG + Intronic
1122264633 14:100540888-100540910 CAATGGCCCTGAGCTCCCCCAGG + Intronic
1122558597 14:102594496-102594518 GAGTGTCCAAGAGCTCACCTAGG - Intronic
1124411571 15:29441831-29441853 GAAAGTGCGTGAGCTCACCTGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1129245478 15:74276483-74276505 GCCTGTCCCCAAGCTCTCCTGGG + Intronic
1132119657 15:99166165-99166187 GCATTTCCCTGCCCTCTCCTGGG + Intronic
1133025863 16:2988715-2988737 CAAGGGCCCTGAGCTCTCCTGGG - Intergenic
1133904507 16:10009600-10009622 GTCTGTGCCTGAGCTCACCTGGG + Intronic
1137061178 16:35792891-35792913 GCATGTCCCTGTCCACTCCTAGG + Intergenic
1141685093 16:85565642-85565664 GCATGTTCATGAGCCCTCCTGGG + Intergenic
1143344264 17:6238516-6238538 GAAGGTCACTGAGCTCCCCACGG - Intergenic
1144083784 17:11788304-11788326 GAAATTCCCTTAGGTCTCCTTGG - Intronic
1145888497 17:28398642-28398664 TAATGTCCCTGAGCAGTTCTTGG - Exonic
1146507161 17:33415229-33415251 TGATGTCCCTGAGGTGTCCTGGG - Intronic
1150865744 17:68847994-68848016 GAAGCTCTCTGATCTCTCCTTGG + Intergenic
1151355494 17:73555631-73555653 CAATGTCCCGGAGCTCAACTGGG + Intronic
1151478353 17:74356055-74356077 TCAGGTCCCTGACCTCTCCTGGG - Intergenic
1151619918 17:75239411-75239433 GAAGGGGCCTGAGCTCTCCCTGG - Exonic
1153007015 18:505914-505936 TAATGACCATGAACTCTCCTGGG - Intergenic
1157968873 18:52242228-52242250 GAATGGCAATGAGCTCTACTTGG - Intergenic
1159278436 18:66251158-66251180 GAAGGTCCCTTGGCTTTCCTAGG - Intergenic
1160161237 18:76472574-76472596 GAAATTTCCTTAGCTCTCCTGGG + Intronic
1162555015 19:11381353-11381375 GATTGGCCCTGAGCTTTCTTGGG - Intronic
1163372144 19:16907198-16907220 GAGTCACCCAGAGCTCTCCTCGG - Intronic
1163725933 19:18923006-18923028 GGGTGTCACTGAGCTTTCCTGGG + Intronic
1165457799 19:35924296-35924318 CCATGTCGCTGTGCTCTCCTTGG + Intergenic
1168118491 19:54239516-54239538 TAGTGTCCCAGAGCTCTCCTGGG + Intronic
1168158819 19:54494428-54494450 GGATGTCCCTGAGTCATCCTGGG + Intergenic
1168169467 19:54576165-54576187 TATTGTCCCAGAGCTCTGCTGGG - Intronic
925293254 2:2762367-2762389 GAGTGTCCCTGAGCTCACCCTGG - Intergenic
928729555 2:34215539-34215561 GAATGTGCCTGATCACTCCAGGG + Intergenic
930644046 2:53884804-53884826 GAATGTCCCTGGGATCTTTTGGG - Intronic
931190829 2:59998671-59998693 GATTGTCTCTGTGCTCTCATGGG + Intergenic
932750375 2:74367782-74367804 GAGTGCCCATGAGCGCTCCTTGG - Exonic
933898722 2:86834147-86834169 GACTGTCACTCAGCACTCCTGGG - Intronic
934774379 2:96927799-96927821 GAGTGTCCCTGTGTCCTCCTGGG - Intronic
937253924 2:120541448-120541470 GTATCTTCCTGAGATCTCCTGGG - Intergenic
940005942 2:149009707-149009729 GCATGTTCCTGAGCTCTCAGAGG - Intronic
940324910 2:152414982-152415004 GAAGGTCCCTGAGTTCCTCTTGG + Intronic
941151629 2:161921114-161921136 GAATGCTTCTGAGCTCTCCAGGG - Intronic
944427860 2:199602476-199602498 GAGTGTCGCTGCCCTCTCCTGGG - Intergenic
947770787 2:232668549-232668571 GAGAGTCCCTGAGGTCACCTGGG + Intronic
1170175131 20:13460376-13460398 GAATGTTCCAGAGCTCTTCAAGG + Intronic
1172705487 20:36879259-36879281 GCTTGTCCCTGAGCTGCCCTGGG - Intronic
