ID: 915288879

View in Genome Browser
Species Human (GRCh38)
Location 1:154869762-154869784
Sequence TGCTGAAGCTGCGGAGGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 949
Summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 856}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915288879 Original CRISPR TGCTGAAGCTGCGGAGGCTG AGG Exonic
900188383 1:1343306-1343328 TGCTGCTGCTGAGGAGGCTGGGG - Intronic
900213288 1:1467849-1467871 GGCTGGAGCTGCTGGGGCTGTGG - Intronic
900220849 1:1508668-1508690 GGCTGGAGCTGCTGGGGCTGTGG - Intergenic
900225858 1:1533388-1533410 GGCTGGAGCTGCTGGGGCTGTGG - Intronic
900569146 1:3349841-3349863 TGCGGGGGCTGCGGAGGCTGAGG - Intronic
900802963 1:4748662-4748684 CGCTTAAACTGGGGAGGCTGAGG + Intronic
901057500 1:6455467-6455489 TGCGGCAGCTGCTGAGGCAGCGG + Intronic
902300011 1:15495004-15495026 TGCTAAAGATGCGAAGGCAGAGG + Intronic
902340938 1:15783318-15783340 TGTTGAAGCTGTGTGGGCTGTGG + Intronic
902476860 1:16693011-16693033 TGCGGCAGCTGCTGAGGCAGCGG - Intergenic
902743578 1:18457804-18457826 TGCTGGAGCTGGGTAGACTGAGG + Intergenic
902895398 1:19476330-19476352 TGCTTGAGCCGAGGAGGCTGAGG + Intronic
903530389 1:24025883-24025905 TGCTGAAGCCCAGGAGGTTGAGG - Intergenic
903560709 1:24224924-24224946 TGCTGAGGCTGCTGAACCTGAGG + Intergenic
903778887 1:25809450-25809472 TCCAGAAGCTGTGAAGGCTGGGG + Intronic
904789814 1:33010962-33010984 AGCAGAACCTGCTGAGGCTGAGG + Intronic
905136188 1:35802139-35802161 TGCTTGAGCTGGGGAGGTTGAGG + Intergenic
905365871 1:37451252-37451274 GTCTGAAGCTGCGGAGGGGGAGG + Intergenic
905872802 1:41414824-41414846 TGCTGTCCCTGCTGAGGCTGGGG + Intergenic
906173542 1:43748510-43748532 TGCTTAAGCTGGGGAGGTTGAGG - Intronic
906537234 1:46558232-46558254 CGCTGTAGCTGTGGCGGCTGGGG - Exonic
906590981 1:47023909-47023931 AGCTGTACCTGCGGAGGCAGCGG + Exonic
906667728 1:47633247-47633269 TGATGAAGCTTCAGAAGCTGAGG - Intergenic
906745260 1:48216933-48216955 TGCTGGAAGTGTGGAGGCTGTGG - Intergenic
907088399 1:51701021-51701043 TGCTGGAACTGGGGAGGCAGAGG - Intronic
907213410 1:52842586-52842608 TGGGGAGGCTGGGGAGGCTGGGG + Intronic
907308248 1:53525458-53525480 TGGGGAGGCTGGGGAGGCTGGGG + Intronic
907789980 1:57653694-57653716 TGCTTGAGCTGGGGAGGCAGAGG - Intronic
907917779 1:58886594-58886616 TGCTGAAACTGAGGAAACTGAGG + Intergenic
907965724 1:59327085-59327107 TGCTGAAGGTTAGGTGGCTGTGG + Intronic
908129137 1:61057292-61057314 TGCGGCGGCTGCGGCGGCTGCGG + Intronic
908947880 1:69522344-69522366 TGCTGAAACTCCGGAAGCGGAGG - Intergenic
909643518 1:77891997-77892019 TGCTTGAGCTCAGGAGGCTGAGG + Intronic
911193464 1:94970873-94970895 TACTGAAGATTCGGAGGGTGTGG - Intergenic
912716937 1:111989775-111989797 GGCTGGAGCGGCGGAGGCTGCGG - Intergenic
912765786 1:112409042-112409064 TGCTTAAACTGCGGAGGCAGAGG + Intronic
913192549 1:116426002-116426024 TTGTGAAGCTGAGGAAGCTGGGG + Intergenic
913940677 1:125101574-125101596 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
913944040 1:125140417-125140439 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
913955155 1:143283332-143283354 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
913982281 1:143532108-143532130 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
914210574 1:145575018-145575040 TGCTTATGCTGAGGAGCCTGAGG - Intergenic
914751468 1:150537794-150537816 GGCTGAAGCTGGAGAGGCAGTGG + Intergenic
915152455 1:153845296-153845318 TGCTCAAGCACAGGAGGCTGAGG + Intronic
915288877 1:154869753-154869775 TGCTGCTGCTGCTGAAGCTGCGG + Exonic
915288879 1:154869762-154869784 TGCTGAAGCTGCGGAGGCTGAGG + Exonic
915462909 1:156080653-156080675 TGCTGGAGCAGCAGAGGGTGTGG + Intronic
915524780 1:156468840-156468862 TGCTGAGGCTGCTGTGGCTGTGG + Exonic
915524786 1:156468879-156468901 GGCTGCTGCTGTGGAGGCTGTGG + Exonic
915902374 1:159855970-159855992 TGCTGCTGCTGCGGGGGCTCCGG - Exonic
915926037 1:160020359-160020381 TGCTGATGCGGCAGAGGCTGTGG - Intergenic
917533599 1:175858033-175858055 TGCTTCAGCTGGGGAGACTGAGG + Intergenic
917565547 1:176208375-176208397 TGCTTGAGCTGGGGAGGTTGAGG + Intergenic
918009224 1:180571051-180571073 TGATAAAGCTGAGGAGACTGAGG - Intergenic
918101811 1:181382891-181382913 TGCAGAAGGGGCGGAGGCTTAGG + Intergenic
918246401 1:182663610-182663632 TGCTGAAGCCCAGGAGGTTGAGG - Intronic
918616748 1:186553116-186553138 TGCTGAAGGTGGGGTTGCTGGGG + Intergenic
918975885 1:191485566-191485588 TGCTGAAGGTTGGGTGGCTGTGG + Intergenic
919101787 1:193105271-193105293 TGCGGGAGCTGCGGCAGCTGCGG - Intronic
919101980 1:193106522-193106544 TGCGGGAGCTGCGGCAGCTGCGG - Intergenic
919634735 1:199992566-199992588 TGCTTGAGCTCGGGAGGCTGAGG - Intergenic
919750492 1:201034738-201034760 TGCTGGGGCTGTGGGGGCTGGGG - Intergenic
919761518 1:201101217-201101239 GGCTGAAGGTGGAGAGGCTGCGG + Intronic
919886940 1:201941696-201941718 TGCTGAGGCTGTGCAGGCAGTGG + Intronic
920237734 1:204519728-204519750 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
920375626 1:205506296-205506318 TTGTGCAGCTGAGGAGGCTGTGG + Intronic
921266591 1:213425828-213425850 TGCTGCTGCTGCGGTGGCGGTGG + Intergenic
921503807 1:215941650-215941672 TGCTGAACCTGCTGAGCCTGTGG + Intronic
922159563 1:223068626-223068648 TGCTTGAGCTGGGGAGGTTGAGG + Intergenic
922422680 1:225470280-225470302 TGTTGAAGCTGCCCAGTCTGGGG + Intergenic
923047703 1:230367612-230367634 TGCTCAAGCCCAGGAGGCTGAGG + Intronic
923099011 1:230797619-230797641 TTCTGAAGGTGAGGAGGCTGAGG + Intronic
923668426 1:236019170-236019192 AGCTGGAGCTGGGGAGGCTGTGG + Intronic
923781867 1:237032013-237032035 TGCTGAAGATGCAGAAGCCGGGG - Intergenic
924776016 1:247114803-247114825 TGCTGCAGATGGGGAGACTGAGG + Intergenic
1063045534 10:2388400-2388422 TGCTGCAGGTGGGAAGGCTGGGG + Intergenic
1063045960 10:2392748-2392770 TGCTGCAGGTGGGAAGGCTGTGG + Intergenic
1063644004 10:7860186-7860208 TGCTGAAGCCTGGGAGGCAGAGG + Intronic
1064150900 10:12863843-12863865 TGCTTGAGCTGAGGAGGCCGAGG - Intergenic
1064743003 10:18452342-18452364 TGCTTAAGCCCAGGAGGCTGAGG + Intronic
1065290388 10:24223795-24223817 TGCTTGAGCCGCGGAGGTTGAGG - Intronic
1065353843 10:24820010-24820032 TGCTGGAGCCCTGGAGGCTGAGG + Intergenic
1065659203 10:27988419-27988441 TGCTTGAGCTCCGGAGGCAGAGG - Intronic
1065800914 10:29351633-29351655 TGCTTGAGCTGGGGAGGCAGAGG - Intergenic
1065812151 10:29452122-29452144 TGCTGGAGCTCAGGAGGTTGAGG - Intergenic
1066422507 10:35275871-35275893 TGCTAAACCGGCGGTGGCTGGGG - Intronic
1066440918 10:35437568-35437590 TGCTTGAGCTGGGGAGGCAGAGG + Intronic
1066573463 10:36799405-36799427 TGCTTGAGCTGGGGAGGCGGAGG + Intergenic
1066616499 10:37300320-37300342 TGCAGAAGCAGCTGAGGCTCTGG + Intronic
1066951649 10:42124241-42124263 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
1067009956 10:42701710-42701732 TGGCAAAGCTGGGGAGGCTGTGG - Intergenic
1067204082 10:44198863-44198885 AGCTGCCGCTGGGGAGGCTGAGG + Intergenic
1068749003 10:60569934-60569956 TACTGAAGCAGGGGAGGGTGTGG - Intronic
1069129576 10:64682130-64682152 TGCTGCTGCTGTGGAGGATGGGG + Intergenic
1069269769 10:66511944-66511966 TGCTGAGGGTGAGGAGGGTGAGG + Intronic
1069933733 10:71900946-71900968 CGCTGCAGCTGCTGAGCCTGGGG + Intergenic
1070163979 10:73884101-73884123 TGCAGAAACTCGGGAGGCTGAGG - Intergenic
1070408668 10:76119321-76119343 TGCTTCTGCTGCTGAGGCTGGGG + Intronic
1070845382 10:79518500-79518522 TTCGGAGGCTGAGGAGGCTGAGG + Intergenic
1071569407 10:86688436-86688458 TGCTGGAACTGAGGAGCCTGGGG + Intronic
1072120417 10:92401200-92401222 TGCTTGAGCTCAGGAGGCTGAGG - Intergenic
1072158531 10:92745481-92745503 TGCTAAAGTTACGGTGGCTGTGG - Intergenic
1073240669 10:102055906-102055928 TGCTGAAGCTGCGTATGCCGGGG - Intronic
1073349031 10:102806095-102806117 TGCAGCTGCTGAGGAGGCTGAGG + Intronic
1073586294 10:104713306-104713328 TGCTGAGGCTGAGGAGGGTTGGG - Intronic
1074188453 10:111116237-111116259 AGCTGGAGCTCCGGAGCCTGAGG - Intergenic
1074474522 10:113757621-113757643 TGCTGAAGATGCGCTGGCTGTGG + Intronic
1074750191 10:116578477-116578499 TGCTGAAGCAGCCGAGTCTTGGG - Intergenic
1074790664 10:116883830-116883852 TGCTGAAACTGCTGTGGGTGAGG + Exonic
1074903558 10:117840341-117840363 TGCTGAAGATGCTGAGGCTGTGG - Intergenic
1075077316 10:119359961-119359983 TGAGGAGGCTGGGGAGGCTGAGG + Intronic
1075101966 10:119512629-119512651 TGCTTAAGCCTGGGAGGCTGAGG - Intronic
1075588646 10:123675906-123675928 TCCTGCAGCTGAGGATGCTGGGG - Intronic
1075638806 10:124049783-124049805 TACTGAACCTGAGGAGGTTGTGG + Intronic
1076220815 10:128731767-128731789 TGCTGTAGCTGATGTGGCTGAGG + Intergenic
1076312486 10:129518438-129518460 TGCTGTCTCTGCGGTGGCTGAGG - Intronic
1076365061 10:129916311-129916333 TTTTGAAGTTGCGGAGCCTGAGG - Intronic
1076461467 10:130650126-130650148 TGCTGCAGGTGAGGGGGCTGGGG + Intergenic
1076474639 10:130743671-130743693 TGCTGAGGCTGCGGAGACGCGGG + Intergenic
1076899329 10:133329468-133329490 TGCTGAAGCTCAGGAGGCAAAGG - Intronic
1076921945 10:133458873-133458895 TGCTGATGCAGAGGAGGGTGGGG + Intergenic
1077094379 11:793121-793143 TGCTGCAGTGGCGGAGGCTGGGG - Intronic
1077256367 11:1585218-1585240 TGCGGCTGCTCCGGAGGCTGTGG - Exonic
1077339387 11:2019217-2019239 GGCTGCACCTGGGGAGGCTGGGG + Intergenic
1078256606 11:9664093-9664115 GGCTGTGGCTGCGGAGGTTGAGG + Exonic
1079098419 11:17526115-17526137 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
1079100102 11:17535802-17535824 TGCTGCAGCTGAGGAAACTGAGG + Intronic
1080257634 11:30309046-30309068 AGCTGATGCTGTGGAGGCTGAGG - Intergenic
1081695318 11:45105544-45105566 AGCTGTAGCAGTGGAGGCTGAGG - Intronic
1082829574 11:57605778-57605800 AGCTGAGGCAGCGGAGGCTTGGG + Intronic
1083567938 11:63736319-63736341 TGCAGAACCTGCGGATGCAGAGG - Intronic
1083773819 11:64883434-64883456 TGCTGGGGCTGATGAGGCTGGGG + Intronic
1084189709 11:67493395-67493417 TGCAGGAGGTGCGGCGGCTGGGG - Exonic
1084277902 11:68064939-68064961 TGCTGAAGCTGAGTAGGATTGGG - Intronic
1084400541 11:68940431-68940453 TGCTGAAGATGCTGAGGCTGTGG - Exonic
1084554716 11:69868841-69868863 CCTTGAAGGTGCGGAGGCTGGGG - Intergenic
1085332956 11:75668218-75668240 TGCTGCGGCGGCGGTGGCTGCGG + Exonic
1085405237 11:76257620-76257642 GGCTGAGGCTGTGGAAGCTGGGG - Intergenic
1086580368 11:88391913-88391935 TGTTGAAGCTGCCAAGGCTTGGG + Intergenic
1086583860 11:88429721-88429743 TGCTTGAACTGAGGAGGCTGAGG + Intergenic
1087053526 11:93909448-93909470 ATCTGAACCTGGGGAGGCTGAGG - Intergenic
1088325114 11:108593287-108593309 AGCGGCTGCTGCGGAGGCTGCGG - Intronic
1088625012 11:111723785-111723807 TGCTGTAGCTGCGTGGGCAGAGG - Exonic
1088647011 11:111925679-111925701 TGCTGCAGCTGTTGTGGCTGCGG - Exonic
1088976229 11:114818597-114818619 TGAGGAAGCTGCAGAGGCTTAGG - Intergenic
1089914509 11:122140036-122140058 TACTGAAACTTCGGAGGCTGAGG - Intergenic
1090009995 11:123037764-123037786 TGCTGAAGCTTTGGAGGTTCGGG + Intergenic
1090845695 11:130528160-130528182 TGCTGTAGCTCAGGTGGCTGCGG + Intergenic
1202822372 11_KI270721v1_random:74406-74428 GGCTGCACCTGGGGAGGCTGGGG + Intergenic
1091420298 12:333333-333355 TGCTTGAGCTGAGCAGGCTGAGG + Intronic
1092634309 12:10425045-10425067 TGCTGACACTGCGTAGGCTTAGG - Intronic
1092635355 12:10440450-10440472 TGCTGACACTGCGTAGGCTTAGG - Intronic
1092804535 12:12207416-12207438 GGCTGAGGCAGGGGAGGCTGAGG + Intronic
1093039880 12:14365678-14365700 TTTTGAATCTGCGGAGGCGGCGG + Intronic
1093062533 12:14622566-14622588 TGCAGAAGCTGAGGAGAGTGTGG + Intronic
1093072584 12:14722237-14722259 TGCTGATGCTGATGAGGATGTGG - Intergenic
1093158592 12:15717501-15717523 TGCTTAAGCCCCGGAGGCAGAGG + Intronic
1093498084 12:19780056-19780078 TACTGTAGCTGCAGAGGCAGAGG + Intergenic
1093503260 12:19836286-19836308 GGCGGAAGATGCGGAGGCTGGGG + Intergenic
1094427159 12:30327871-30327893 TGCTGTAGCTGCCCAAGCTGTGG + Intergenic
1095263176 12:40122136-40122158 TGCTGGAGCCGAGGAGGTTGAGG - Intergenic
1095954557 12:47798718-47798740 TGCTGAAGGCGGGGAGGCTGGGG + Intronic
1096174144 12:49501033-49501055 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1097174227 12:57133631-57133653 TGCTCAAGGTGCGGGGGGTGGGG - Intronic
1097404838 12:59176974-59176996 TGCAGAAGCTGCCAAGGCTTGGG + Intergenic
1098551910 12:71771890-71771912 TGCTTAAACTGGGGAGGCAGAGG + Intronic
1098626529 12:72678000-72678022 GGCTAAAGCAGCAGAGGCTGGGG - Intergenic
1098688037 12:73450844-73450866 TGGTGAGGCTGCAGAGGATGAGG + Intergenic
1098881376 12:75920727-75920749 TGCTTGAGCTGGGGAGGTTGAGG + Intergenic
1098903044 12:76132447-76132469 TGCTTAAGCCTGGGAGGCTGAGG + Intergenic
1098963757 12:76764432-76764454 TGCCGAAGTTGGGGAGGGTGGGG + Intronic
1099909377 12:88810998-88811020 TGGTGAAGCGGTGGAGGCTGAGG - Intergenic
1100495467 12:95120601-95120623 TGCTTAAACTCCGGAGGCAGAGG + Intronic
1101253832 12:102958363-102958385 CGCTGCCGCTGCGGCGGCTGCGG - Exonic
1101365285 12:104064755-104064777 TGCTGGAGCTGCGGAGGGGGAGG + Intronic
1101449528 12:104763599-104763621 TGCAGAAGCTGCAGAACCTGAGG + Intergenic
1101449529 12:104763608-104763630 TGCAGAACCTGAGGAGCCTGTGG + Intergenic
1101851801 12:108409270-108409292 TGCTTGAGCTCAGGAGGCTGAGG + Intergenic
1101920702 12:108930519-108930541 TGCTTGAACTGGGGAGGCTGAGG - Intronic
1102051717 12:109867230-109867252 TGCTTAAGCTCGGGAGGCGGAGG - Intronic
1102588634 12:113940862-113940884 TGCTGTCGCTGCGGGAGCTGAGG - Intronic
1102979748 12:117232020-117232042 TGCTGCAGCTGCAGAGGCGTTGG + Exonic
1103213065 12:119180498-119180520 TCTTGCAGCTGAGGAGGCTGAGG + Intronic
1103240663 12:119410824-119410846 TGCTTGAGCTGGGGAGGCAGAGG - Intronic
1103272364 12:119684066-119684088 TCCTGAAGCTGGGGAGGGTGGGG - Intergenic
1103763333 12:123266340-123266362 GGCTGAAGAAGCGGTGGCTGTGG - Intronic
1103995308 12:124825883-124825905 TGCTTACGGGGCGGAGGCTGGGG + Intronic
1104181605 12:126386819-126386841 AGCTGAGGCTCCCGAGGCTGAGG + Intergenic
1104376204 12:128267145-128267167 TGCGGAGGCTGCGGAGGCTGCGG + Intergenic
1104603997 12:130174663-130174685 TGCTTAAACTGGGGAGGCAGAGG - Intergenic
1105508855 13:21034608-21034630 TGCTGAAGATGAGCAGGCTGTGG - Intronic
1105902752 13:24771233-24771255 TGCTTCAGCTGGAGAGGCTGAGG - Intronic
1106070970 13:26410645-26410667 TGATGAAGGTGTGCAGGCTGTGG - Intergenic
1106247741 13:27963242-27963264 GGCTGAGGCTGGGGAGGCTGTGG + Exonic
1106715968 13:32388200-32388222 TGCTTGAGCTGGGGAGGCAGAGG - Intronic
1108494010 13:51006659-51006681 TGCTGGAGCCTCTGAGGCTGTGG + Intergenic
1109076788 13:57846003-57846025 TTCTGAAGCTGCCGAGACTTGGG + Intergenic
1109226622 13:59704125-59704147 TTCTGAAGCTGTGGATGATGAGG - Intronic
1110300926 13:73926257-73926279 TGCTGAGGTTGGGGTGGCTGTGG - Intronic