1173392128 20:42644692-42644714 GAAAGTCCCTGAGTGCTCCTGGG - Intronic
1174188960 20:48726425-48726447 CTATGTCCCTGTGCTATCCTTGG - Intronic
1175726927 20:61324861-61324883 CCATGTCCCAAAGCTCTCCTGGG - Intronic
1175995696 20:62811426-62811448 GATGGTGCCTGAGCTCTCCAAGG + Intronic
1177262560 21:18749847-18749869 GAGTGGCCCTCAGCCCTCCTTGG - Intergenic
1177925402 21:27208271-27208293 TGATGTCCCTGAGCTGTCCTAGG + Intergenic
1178428589 21:32499384-32499406 GAATGTCCCTTGGCTGTCCTTGG - Intronic
1182560188 22:31153544-31153566 GACGGACCCTGAGCTGTCCTGGG + Intergenic
1184606599 22:45578029-45578051 GACAGTCCCTGACCTCCCCTGGG + Intronic
1185053981 22:48568516-48568538 GTGTGTCCCAGAGGTCTCCTTGG + Intronic
950239448 3:11354947-11354969 GAATCTCCCTGGGCTCTCACGGG - Intronic
953784017 3:45896958-45896980 GAAGGTCCCAGAGCTTTCCAGGG - Intronic
954424802 3:50437722-50437744 GAGTTGCCCTGGGCTCTCCTGGG - Intronic
956011163 3:64833136-64833158 GAATGTGCCTGAGATCTCAGTGG - Intergenic
961386633 3:126526617-126526639 GAATGTCTCTGAGCTCCCTGGGG - Intronic
962168714 3:133077920-133077942 GAATGCCCCCGGGCTGTCCTGGG - Intronic
962879671 3:139564436-139564458 GAATGTGGCTGAGCTGTGCTTGG + Intronic
962937624 3:140095477-140095499 TAATGGCACTGAGCTTTCCTGGG - Intronic
963843348 3:150130440-150130462 GACTGTCTCTGCGCACTCCTGGG + Intergenic
970512218 4:16792703-16792725 CCATGTCCCTGGCCTCTCCTCGG + Intronic
970586338 4:17517890-17517912 CAGTGTCCCTGAGCTGTACTGGG - Intronic
971060464 4:22963050-22963072 GAAAGTCCCTGAGATCTCTGAGG - Intergenic
972389673 4:38602811-38602833 CAATGTCCCTGAACCCTCCCAGG - Intergenic
974773358 4:66445651-66445673 GAATCTTCCTGAGATCTCCTGGG + Intergenic
980749629 4:137071168-137071190 GAAAGTCCCTCAACCCTCCTGGG - Intergenic
980848044 4:138347905-138347927 GTTTGTCCCTGAGTTTTCCTGGG + Intergenic
981413403 4:144459188-144459210 AAAAGCCCCTGAGCACTCCTGGG + Intergenic
985299550 4:188473342-188473364 CAATGTCCCTGAGACCTCCAGGG - Intergenic
985646409 5:1086760-1086782 GGCTGCCCCTGGGCTCTCCTGGG - Intronic
986251011 5:6058649-6058671 CACTGCCTCTGAGCTCTCCTTGG + Intergenic
986840927 5:11696721-11696743 GAGTGTCCCTGACCTCCCTTAGG - Intronic
987886781 5:23823564-23823586 GAGTCTCCCTGAGCTCTTTTCGG - Intergenic
992773754 5:80072223-80072245 GAATGTCACTGACTTCTTCTAGG - Intronic
993494745 5:88595178-88595200 AAATTTCCCTGACCTCACCTAGG + Intergenic
995346623 5:111127714-111127736 GAATTTCCCTTACCTATCCTTGG - Exonic
997215933 5:132110715-132110737 GACTGTCCCTTAGCTCACCTTGG + Intergenic
999275279 5:150325797-150325819 GACTGTCCCTGGTCTCTGCTGGG + Intronic
1000018042 5:157295797-157295819 GAATGTCCCTGTGCTTACCTTGG + Intronic
1001311865 5:170616901-170616923 GGATGTCCCTGAGCTGGGCTAGG + Intronic
1003050872 6:2780283-2780305 GAATGTTCCTGATCTCACGTAGG + Intronic
1007375320 6:41452297-41452319 GCAAGTCCTTGAACTCTCCTGGG - Intergenic
1007941744 6:45787981-45788003 GAATTTCCCTGAGGTCTTGTTGG - Intergenic
1011522121 6:88219603-88219625 GAATGAGCCAGAGTTCTCCTGGG + Intergenic
1012367602 6:98461283-98461305 GAAGGTCCCTGAGGTAGCCTAGG + Intergenic
1014200132 6:118600277-118600299 GCCTGTCCCTGAGCCTTCCTGGG + Intronic
1018457407 6:163964352-163964374 GGCTGTCACTGAGCTCCCCTGGG + Intergenic
1019319543 7:409339-409361 GAATGACCCTGAGAGCACCTTGG - Intergenic
1022086369 7:27071782-27071804 GAATGACCCTGAGCTCTGCTGGG - Intergenic
1022891202 7:34701622-34701644 GAATTTCCCTGTACTCTCCTAGG - Intronic
1023938350 7:44755338-44755360 GTGTGTCCCTGCCCTCTCCTGGG + Intronic
1024682805 7:51711389-51711411 CAGTGTCCCTGTGCTATCCTAGG - Intergenic
1026772745 7:73212602-73212624 GACTGTCCCAGATCTCTCCTGGG + Intergenic
1027013609 7:74766002-74766024 GACTGTCCCAGATCTCTCCTGGG + Intergenic
1027074429 7:75180031-75180053 GACTGTCCCAGATCTCTCCTGGG - Intergenic
1033255553 7:139798338-139798360 GAATCTCCCTGTTTTCTCCTCGG - Intronic
1034416092 7:150964945-150964967 CAATGTCCCTGGCCTTTCCTAGG - Intronic
1035541237 8:440064-440086 GAGTGACCCTGAGCCCTCCCAGG + Intronic
1038015206 8:23508987-23509009 AAATATAGCTGAGCTCTCCTGGG + Intergenic
1038518372 8:28206596-28206618 GAATGTTCCTGAGCAGTCCTTGG + Intergenic
1040899501 8:52403406-52403428 CAAGGTCCCTGAGCTCAGCTTGG - Intronic
1041217339 8:55613931-55613953 GAATGTTCCAGAACTCTCTTTGG - Intergenic
1042839775 8:73111967-73111989 AGATTTCACTGAGCTCTCCTGGG + Intronic
1044786782 8:95802553-95802575 TTCTGTCCCTGAGATCTCCTTGG - Intergenic
1045055332 8:98363700-98363722 GAATGTCACTCAGCCCCCCTTGG - Intergenic
1048207962 8:132430852-132430874 GTTTGTCCCTGATGTCTCCTTGG + Intronic
1050591240 9:7162610-7162632 CCATGTCCCTCAGCTCTCCTTGG + Intergenic
1051092931 9:13431338-13431360 CAAAGTGCCTGAGCTTTCCTGGG + Intergenic
1054761782 9:69011429-69011451 GAATCACCCTGAGCCCACCTGGG + Intergenic
1056533186 9:87505347-87505369 CAAAGTCCCTGAGCTCTCTGGGG - Intronic
1056579043 9:87877004-87877026 GCATCTCCCAGAGCTCTCTTAGG - Intergenic
1056912590 9:90716347-90716369 GAAAGTTCCTGAGGTCTCCCTGG + Intergenic
1058644861 9:107121602-107121624 GATTGTCCGTGGGCTCCCCTTGG + Intergenic
1058670909 9:107359765-107359787 GAATGTCCCTGTGGACTTCTTGG + Intergenic
1059280793 9:113131996-113132018 CAGTGTCCTTGAGCTGTCCTTGG + Intergenic
1059430611 9:114248118-114248140 GATTGACCCTGAGGTCTGCTGGG + Intronic
1059737257 9:117114780-117114802 CAATGTCACTTAGTTCTCCTGGG + Intronic
1060859623 9:126943965-126943987 GAGGGTCTCTGAGTTCTCCTTGG - Intronic
1061943932 9:133897997-133898019 GAGTGTCCCTAAGCCCTGCTGGG - Intronic
1062085603 9:134646478-134646500 CCGTGTCCCAGAGCTCTCCTGGG + Intronic
1062348651 9:136127954-136127976 GACTGTACCTGAGCCCACCTTGG + Intergenic
1186978140 X:14930293-14930315 TAATGCCCCTGAGGTCTACTTGG - Intergenic
1189233386 X:39469633-39469655 GAAAGACCTTGAGCTCTACTGGG - Intergenic
1189291166 X:39887095-39887117 GAATTTCCACCAGCTCTCCTTGG + Intergenic
1192776319 X:74249224-74249246 GAATCTCCCTGGGCTCTGGTGGG - Intergenic
1196275751 X:113763648-113763670 GAATGTCCCTGAATTCTAGTTGG - Intergenic
1199351673 X:146809654-146809676 TAGTGTCCCTTAGCTCTCATTGG + Intergenic
1199352234 X:146814839-146814861 TAGTGTCCCTTAGCTCTCATTGG - Intergenic