1111323465 13:86661596-86661618 TGCTTGAGCTGGGGAGGCAGAGG - Intergenic
1111687238 13:91516866-91516888 TGTGGAAGCTGCCGAGGCTTGGG + Intronic
1111886504 13:94028179-94028201 TGCTTGAGCTTCGGAGGTTGAGG + Intronic
1112572179 13:100602990-100603012 AGCTGAAGCAGTGAAGGCTGAGG + Intergenic
1113415195 13:110123544-110123566 TGGTGAAGCTGTAGAAGCTGGGG - Intergenic
1113886678 13:113664657-113664679 TGCTGATGCTGTGGAGGCGTAGG - Intergenic
1113916943 13:113879854-113879876 ATCTGGAGCTTCGGAGGCTGAGG - Intergenic
1113937106 13:114000264-114000286 GGCTGCAGGTGCGGGGGCTGAGG + Intronic
1113943696 13:114032458-114032480 TTCAGAAGGTGGGGAGGCTGAGG - Intronic
1114179350 14:20352496-20352518 TCCTGATACTGAGGAGGCTGAGG - Intronic
1114185526 14:20398780-20398802 TGATGAAGCTGCTGATGGTGTGG - Intronic
1114221248 14:20699412-20699434 TGCTGACCCTGCTGGGGCTGGGG + Exonic
1114559293 14:23578882-23578904 AGCTGAAGATGGGGAGGCAGGGG + Intergenic
1115028395 14:28767475-28767497 TGCTGCTGCTGCGGCGGCGGCGG - Exonic
1115134789 14:30095619-30095641 TGTGGAAGCTGCCAAGGCTGGGG - Intronic
1115364978 14:32547758-32547780 TGCTTGAGCTGAGGAGGTTGAGG + Intronic
1115436699 14:33383001-33383023 TGCTGGAGCTGAGGAGGTTGAGG + Intronic
1116018243 14:39432046-39432068 TGCAGCAGCTGCGACGGCTGCGG - Exonic
1116144350 14:41044258-41044280 TCCAGAAGCTTGGGAGGCTGAGG + Intergenic
1116855150 14:49945683-49945705 TGCTTAAGCTACAGAGGATGTGG - Intergenic
1117263299 14:54059077-54059099 TGGTGAAGCTGGGGTGGCTGTGG + Intergenic
1117602731 14:57391180-57391202 TGCTGCTCCTGCGGCGGCTGAGG - Exonic
1117973953 14:61280232-61280254 TGCTGAAGATGAGGAGCTTGTGG + Exonic
1118283422 14:64449704-64449726 GGCTGAAGCTGCGAAGCATGGGG - Intronic
1118593315 14:67417825-67417847 TGCTTAAGCCTGGGAGGCTGAGG - Intergenic
1119318357 14:73714130-73714152 TGCCGAAGTCGCGGCGGCTGCGG + Exonic
1119370098 14:74132590-74132612 TGCTTAAGCCGGGGAGGCGGAGG - Intronic
1119410273 14:74426045-74426067 TGCTGAAGCGGCGGCTGCTCAGG - Exonic
1119530940 14:75361045-75361067 GGCTGAGGCTGGGGAGGCAGAGG - Intergenic
1120790826 14:88580109-88580131 TGCTGGAGCCCGGGAGGCTGAGG + Intronic
1120790835 14:88580141-88580163 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1120790853 14:88580219-88580241 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1120813080 14:88824857-88824879 CGCTGAGGCTGCGGGGTCTGGGG + Intronic
1120991855 14:90383927-90383949 CGTTGGAGCTGCAGAGGCTGCGG + Intergenic
1121700844 14:95953082-95953104 GCCTGAGGCTGAGGAGGCTGGGG - Intergenic
1122452321 14:101819697-101819719 TGCTCGAGCTGGGGAGGTTGAGG - Intronic
1122883063 14:104698795-104698817 GGCTGAGGCCCCGGAGGCTGAGG - Intronic
1123039957 14:105486450-105486472 TGCGGGGGCTGCGGGGGCTGGGG - Intergenic
1123065864 14:105618851-105618873 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123070021 14:105638097-105638119 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123074613 14:105661759-105661781 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123089260 14:105734884-105734906 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123095047 14:105763041-105763063 TGCAGTGGCTGCGGTGGCTGCGG - Intergenic
1123117369 14:105900745-105900767 TGCGGGGGCTCCGGAGGCTGTGG + Intergenic
1123475807 15:20592136-20592158 TGCAGGGGCTGCGGAGGCTGAGG - Intergenic
1123642203 15:22408227-22408249 TGCAGGGGCTGCAGAGGCTGAGG + Intergenic
1124957178 15:34367168-34367190 TGCTGCAGCAGCGGCGGCGGCGG + Exonic
1125522941 15:40358267-40358289 TGCTGAAGCCGCGGCGGCGGCGG - Exonic
1125996470 15:44165749-44165771 TGCTTGAGCTGGGGAGGCTGAGG + Intronic
1126206703 15:46053558-46053580 TGATGCAGATGCTGAGGCTGAGG - Intergenic
1127144105 15:56007273-56007295 TGCTGGTGCTGCGGCGGCGGGGG + Intergenic
1127265478 15:57357537-57357559 TGCTTAAGCTGAGGAGTTTGAGG + Intergenic
1127444050 15:59042208-59042230 TGCTTAAGCGTGGGAGGCTGAGG - Intronic
1127996224 15:64154421-64154443 TGCTGAAGCTGTAGAGGCCCTGG - Exonic
1128111708 15:65080312-65080334 TGCTGTAGTTGCCCAGGCTGGGG + Intergenic
1128307805 15:66611544-66611566 TGCTGAAGCTACGCAGGTGGGGG + Intronic
1128399451 15:67262799-67262821 TGCTTAAGCCTTGGAGGCTGAGG + Intronic
1128478527 15:68017759-68017781 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
1128839956 15:70842127-70842149 TGCTTGAGCTTGGGAGGCTGAGG - Intronic
1129154134 15:73707207-73707229 TGCAGAAGCTGCTGAGGCCCTGG + Intronic
1129236010 15:74224165-74224187 TGCTGGCCCTGGGGAGGCTGGGG + Intergenic
1129332726 15:74836020-74836042 AGCAAAAGCTGCGGAAGCTGAGG - Intergenic
1129385240 15:75192627-75192649 TGCTGGAGCAGAGGGGGCTGTGG + Intergenic
1129706913 15:77799583-77799605 AGCGGGAGCTGCTGAGGCTGGGG - Intronic
1130259560 15:82344669-82344691 TGCGGGAGCTGGAGAGGCTGCGG - Exonic
1130259564 15:82344687-82344709 TGCGGGAGCTGGAGAGGCTGCGG - Exonic
1130269118 15:82434499-82434521 TGCGGGAGCTGGAGAGGCTGCGG + Exonic
1130281702 15:82524499-82524521 TGCGGGAGCTGGAGAGGCTGCGG + Intergenic
1130473070 15:84240661-84240683 TGCAGGAGCTGGAGAGGCTGCGG + Exonic
1130473074 15:84240679-84240701 TGCGGGAGCTGGAGAGGCTGCGG + Exonic
1130480484 15:84354726-84354748 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1130480488 15:84354744-84354766 TGCGGGAGCTGGAGAGGCTGCGG + Intergenic
1130491224 15:84433015-84433037 TGCGGGAGCTGGAGAGGCTGCGG - Intergenic
1130491228 15:84433033-84433055 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130502807 15:84511815-84511837 TGCGGGAGCTGGAGAGGCTGCGG - Intergenic
1130502811 15:84511833-84511855 TGCAGGAGCTGGAGAGGCTGCGG - Intergenic
1130595359 15:85245269-85245291 TGCAGGAGCTGGAGAGGCTGCGG + Intergenic
1131187394 15:90286390-90286412 TGCAGCTGCTGGGGAGGCTGAGG + Intronic
1131243200 15:90766509-90766531 TGCTGGAGCTTGGGAGGCAGAGG - Intronic
1131289948 15:91099012-91099034 TGCTTGAGCTGCGGAGGTTGAGG + Intergenic
1132262935 15:100441971-100441993 TGGTGGAGGAGCGGAGGCTGAGG - Intronic
1132340330 15:101074251-101074273 TGGTGGAGGAGCGGAGGCTGAGG - Intronic
1132866281 16:2094159-2094181 CGCTGGCGCTGCAGAGGCTGGGG - Exonic
1133754795 16:8754269-8754291 TGCTTAAGCTAGGGAGGTTGAGG + Intronic
1134045961 16:11101310-11101332 GGGTGAGGCTGCGGAGGGTGGGG - Intronic
1134048786 16:11122217-11122239 TCCTGAAGAAGAGGAGGCTGGGG - Intronic
1134057299 16:11178573-11178595 CGGTGAGGCTGCGGAGGCTGTGG - Exonic
1134270148 16:12725944-12725966 CACTGAGGCTGGGGAGGCTGAGG + Intronic
1134544165 16:15094919-15094941 TGCTGGAACTGGGGAGGCGGAGG - Intronic
1135532756 16:23268512-23268534 TGCTTAAGCCTGGGAGGCTGAGG + Intergenic
1135717705 16:24786766-24786788 TGCTTAAACCGCGGAGGCAGAGG - Intronic
1136220194 16:28823494-28823516 TGCTGCGGCGGCGGCGGCTGCGG - Exonic
1136697850 16:32101936-32101958 TGCTAGAGCTTGGGAGGCTGAGG - Intergenic
1136710486 16:32233370-32233392 TGCTGCAGATGGGGAGACTGGGG + Intergenic
1136757425 16:32696041-32696063 TGCTGCAGATGGGGAGACTGGGG - Intergenic
1136769753 16:32825937-32825959 TGCTAGAGCTTGGGAGGCTGAGG + Intergenic
1136798345 16:33045218-33045240 TGCTAGAGCTTGGGAGGCTGAGG - Intergenic
1136810682 16:33174334-33174356 TGCTGCAGATGGGGAGACTGGGG + Intergenic
1136817158 16:33284414-33284436 TGCTGCAGATGGGGAGACTGGGG + Intronic
1136823722 16:33340945-33340967 TGCTGCAGATGGGGAGACTGGGG + Intergenic
1136939890 16:34513433-34513455 TGCTTCAGCTTGGGAGGCTGAGG + Intergenic
1136945870 16:34650354-34650376 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1136948713 16:34688936-34688958 TGCTTCAGCTTGGGAGGCTGAGG - Intergenic
1136959929 16:34835133-34835155 TGCTTCAGCTTGGGAGGCTGAGG - Intergenic
1136968108 16:34939565-34939587 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1137088608 16:36160219-36160241 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1137093119 16:36219442-36219464 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1137220022 16:46439794-46439816 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
1137265865 16:46868506-46868528 TGCAGAAGCTGCCAAGGCTTTGG + Intergenic
1137300266 16:47143026-47143048 TGCTGCGGCCACGGAGGCTGCGG - Intronic
1137341075 16:47606080-47606102 TGCTGCTGCTGCAGAGGCAGCGG + Intronic
1138590702 16:57998198-57998220 TGCTGAGGCTGCGGTGGCTGTGG + Exonic
1138922969 16:61555715-61555737 AGCTGCAGCTGCTGATGCTGGGG - Intergenic
1139095793 16:63703487-63703509 TGCTGACGCTGTGGCAGCTGTGG + Intergenic
1139100375 16:63759884-63759906 TCCAGCAGCTGGGGAGGCTGAGG + Intergenic
1139538679 16:67597115-67597137 TCCTGAACCTGGGGAGGTTGAGG - Intronic
1139743082 16:69052350-69052372 TGCTTAAGCCTGGGAGGCTGAGG - Intronic
1139914883 16:70421773-70421795 TGCTCAGGATGCTGAGGCTGAGG - Intronic
1140393309 16:74606874-74606896 TGCTGAAGCTGCGATGACTGAGG + Exonic
1140395728 16:74624903-74624925 TGCTTAAGCTGAGGAGTTTGAGG + Intronic
1140470307 16:75210112-75210134 TGCTTGAGCTGAGGAGGCTGAGG - Intergenic
1140723096 16:77788632-77788654 TGCGGTGGCTGCGGTGGCTGCGG - Exonic
1141413341 16:83851492-83851514 TGCTGAAGGAGCTGTGGCTGAGG - Intergenic
1142200285 16:88757852-88757874 TGCTGGAGCTGAGGCTGCTGGGG - Intronic
1142201713 16:88764162-88764184 TCATGAAGCTGCGGAGGGTGGGG + Intronic
1142230498 16:88897956-88897978 TGCTGAGGGTGCGGAGGCCGGGG + Intronic
1203059574 16_KI270728v1_random:956390-956412 TGCTGCAGATGGGGAGACTGGGG - Intergenic
1203072171 16_KI270728v1_random:1088041-1088063 TGCTAGAGCTTGGGAGGCTGAGG + Intergenic
1142587799 17:985296-985318 TGCTGAAGGTTGGGTGGCTGTGG - Intergenic
1142596863 17:1034052-1034074 TGCTTGAGCTGGGGAGGCGGAGG - Intronic
1142695666 17:1631584-1631606 TGCTTGAGCTGGGGAGGCAGAGG + Intergenic
1142699250 17:1649458-1649480 AGCAGGAGCTGCGGCGGCTGCGG - Exonic
1142757642 17:2025242-2025264 TGCTGCAGCCGCGGCGGCGGTGG - Exonic
1142892556 17:2953993-2954015 TGCTTAAGCTGAGGGGGATGGGG - Intronic
1143490250 17:7281833-7281855 CGCAGAACCTGCGGAGGCCGCGG - Exonic
1143639548 17:8188337-8188359 TGCTGCTGCTGCGAAGGCTGAGG - Exonic
1143921726 17:10335669-10335691 TGCTTAAACTGGGGAGGCAGAGG + Intronic
1143956047 17:10670037-10670059 TGTTGAAGGTGGGGAGGCAGAGG + Intergenic
1143989470 17:10944464-10944486 TGCTCAAACTGAGGAAGCTGTGG - Intergenic
1144496639 17:15749924-15749946 TGAGGAGGCTGAGGAGGCTGAGG + Intergenic
1144606220 17:16667315-16667337 TGAGGAGGCTGAGGAGGCTGAGG + Intergenic
1144641242 17:16938184-16938206 TGCTGAAGCTGCCCAGTCTGTGG + Intronic
1144873775 17:18386044-18386066 TGCTGAAGCTGCCCAGTCTGTGG - Intronic
1145158692 17:20559746-20559768 TGCTGAAGCTGCCCAGTATGTGG + Intergenic
1146328050 17:31904049-31904071 TGCTGGAGCTCAGGAGGTTGAGG - Intergenic
1146794186 17:35769751-35769773 AGCGGGAGCTGCGGGGGCTGGGG + Intronic
1146874015 17:36393357-36393379 TGCTGAAGGTGCCCAGTCTGTGG - Intronic
1146881368 17:36444269-36444291 TGCTGAAGGTGCCCAGTCTGTGG - Intergenic
1146939415 17:36833936-36833958 TCCAGATACTGCGGAGGCTGAGG + Intergenic
1147065372 17:37919516-37919538 TGCTGAAGGTGCCCAGTCTGTGG + Intergenic
1147186560 17:38716445-38716467 GGCTGAAGGGGCGGGGGCTGTGG - Exonic
1147188313 17:38724855-38724877 TGCTGCAGCTGCAGCTGCTGCGG - Exonic
1147416902 17:40298530-40298552 AGCTGGAGCTGGGGAGGCTGAGG - Intronic
1147535054 17:41315436-41315458 TGTGGAGGCTGCGGAGGCTGCGG - Exonic
1147535056 17:41315445-41315467 TGCGGAGGCTGTGGAGGCTGCGG - Exonic
1147710329 17:42458893-42458915 TCCTGGAGCCGCGGAGGGTGCGG + Exonic
1147753965 17:42755905-42755927 TTCTGGAGATGAGGAGGCTGGGG + Intergenic
1147971176 17:44219744-44219766 GGCTGAGGCTGCGGCGGCGGCGG - Intronic
1148057766 17:44811467-44811489 ACCTGAACCTGGGGAGGCTGAGG - Intronic
1148268355 17:46244080-46244102 TGCTGGAGCTGGTGAGCCTGCGG + Intergenic
1148537114 17:48449201-48449223 TGGTGAGGCTGACGAGGCTGTGG + Intergenic
1148583214 17:48758056-48758078 TGCTTGAGCTCAGGAGGCTGAGG - Intergenic
1148868461 17:50641540-50641562 GCATGAAGCTGCAGAGGCTGCGG + Intronic
1149166928 17:53762892-53762914 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
1149819846 17:59765672-59765694 TGTTGAAGAGGCTGAGGCTGAGG + Intronic
1150207482 17:63420126-63420148 TGCTGAGGCTGCGGTGGCGGCGG - Exonic
1150530289 17:65974158-65974180 TGCTTGAGCTGGGGAGGCTGAGG - Intronic
1150560949 17:66294563-66294585 CGCTTAAGCTGGGGAGGCAGAGG - Intergenic
1151569580 17:74919545-74919567 CGCTGATGCTGCGGAGGTCGAGG + Exonic
1152076582 17:78163780-78163802 TGCTCGAGCTGGGGAGGCGGAGG + Intronic
1152195154 17:78913625-78913647 TGCTTAAGCCCAGGAGGCTGAGG + Intronic
1152279575 17:79377536-79377558 TGCTGTAGGTGCGGCGGCCGAGG + Intronic
1152747943 17:82049826-82049848 TCATGAAGCTGCCCAGGCTGGGG + Exonic
1152785967 17:82248303-82248325 TGCTGAAGAGGCGGTGGCCGTGG + Intronic
1152792381 17:82288395-82288417 TGTTTAAGCTGCCCAGGCTGTGG + Intergenic
1152914231 17:83024668-83024690 GGCTGAGACTGCGGAAGCTGCGG + Intronic
1152941745 17:83176442-83176464 AGCAGCAGCAGCGGAGGCTGGGG + Intergenic
1203173411 17_GL000205v2_random:173440-173462 TGCTGAAACTTGGGAGGCAGAGG - Intergenic
1203183673 17_KI270729v1_random:90996-91018 TGCTTGAGCTTGGGAGGCTGTGG - Intergenic
1153198777 18:2628726-2628748 ACCTGAACCTGGGGAGGCTGAGG - Intergenic
1153967035 18:10191406-10191428 TGCTTAAGCTGCGCGGGATGTGG + Intergenic
1153997472 18:10454642-10454664 CGCTGCAGCTGCGGTGGCGGTGG + Exonic
1154952555 18:21224469-21224491 TGCTGAAGGTTGGGGGGCTGTGG + Intergenic
1155652600 18:28159738-28159760 TGCTTGAGCTGCGGAGGCAAAGG - Intronic
1156168332 18:34451091-34451113 TGCTGAAGGTTAGGTGGCTGTGG + Intergenic
1156886898 18:42145499-42145521 TGCTGAAACTCAGGAGGCAGAGG + Intergenic
1157252895 18:46111406-46111428 TGCTTGAGCTGGGGAGGCAGAGG - Intronic
1157749061 18:50161910-50161932 TCAGGAAGCTGGGGAGGCTGAGG + Intronic
1158107140 18:53898670-53898692 TGCTCAAGCCTGGGAGGCTGAGG + Intergenic
1158387579 18:57012589-57012611 TGCTGTAGCTGCCTGGGCTGGGG + Intronic
1158810378 18:61026769-61026791 TGCCCAAGCTGAAGAGGCTGAGG - Intergenic
1158920591 18:62187301-62187323 TGCTGGTGCAGCAGAGGCTGAGG + Exonic
1158933013 18:62339335-62339357 TGCACAAGCTGGGGAGGGTGAGG - Intronic
1158970471 18:62661781-62661803 TGCTTAAGCTCAGGAGGCAGAGG + Intergenic
1159027688 18:63200970-63200992 TGCTGGAGCTGAGGATGCAGCGG - Intronic
1159215279 18:65384183-65384205 AGCTGAAGCTCCAGTGGCTGTGG - Intergenic
1159656990 18:71042015-71042037 TGCTGAAGGTGAGGTGGCTGTGG - Intergenic
1159984666 18:74828045-74828067 TGCGGAAGCAGCGGAGGCCCAGG - Intronic
1160337920 18:78059374-78059396 TGCTGAAGCCGCACCGGCTGTGG - Intergenic
1160441481 18:78896162-78896184 TGCTGCTGCTGCTGCGGCTGAGG - Intergenic
1160504390 18:79418856-79418878 TGAGGAGGCTGCGGAGGCCGAGG + Intronic
1160771493 19:833813-833835 TGCTGAAGCCTGGGAGGCTGAGG - Intergenic
1161413661 19:4132038-4132060 TGCTTAAACTGGGGAGGCGGAGG + Intergenic
1161569572 19:5023169-5023191 TGCTGTGGCTGCGGAGGTGGAGG + Intronic
1161776022 19:6262597-6262619 TGCAGAGGATGAGGAGGCTGAGG + Intronic
1161802714 19:6424730-6424752 GGCTGAAGCTGAGGAGGCGGCGG + Exonic
1161960488 19:7520459-7520481 TGCTGCAGCTGCAGCGGCCGCGG - Exonic
1162358219 19:10200636-10200658 TGCTTGAGCTTGGGAGGCTGAGG - Intronic
1162596494 19:11633562-11633584 TGCGGAAGCTGCCAAGGCTTGGG - Intergenic
1163125629 19:15242956-15242978 TGCTGAGGCTTGGCAGGCTGCGG + Exonic
1164619969 19:29689578-29689600 TAATGAACCTGTGGAGGCTGTGG + Intergenic
1164711278 19:30358830-30358852 GGCTGAAGCAGCTCAGGCTGGGG + Intronic
1164941712 19:32256098-32256120 TGCTTAAGCCCAGGAGGCTGAGG + Intergenic
1164972462 19:32544232-32544254 TGCTTAAGCTTGGGAGGCGGAGG + Intergenic
1165271293 19:34709920-34709942 TGCTGAAGCTGCAGAGTCAAAGG - Intergenic
1165349619 19:35268870-35268892 TGCAGGAGCGGCGGCGGCTGCGG + Intergenic
1165404534 19:35621703-35621725 GGCTGAAGCTGGTGAGGGTGGGG - Intronic
1165566500 19:36733680-36733702 CGCTTAAGCTGAGGAGGTTGAGG + Intronic
1165682682 19:37790816-37790838 TGCTGGAGCTGCGAAGGAAGGGG + Intronic
1165685687 19:37817686-37817708 TGCTGGAGCTGCCGAGGTGGGGG + Intergenic
1165790340 19:38487715-38487737 TGCTGAAGCCCAGGAGGTTGAGG - Intronic
1166888033 19:45973374-45973396 TGCTGCTGCTGCGGCGGCTGCGG + Exonic
1167201236 19:48066883-48066905 TGCTTGAGCTGGGGAGGCTGAGG + Intronic
1167332427 19:48864642-48864664 TGCTGAAGCCCAGGAGGCTGAGG - Intronic
1167561655 19:50229554-50229576 TGCTTGAGCTGGGGAGGCGGAGG + Intronic
1167578491 19:50328958-50328980 TGCTGCTGCTGCGGCGGCAGCGG + Exonic
1167774546 19:51546055-51546077 TGCTGACCCTGCATAGGCTGCGG - Intergenic
1168164560 19:54537713-54537735 TGCTAATGCTCGGGAGGCTGAGG + Intronic
1168420976 19:56203186-56203208 TGCTGCTGCTCAGGAGGCTGAGG - Intronic
1168454917 19:56499220-56499242 TGCTTAAACTGGGGAGGCGGAGG + Intergenic
1168640196 19:58025998-58026020 TGCTGTAGCTGCAGAGGCTATGG + Intergenic
1202671791 1_KI270709v1_random:61529-61551 TGCTTGAGCTTAGGAGGCTGAGG - Intergenic
1202682132 1_KI270712v1_random:16304-16326 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1202710875 1_KI270714v1_random:18837-18859 TGCGGCAGCTGCTGAGGCAGCGG - Intergenic
925039064 2:716320-716342 TGCTGAAGCTGTGAAAGCTGGGG + Intergenic
925072619 2:983137-983159 TGAAGAAGCTGCGGAGGTGGAGG + Intronic
925072627 2:983212-983234 TGCAGAAGCTGCAGAGGTGGAGG + Intronic
925179980 2:1811348-1811370 TGCTGGAGCTGATGACGCTGGGG - Intronic
925191954 2:1892246-1892268 TGCTGCTGCTGCTGGGGCTGGGG + Exonic
925611248 2:5705386-5705408 TGGAGGAGCTGGGGAGGCTGGGG + Intergenic
925731145 2:6920061-6920083 GGCTGAAGCTGCTGAGGTTCAGG + Intronic
925938092 2:8787450-8787472 TGCTTAAGCTTCGGGGGTTGAGG - Intronic
926202637 2:10812723-10812745 GGCTGAAGCGGCGGCGGCGGTGG - Intronic
926278149 2:11421594-11421616 TGCTGAGGCTCAGGAGGATGAGG - Intergenic
926414954 2:12640499-12640521 TGTTGAAGCTTTGGAGGCTTTGG + Intergenic
927760031 2:25744291-25744313 TGCAGCAGCTGCGGCGGCAGCGG + Exonic
928376148 2:30776345-30776367 TGGTGCAGCTGTGGAGGCTGTGG - Intronic
928515197 2:32038501-32038523 TGCTGGAGCTGGGGAGGTTGAGG - Intronic
928827735 2:35441104-35441126 GGATGAAGGAGCGGAGGCTGAGG + Intergenic
928964501 2:36963871-36963893 TGCTTAAACTTGGGAGGCTGAGG + Intronic
929693326 2:44092823-44092845 TGCTTGAACTGCGGAGGCAGAGG - Intergenic
930117096 2:47727450-47727472 GGCTGAAGCTGGGGAGGTCGAGG + Intronic
930136095 2:47905563-47905585 TGCTGCTGCTGCGGCGGCGGCGG + Exonic
930448343 2:51502292-51502314 TGCAGATGCTGGGGAGGGTGTGG - Intergenic
930656581 2:54013174-54013196 TGCTGAGGATGTGGAAGCTGGGG - Intronic
930831746 2:55751134-55751156 TGCTGAAGGTTGGGTGGCTGTGG - Intergenic
932028958 2:68163831-68163853 GGTTGAAGCTGCCCAGGCTGGGG + Intronic
932116891 2:69059324-69059346 TGCTGAAGGTGGGGTGGCTGTGG - Intronic
932185988 2:69696018-69696040 TGCTGAAGGTTGGGTGGCTGTGG + Intronic
932436348 2:71704509-71704531 TGGTGAGGCAGCTGAGGCTGAGG + Intergenic
933153541 2:78945089-78945111 TGCTTAAGCTCAGGAGGCAGAGG - Intergenic
934036024 2:88088951-88088973 TGGTGAAGGTGAGCAGGCTGAGG + Intronic
934303246 2:91796586-91796608 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
934330013 2:92056170-92056192 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
934468237 2:94286079-94286101 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
934851977 2:97707356-97707378 TGTTGATGCTGCTGATGCTGGGG - Intergenic
935203996 2:100881982-100882004 TGCTGAAACTGCTGGGGCTGGGG + Intronic
935496887 2:103793156-103793178 AGCAGATGCTGCTGAGGCTGTGG + Intergenic
936004841 2:108875773-108875795 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
936663576 2:114569396-114569418 AGCTGAAAATGCTGAGGCTGTGG - Intronic
937045081 2:118846914-118846936 TGCTGAGGCGGCGGGGGCGGGGG + Exonic
937178675 2:119969105-119969127 TGCTTAAGCTTGGGAGGCTGAGG - Intronic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
937253947 2:120541565-120541587 TGCTGAAGCTGAGGGCACTGGGG - Intergenic
937394806 2:121525473-121525495 TGCAGAATCTGCTGAGGTTGGGG - Intronic
937414976 2:121707212-121707234 TGCTCAAACTGGGGAGGCAGAGG + Intergenic
938388383 2:130883866-130883888 GGCTGAAGCTCAGGAGGCTGAGG - Intronic
938848011 2:135231702-135231724 TGCTGGAGCCTCGGAGGTTGAGG + Intronic
939632733 2:144544908-144544930 TGCTGGAGCTTGGGAGGCGGAGG - Intergenic
939663786 2:144924217-144924239 TGCTGAAGGTTGGGTGGCTGGGG - Intergenic
940953659 2:159705102-159705124 TGCTTGAGCTGAGGAGGCAGAGG - Intergenic
941106380 2:161359050-161359072 TGCTTCAGCTCAGGAGGCTGGGG - Intronic
941120191 2:161520991-161521013 TGCTGCAGCCCAGGAGGCTGAGG - Intronic
941181346 2:162262852-162262874 TCCAGATGCTGGGGAGGCTGAGG + Intergenic
942314666 2:174686558-174686580 TGCTGGAGCTGAGAAGACTGCGG - Intergenic
943129678 2:183840005-183840027 TGCTGCAGCTGCAGCTGCTGTGG - Intergenic
943750024 2:191501312-191501334 AGCTGAAGCTGCGGCTGCTCTGG - Intergenic
944248593 2:197558454-197558476 GGCTGAGGCTGAAGAGGCTGAGG - Intergenic
945487131 2:210409315-210409337 TGCTGAAGGTTGGGTGGCTGTGG + Intergenic
946237422 2:218332672-218332694 TGCTGAAGGTGGAGAGGGTGGGG - Intronic
947231959 2:227897000-227897022 TGCTTGAGCTCCGGAGGTTGAGG + Intronic
947611009 2:231525153-231525175 TGCTGAGGCTGTGGGAGCTGTGG + Exonic
947730323 2:232424998-232425020 TGCTTGAGCTCAGGAGGCTGAGG + Intergenic
947733722 2:232444390-232444412 AGCAGAAGCTGAGGAGGCTGTGG - Intergenic
947897857 2:233692186-233692208 TGCTGAAGGTGTGGAGGGTGGGG + Intronic
948820403 2:240540658-240540680 TGCTGCAGCGGAGGAGACTGGGG - Intronic
948875070 2:240821796-240821818 TGCTTGAGCTGGGGAGGCTGAGG - Intergenic
1169159502 20:3364840-3364862 TGCTGAAGGTTAAGAGGCTGCGG + Intronic
1169196627 20:3686541-3686563 TGCTGAAGCTGCAGCTACTGGGG - Intergenic
1170317064 20:15054360-15054382 TGCTGAGGCTGGGGTGGCTGTGG - Intronic
1170493371 20:16900458-16900480 TGCTTAAGCCCAGGAGGCTGAGG + Intergenic
1170843773 20:19945230-19945252 CGCTGAAGATTAGGAGGCTGAGG + Intronic
1170964477 20:21053678-21053700 TGCTGCAGCTGTGGGGGTTGTGG + Intergenic
1171040807 20:21761156-21761178 TGCTTGAGCTCCGGAGGCGGAGG + Intergenic
1171170958 20:23015072-23015094 TCCTAAAGCTGCAGAGCCTGGGG + Intergenic
1171300970 20:24060069-24060091 TGCTTAAGCTTGGGAGGCGGAGG - Intergenic
1171969597 20:31555556-31555578 TGCTGAAGTGGCTGAGGCTCGGG + Intronic
1171989056 20:31681555-31681577 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1172413406 20:34743173-34743195 TGCTGCTGCTGCTGAGACTGTGG + Exonic
1172780127 20:37431691-37431713 TGCTTGAGCTGGGGAGGCAGAGG - Intergenic
1173313235 20:41919133-41919155 TGCTGAAGGTTGGGTGGCTGTGG + Intergenic
1173490621 20:43477403-43477425 TGCTTAAGCCCAGGAGGCTGAGG - Intergenic
1174063983 20:47851706-47851728 GGCTGAAGCCAGGGAGGCTGGGG + Intergenic
1174080511 20:47968151-47968173 TGCTGCAGATGGGGAAGCTGAGG + Intergenic
1174104490 20:48152766-48152788 TGTTGAAGCTGCCCAGTCTGTGG + Intergenic
1175666447 20:60864112-60864134 TCCTTAAGCTGTGGGGGCTGAGG + Intergenic
1175740058 20:61413874-61413896 TGTTGAAGCTGCCCAGCCTGTGG - Intronic
1175794410 20:61762707-61762729 TTCTGTAGCTGCAGAGCCTGGGG - Intronic
1176267780 20:64219790-64219812 TGCTGCAGCTGCTGCTGCTGGGG - Exonic
1176328296 21:5521143-5521165 TGCTGAAACTTGGGAGGCGGAGG + Intergenic
1176329397 21:5535082-5535104 TGCTGAAACTTGGGAGGCAGAGG - Intergenic
1176358042 21:5969133-5969155 TGCTGAACCTGCCCTGGCTGGGG + Intergenic
1176398360 21:6285869-6285891 TGCTGAAACTTGGGAGGCAGAGG + Intergenic
1176399461 21:6299808-6299830 TGCTGAAACTTGGGAGGCGGAGG - Intergenic
1176437696 21:6689296-6689318 TGCTGAAACTTGGGAGGCGGAGG + Intergenic
1176438797 21:6703235-6703257 TGCTGAAACTTGGGAGGCAGAGG - Intergenic
1176461958 21:7016366-7016388 TGCTGAAACTTGGGAGGCGGAGG + Intergenic
1176463059 21:7030304-7030326 TGCTGAAACTTGGGAGGCAGAGG - Intergenic
1176485519 21:7398144-7398166 TGCTGAAACTTGGGAGGCGGAGG + Intergenic
1176486620 21:7412083-7412105 TGCTGAAACTTGGGAGGCAGAGG - Intergenic
1176585644 21:8582269-8582291 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1176973374 21:15290565-15290587 AGCTGAAGCTGCCCAAGCTGTGG - Intergenic
1178103031 21:29290865-29290887 ACCTGAAGCTGCAGAGGCAGGGG + Intronic
1178508490 21:33182353-33182375 TGCTTAAGCTGGGGAGGTCGTGG - Intergenic
1178901154 21:36600191-36600213 CGCTTAAGCTTCGGAGGCAGAGG - Intergenic
1179190925 21:39121219-39121241 TGCTGTAGCTGCCTAGGGTGGGG - Intergenic
1179718171 21:43300819-43300841 AGCTGCAGGTGCGGAAGCTGGGG + Intergenic
1179765476 21:43569418-43569440 TGCTGAACCTGCCCTGGCTGGGG - Intronic
1180152961 21:45961450-45961472 TGTGGAAGCTGCCAAGGCTGGGG + Intergenic
1180268453 22:10559168-10559190 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1180525225 22:16252448-16252470 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1180558202 22:16594210-16594232 TGCTTAAGCTCAGGAGGTTGAGG + Intergenic
1180722334 22:17918756-17918778 AGCTGCAGATGCGGAGGCTGAGG - Intronic
1180952654 22:19727648-19727670 TGTTGACGCTGTGGATGCTGTGG + Intergenic
1180952671 22:19727732-19727754 TGTTGACGCTGTGGATGCTGTGG + Intergenic
1181142325 22:20815295-20815317 TGCTTAAGCCCGGGAGGCTGAGG + Intronic
1181541827 22:23577619-23577641 TGCTTAAGCCTCGGAGGTTGAGG - Intronic
1182333612 22:29568706-29568728 TGCTTAAACTGGGGAGGCGGAGG + Intronic
1182705244 22:32272907-32272929 TCCGGAAGGTGCGGAGGTTGAGG - Intergenic
1183109129 22:35635976-35635998 TGCTGAAGCCCAGGAGGCTGAGG - Intronic
1183123089 22:35746496-35746518 GGCTGCAGCAGCGGTGGCTGCGG + Exonic
1183687516 22:39369733-39369755 TGGTGAGGCTGCAGAGCCTGTGG + Intronic
1184721658 22:46318066-46318088 GGCTGGAGCTCAGGAGGCTGAGG - Intronic
1184831056 22:46987761-46987783 TGCCGAAGTTGGGGTGGCTGTGG + Intronic
1185178251 22:49343614-49343636 TGCTAAAGTTGGGGTGGCTGTGG - Intergenic
1203323142 22_KI270737v1_random:88476-88498 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
949145056 3:690455-690477 TGATGCAGATGTGGAGGCTGAGG + Intergenic
949440960 3:4079846-4079868 AGCTGAAGCTGCAGAAACTGTGG + Intronic
950265671 3:11571040-11571062 TGCCGAGGTGGCGGAGGCTGAGG + Intronic
950452221 3:13071911-13071933 TGCTGACGCAGCAGAGGCAGAGG + Intronic
950604310 3:14064794-14064816 TGCTGGAGCTGCTGCTGCTGGGG - Exonic
950945489 3:16941434-16941456 AGCTGGTGCTGCTGAGGCTGGGG - Intronic
950965040 3:17140156-17140178 TGCAGAAGGTGAGGATGCTGGGG + Intergenic
950997171 3:17514828-17514850 TGCTCAAGATGCAGAGACTGGGG + Intronic
951072599 3:18349615-18349637 TGCTGTGGCTGTGGAGGCGGCGG + Exonic
952908882 3:38165601-38165623 CGCTGCTGCTGCGGAGGCCGAGG + Exonic
953037190 3:39223235-39223257 TGATGATGCTGCTGAGGCTGTGG + Intergenic
953123794 3:40071677-40071699 TGCAGATGCTGGGGAGGTTGGGG + Intronic
953694331 3:45146092-45146114 TGCGGAGGGTGCGGAGGGTGCGG - Intronic
953709249 3:45256182-45256204 TGCTTAAGCCCAGGAGGCTGAGG - Intergenic
953935278 3:47036469-47036491 TGCTGAAGCCCAGGAGGCAGAGG + Intronic
954018119 3:47713507-47713529 TGCTTGAGCTGAGGAGGTTGAGG - Intronic
954243968 3:49316401-49316423 TGCTTGAACTGGGGAGGCTGAGG - Intronic
954949067 3:54453073-54453095 TGCTTAAGCCCAGGAGGCTGAGG - Intronic
955338788 3:58108835-58108857 GGCTGAAGCTGCTGAGGCCATGG + Intronic
955383204 3:58457972-58457994 TGCTTAAACTGAGGAGGCAGAGG + Intergenic
955441382 3:58959176-58959198 TGCTTAAACTGGGGAGGCGGAGG - Intronic
955916493 3:63912716-63912738 CGCTGGGGCTGCGGAGGCGGCGG - Exonic
956063411 3:65371529-65371551 TGCTGAAGGTTGGGTGGCTGTGG + Intronic
956478061 3:69644311-69644333 GTGTGAACCTGCGGAGGCTGAGG + Intergenic
956835576 3:73093889-73093911 TGCTTAAACTTGGGAGGCTGAGG - Intergenic
956931754 3:74051343-74051365 TGCTTGAGCTCAGGAGGCTGAGG + Intergenic
957557535 3:81780864-81780886 TGTGGAAGCTGCCAAGGCTGGGG + Intergenic
957703991 3:83755964-83755986 TGTGGAAGCTGCCAAGGCTGGGG - Intergenic
957787871 3:84905108-84905130 TTCTGAGGCTGCGGGGGCAGGGG - Intergenic
958529225 3:95304047-95304069 TGCTTGAGCTGGGGAGGCAGAGG + Intergenic
959963619 3:112330481-112330503 TGCTTAAGCTCGGGAGGTTGAGG - Intergenic
960151323 3:114251555-114251577 TGCTGAAGCTGGAGAGACTAAGG + Intergenic
960449719 3:117791325-117791347 AGGAGAAGCTGAGGAGGCTGTGG - Intergenic
960857992 3:122122884-122122906 TGCTGAAGCTGCCAAGCCTTGGG - Intergenic
960883913 3:122375048-122375070 TGCTTGAGCTGAGGAGGTTGAGG + Intronic
961333028 3:126154146-126154168 TGCTGAAGATGGGGAGACTTGGG - Intronic
961351062 3:126303422-126303444 TGCTGAAGGAGTGGAGGATGGGG - Intergenic
962212496 3:133490987-133491009 TGCTCAGGCTGCTGGGGCTGAGG - Intergenic
962328623 3:134457544-134457566 TGCGGAGGCTCAGGAGGCTGAGG - Intergenic
962546458 3:136440903-136440925 TGCTTAAGCTGGGAAGGCAGAGG + Intronic
962792053 3:138820575-138820597 TGCTTAAGCCCCGGAGGCAGTGG - Intronic
962918904 3:139934514-139934536 TGCTGAGGCTGCAGTGGCGGGGG - Intergenic
963028501 3:140942584-140942606 GGCGGAAAGTGCGGAGGCTGAGG + Intronic
963131562 3:141863101-141863123 TGCTGGAGCTGGGGAGGCAGAGG - Intergenic
963805469 3:149717081-149717103 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
963929907 3:150992807-150992829 TGCTGAAGGTGGGGTGGCTGTGG + Intergenic
963965169 3:151360122-151360144 TTGTGAATCTGCGGAGGCAGGGG + Intronic
964647319 3:158972143-158972165 TGCTAAAGCTTCGGGGGTTGGGG + Intronic
964773106 3:160245285-160245307 TGTGGAGGCTGTGGAGGCTGCGG + Intronic
964773108 3:160245294-160245316 TGTGGAGGCTGCGGAGGCTGCGG + Intronic
964773110 3:160245303-160245325 TGCGGAGGCTGCGGAGGCTGCGG + Intronic
965833603 3:172826706-172826728 TGCTGAAGGTTGGGAGGCAGTGG - Intergenic
965931106 3:174044026-174044048 TGAGGAAGCTGCCGAGGCTTAGG + Intronic
966167773 3:177040229-177040251 TGCTTGAGCTGGGGAGGCCGAGG + Intronic
966517126 3:180830183-180830205 TGCTGCAGCAGCAGAGGCTGAGG - Intronic
966899203 3:184468150-184468172 TGCGGAGGCTGCGGAGGCTGAGG - Intronic
966899206 3:184468159-184468181 TGCTTTGCCTGCGGAGGCTGCGG - Intronic
967080335 3:186043893-186043915 ACCAGAAGCTGGGGAGGCTGGGG - Intergenic
967622564 3:191650973-191650995 CGCTGAAGCTGCCAAGGCTTGGG + Intergenic
967936686 3:194733996-194734018 TGCTGAAGTTGAGATGGCTGTGG + Intergenic
968228952 3:196993001-196993023 TGAGGAGGCTGAGGAGGCTGCGG - Intronic
968437789 4:603067-603089 TGCTGAAGCTACCTAGTCTGTGG - Intergenic
968481787 4:836376-836398 GACTGCAGCTGCTGAGGCTGGGG + Intergenic
968481788 4:836385-836407 TGCTGAGGCTGGGGAGCATGCGG + Intergenic
968594218 4:1474039-1474061 TGCTGAGGCTGCTCTGGCTGTGG + Intergenic
968850565 4:3074961-3074983 TGAGGAAGCTGAGGAGGCGGCGG - Exonic
968871654 4:3245705-3245727 TGCTGGGGCTGCAGAGCCTGGGG - Intronic
968967867 4:3778420-3778442 TGTTGAAGCCGCACAGGCTGGGG - Intergenic
969316171 4:6382539-6382561 TGGGGAAGCTGCAGAGGATGAGG - Intronic
970384117 4:15538863-15538885 TGCTGATGCTGCTGATTCTGGGG - Intronic
970400161 4:15709520-15709542 TGATGATGCTGCAGAGGGTGGGG + Intronic
970677503 4:18468218-18468240 TGCTTGAGCTCAGGAGGCTGAGG + Intergenic
972495410 4:39629705-39629727 TGCTTGAGCTGGGGAGGCTGAGG - Intronic
972581351 4:40398272-40398294 TGAGGAAGCTGCAGAAGCTGAGG - Intergenic
973071063 4:45858861-45858883 TGCTTGAGCTCCAGAGGCTGAGG + Intergenic
973257923 4:48131401-48131423 TGCTTAAGCTGAGGAGTTTGAGG - Intronic
973327333 4:48877192-48877214 TGCTGAACCTCCTGGGGCTGGGG + Intergenic
973946238 4:55958999-55959021 TGATGGAGCTGTGGAGGTTGAGG + Intronic
974005934 4:56557163-56557185 TGCTTAAGCCTGGGAGGCTGAGG + Intronic
974088884 4:57289769-57289791 TGTTGAAGCTGCCCAGTCTGGGG + Intergenic
974335430 4:60538102-60538124 TGCTTAAGCAGCAGAGTCTGTGG - Intergenic
975778975 4:77819649-77819671 TGCTGGTGCTGCGGCGGCGGGGG + Intergenic
976000805 4:80371176-80371198 AGCTGGAGCTGGGGTGGCTGGGG + Intronic
977104174 4:92859149-92859171 TGCTGAAGGTTGGGGGGCTGAGG - Intronic
977526663 4:98154456-98154478 TGCTTAAGCTGCCCAGGTTGTGG - Intergenic
977666127 4:99649417-99649439 TGCTGGGGCTGAGGAGGTTGAGG + Exonic
977951346 4:102974151-102974173 TGCTTGAGCTGGGGAGGCAGAGG + Intronic
978168804 4:105643948-105643970 TGCTTAAGCTGGGGAGGTCGAGG - Intronic
979729316 4:124004674-124004696 TGCTGAAGTTTGGGTGGCTGTGG + Intergenic
980464265 4:133152418-133152440 TGCTGCTGCTGCGGTGGCGGAGG + Exonic
980568761 4:134582152-134582174 TGCTTAAACTGGGGAGGCAGAGG + Intergenic
980681656 4:136170154-136170176 TGCTTTAGCTGAGGAGGTTGAGG + Intergenic
981225081 4:142284801-142284823 TGCTGTAGCTGAACAGGCTGGGG - Intronic
981281687 4:142966281-142966303 TGTGGAAGCTGCTGAGGCTTGGG + Intergenic
981300967 4:143185307-143185329 TGCTGAGGCGGCGGTGGCCGTGG + Exonic
982118341 4:152116194-152116216 TGCTGAACCGGCTGAGGATGAGG - Intergenic
983863326 4:172734883-172734905 TGCGGAAGCTGCCAAGGCTTGGG - Intronic
984003555 4:174281444-174281466 TCCTGAACCTTGGGAGGCTGTGG + Intronic
984130152 4:175864919-175864941 TGCAGCTGCTGGGGAGGCTGAGG - Intronic
984645914 4:182219579-182219601 TGCTTGAGCTCAGGAGGCTGAGG + Intronic
985655932 5:1131349-1131371 TTCAGCAGCTGCTGAGGCTGAGG - Intergenic
985657921 5:1141680-1141702 AGCTGTAGCTGCTGTGGCTGAGG - Intergenic
985709891 5:1422271-1422293 CACTGGAGCTGCGGAGGCGGAGG + Intronic
985947657 5:3199588-3199610 TGCTGGAGCTGGGAAGCCTGGGG + Intergenic
985973065 5:3392607-3392629 TGGGGAGGCTGGGGAGGCTGGGG + Intergenic
985979797 5:3452855-3452877 GGCTGAGGCTCGGGAGGCTGTGG - Intergenic
986555637 5:9007899-9007921 GGGTGAAGGAGCGGAGGCTGAGG + Intergenic
987037373 5:14031918-14031940 TGCTGAAGCTGCAAAGGTGGAGG - Intergenic
988106875 5:26761764-26761786 TGCTGATGATGCGGAGGCCAAGG - Intergenic
989794277 5:45447324-45447346 AACTGGAGCTGGGGAGGCTGTGG - Intronic
989953242 5:50326287-50326309 TGCTGTAGCTGGGGAGTCGGAGG - Intergenic
991104371 5:62827784-62827806 TGCTGAAGGTTGGGTGGCTGTGG - Intergenic
991413015 5:66363604-66363626 TGCTGAAGGTTGGGTGGCTGTGG + Intergenic
991687160 5:69191967-69191989 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
991936902 5:71810976-71810998 CGCTGCAGCTGCAGAGCCTGAGG - Intergenic
991977330 5:72196190-72196212 GGCAGAAACTGAGGAGGCTGAGG + Exonic
992394583 5:76359064-76359086 GGGTGAAGGAGCGGAGGCTGAGG - Intergenic
992910724 5:81393923-81393945 TGCGGGAGCGGCGGCGGCTGGGG - Intronic
993045619 5:82862863-82862885 TGCTGCTGCTGCTGATGCTGAGG - Intergenic
993107163 5:83612383-83612405 TAGTGAAGCTGTGGAGGCAGGGG + Intergenic
993647022 5:90474560-90474582 TGGTGCGGCTGCCGAGGCTGCGG - Exonic
994645753 5:102466664-102466686 TACAGAAGCTGGTGAGGCTGTGG - Intronic
995113503 5:108453902-108453924 TGTGGAAGCTGCCAAGGCTGGGG - Intergenic
995229286 5:109740354-109740376 TGGTGTAGCTGCTGAGCCTGGGG + Intronic
995802246 5:116010057-116010079 TGCTGAAGCTGAGGTGGCTATGG - Intronic
995885146 5:116886129-116886151 TGCTTAAGCTCAGGAGGATGAGG - Intergenic
997039256 5:130232622-130232644 TGCTTAAACTGGGGAGGCAGAGG + Intergenic
997132202 5:131288138-131288160 TGCTTAAGCCCCGGAGGTTGAGG + Intronic
997292615 5:132748248-132748270 TGCTTAAGGTGCGGGGGGTGGGG - Intronic
997310392 5:132874913-132874935 TGGTCAAGCTTGGGAGGCTGAGG + Exonic
997830111 5:137142437-137142459 TGCTGAAGCTGCGGCAGTGGAGG - Intronic
997980606 5:138465565-138465587 CGCCGCGGCTGCGGAGGCTGGGG - Exonic
998015955 5:138732352-138732374 TGCTGATGCTGATGATGCTGAGG - Intronic
998024028 5:138798014-138798036 TGCTGAAGCTGTAAAGGATGAGG - Intronic
998579189 5:143352849-143352871 TGCTGAAGGTGGGGTGGCTGTGG + Intronic
998740873 5:145199765-145199787 TGCTTAAGCCCAGGAGGCTGAGG + Intergenic
999234402 5:150081873-150081895 TGCTGACGCTGCAGAGGCAACGG - Intronic
999287788 5:150404605-150404627 TCCTGAAGCTGCTGAGGCCGGGG - Intronic
1000348515 5:160334121-160334143 TGCTGAAGTTGGGGTGCCTGAGG - Intronic
1000542461 5:162556918-162556940 TGCTGAAGTAGGGGTGGCTGAGG + Intergenic
1000907341 5:166978801-166978823 GGCTGCAGCTGCTGTGGCTGCGG - Intergenic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1001530152 5:172455610-172455632 CGTTGAAGCTGCCGTGGCTGGGG + Intergenic
1001797179 5:174512262-174512284 TTCTCTAGCTGGGGAGGCTGGGG + Intergenic
1002172077 5:177380802-177380824 ATCTGTAGCTGGGGAGGCTGAGG - Intronic
1002503054 5:179659611-179659633 CGCTTGAGCTGGGGAGGCTGAGG - Intergenic
1002552593 5:180007315-180007337 TGCTTAAGCCGAGGAGGCAGAGG + Intronic
1002705484 5:181158541-181158563 TGCTTGAGCTTAGGAGGCTGAGG + Intergenic
1003823020 6:9921494-9921516 TGCTGAAGTTGGAGTGGCTGTGG - Intronic
1003835372 6:10066043-10066065 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
1004023994 6:11800990-11801012 GGCTGAAGCTGCGGAGGTCGAGG + Intronic
1004141839 6:13025169-13025191 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
1004216845 6:13711465-13711487 TGCTGCTGCTGCGGCGGCGGCGG + Exonic
1004251287 6:14025047-14025069 TGCTCAGGCTGCTGGGGCTGCGG - Intergenic
1004268980 6:14177056-14177078 TGCAGAAAGTGGGGAGGCTGGGG + Intergenic
1005519083 6:26582877-26582899 AGCTTAAGCTGAGGAGGTTGAGG - Intergenic
1005546324 6:26877232-26877254 TGCTGAAACCTCGGAGGCGGAGG - Intergenic
1006048448 6:31319816-31319838 TGCTGGAACTGGGGAGGCAGAGG - Intronic
1006148641 6:31974194-31974216 TGCTTGAGCTGGGGAGGCGGAGG + Intronic
1006408061 6:33856586-33856608 TTCTGAGGCTGGGGAGGCAGTGG + Intergenic
1006538594 6:34720896-34720918 TGCTGGAGCCGGGGAGGTTGAGG + Intergenic
1006576280 6:35048831-35048853 TGGTGAGGCTGAGGAGGCTGCGG + Intronic
1007397715 6:41587079-41587101 TGCTCAACCTGCAGAGGCAGGGG + Exonic
1007473998 6:42107192-42107214 TGCTGGAGCTGGGGGTGCTGGGG + Exonic
1007665292 6:43509935-43509957 TGCGGCTGCGGCGGAGGCTGCGG + Exonic
1007895667 6:45355088-45355110 TCCTGATGCTTGGGAGGCTGAGG - Intronic
1008254936 6:49286344-49286366 TTCTGAAGTTGAGGTGGCTGTGG + Intergenic
1008845230 6:55955118-55955140 TGATGAAGCTGGGGTGGGTGAGG + Intergenic
1011241940 6:85281040-85281062 TGGTGCTGCTGTGGAGGCTGAGG - Intergenic
1011734388 6:90296805-90296827 TGCTGCTGCTGCTGAGGCGGCGG + Intronic
1013149317 6:107428751-107428773 TGCTTGAGCTGAGGAGTCTGAGG + Intronic
1013196215 6:107847417-107847439 TGCTTAAGCTGGGGAGGTAGAGG + Intergenic
1013504317 6:110784073-110784095 TGCTTGAGCTGGGGAGGCAGAGG + Intronic
1013551600 6:111212707-111212729 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
1014440995 6:121473745-121473767 TCCAGATGCTGTGGAGGCTGAGG + Intergenic
1014446246 6:121531279-121531301 TGCTCAAACTGGGGAGGCAGAGG + Intergenic
1014913365 6:127118794-127118816 CTCAGAAGCTGCGGCGGCTGCGG - Exonic
1015232207 6:130928007-130928029 TGCTTAAGCCTGGGAGGCTGAGG + Intronic
1015711654 6:136148270-136148292 TGCTTAAGCTCAGGAGGTTGAGG + Intronic
1015954990 6:138589822-138589844 TGCTGGGGATGCAGAGGCTGGGG - Intronic
1016176642 6:141084723-141084745 AGCTGAGGTTGCGGAGGCTGAGG + Intergenic
1016387130 6:143539468-143539490 TACAGAGGCTGCAGAGGCTGTGG - Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016842467 6:148538190-148538212 TGCTGTGTCTGCTGAGGCTGGGG + Intronic
1016882965 6:148929190-148929212 TGCTAAAGAGGGGGAGGCTGTGG - Intronic
1017256883 6:152343642-152343664 GCCTGAGGCTGAGGAGGCTGAGG - Intronic
1017458903 6:154630607-154630629 TGCTTGAGCTCAGGAGGCTGAGG - Intergenic
1017885384 6:158595377-158595399 TGCTGAAGCTGGCAAGGATGTGG + Intronic
1018241080 6:161775324-161775346 TGCTTGAGCTTGGGAGGCTGAGG - Intronic
1018603471 6:165572718-165572740 TGGTGAAACCCCGGAGGCTGAGG + Intronic
1018896417 6:168021362-168021384 CTCTGAAGCAGCGGAAGCTGGGG - Intronic
1018957910 6:168423792-168423814 TGTTTAAGCTGCCCAGGCTGTGG - Intergenic
1019186221 6:170221960-170221982 TGCAGATGCTGCTGAGGCCGTGG - Intergenic
1019414008 7:919191-919213 TGCTGCAGGTGGGGAGGGTGCGG - Intronic
1019756710 7:2776112-2776134 TGCTGAAGCCCAGGAGGTTGAGG - Intronic
1019793585 7:3033425-3033447 TGCTGCAGCTGCCCAGTCTGTGG + Intronic
1019922976 7:4174546-4174568 GGGTGCAGCTGCGGAGGCAGAGG + Intronic
1019974594 7:4570568-4570590 TGCTTAAGCTGGGGATGCAGAGG + Intergenic
1020063682 7:5171242-5171264 TGCTTAAACTGGGGAGGCAGAGG - Intergenic
1020172795 7:5858077-5858099 TGCTGAAGCCCAGGAGGTTGAGG + Intergenic
1020225893 7:6279704-6279726 TGCTTGAGCCGAGGAGGCTGAGG - Intergenic
1020357920 7:7297619-7297641 TACTGATGCTGGGGAGGATGTGG - Intergenic
1020963726 7:14839483-14839505 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1021349631 7:19575219-19575241 TGCTGAATGTTGGGAGGCTGTGG - Intergenic
1021993016 7:26154632-26154654 TGCTGGAGCCGGGGAGGTTGAGG - Intronic
1022063386 7:26824149-26824171 TGCTGAAGGTTGGGGGGCTGTGG - Intronic
1022286008 7:28956674-28956696 TGCTGGAGCTGCGGCTGCGGCGG + Exonic
1022372088 7:29781720-29781742 TGCTGAAGCCTGGGAGGTTGAGG - Intergenic
1022396184 7:29989682-29989704 TGCTGAGGCTGCGGCCGCCGAGG + Intronic
1022594693 7:31701694-31701716 TGCTGAAGGTTAGGTGGCTGTGG - Intronic
1023284406 7:38604375-38604397 TGCCGAAGGTGCAGAGGCTCTGG - Intronic
1023410283 7:39883186-39883208 TGCTTGATCTCCGGAGGCTGAGG + Intergenic
1023645402 7:42307625-42307647 TGCTTAAGCTCAGGAGGCAGAGG - Intergenic
1023698969 7:42874606-42874628 GGGTGAAGGAGCGGAGGCTGAGG + Intergenic
1023938835 7:44757456-44757478 TGCTGCAGCTGTGGCTGCTGCGG + Exonic
1024972044 7:55079347-55079369 TGCTGAAGATGCAGGAGCTGCGG + Intronic
1025321415 7:58098067-58098089 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1025488328 7:61079642-61079664 TGCTTCAGCTTGGGAGGCTGAGG + Intergenic
1025551379 7:62254145-62254167 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
1025565510 7:62429526-62429548 TGCTTAAGCTTGGGAGGCTGAGG - Intergenic
1025693995 7:63765659-63765681 TTCGGAATCTGCAGAGGCTGCGG - Intergenic
1026415473 7:70175590-70175612 TGCTGAAGGTTGGGTGGCTGTGG - Intronic
1026426742 7:70302319-70302341 TGCTTAAGCTGGGGAGATTGAGG + Intronic
1026490883 7:70862232-70862254 TGCTTGAGCTGGGGAGGTTGAGG + Intergenic
1026545933 7:71322033-71322055 TGCTTAAGCTCAGGAGGTTGAGG - Intronic
1026836222 7:73641207-73641229 TGCTTGAGCTGGGGAGGGTGAGG + Intergenic
1027233642 7:76285723-76285745 TGCTGTAGCTCCCGTGGCTGTGG - Exonic
1028507064 7:91582330-91582352 TGCAGAACCTGTGGATGCTGGGG - Intergenic
1028870711 7:95768896-95768918 TGCTGAAGGTGGGGTAGCTGTGG - Intergenic
1028896484 7:96047428-96047450 TGCTGATGCTGCAGGTGCTGAGG + Intronic
1029068050 7:97872192-97872214 TGCTGATGCTGCGGCTCCTGCGG - Intronic
1029112229 7:98218196-98218218 TGGAGAAGCGGAGGAGGCTGTGG - Intronic
1029256121 7:99270798-99270820 TGCTTAAGCTCGGGAGGTTGAGG + Intergenic
1029487510 7:100852603-100852625 AGCTGGAGCAGCGCAGGCTGGGG + Intronic
1029531422 7:101127760-101127782 TGCTTCAGCTGGGGAGGCGGAGG + Intronic
1030033446 7:105388928-105388950 TGCTGGAGCGGCGGCGGCGGCGG - Intronic
1032137880 7:129297943-129297965 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
1032452766 7:132047494-132047516 TTCTGAAGCTGTAGAAGCTGTGG - Intergenic
1032533786 7:132643834-132643856 TCCTGATACTGGGGAGGCTGAGG + Intronic
1032614697 7:133455000-133455022 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
1032785486 7:135196566-135196588 TGCTGAAGGAGAGGGGGCTGTGG + Intronic
1033196110 7:139328778-139328800 TGCTTGAGCTGGGGAGGTTGAGG + Intergenic
1033801433 7:144906916-144906938 TCCAGCTGCTGCGGAGGCTGAGG + Intergenic
1034104933 7:148482141-148482163 TCCTGAAGCTGCGGAGGCCAGGG - Intergenic
1034187735 7:149191957-149191979 TGCTGTAGCTGCACAGGCTGTGG - Intergenic
1034191084 7:149214022-149214044 TGTTGAAGCTGCCCAGCCTGTGG - Intronic
1034192644 7:149223871-149223893 AGCTGCGGCTGCGGTGGCTGGGG - Exonic
1034417440 7:150972449-150972471 GGCAGAAGAAGCGGAGGCTGAGG + Intronic
1034619110 7:152443787-152443809 TGCTTAAGCTCAGGAGGTTGAGG - Intergenic
1034622202 7:152464462-152464484 GGCGGAAGCTGCGGGGGCCGGGG + Intergenic
1034658045 7:152744932-152744954 TGCTGAGGCAATGGAGGCTGAGG - Intergenic
1034844313 7:154430339-154430361 TGCTTAAGCTGTGCAGTCTGTGG - Intronic
1034940341 7:155226586-155226608 TGATGAGGCTGCTGTGGCTGGGG - Intergenic
1034964754 7:155384190-155384212 TGGGGAGGCTGGGGAGGCTGGGG - Intronic
1034991938 7:155553243-155553265 TGCTGAGGCTACAGAGGTTGGGG + Intergenic
1035010447 7:155711218-155711240 TGCTGAGGCGGCGGTGGCGGTGG - Exonic
1035013228 7:155739751-155739773 TGCTGAGGTTGCTGAGGCTGAGG - Exonic
1035127480 7:156619013-156619035 AGCTGCTGCTGCGGAGGCCGTGG - Intergenic
1035133336 7:156675900-156675922 AGCTGCAGCTGCAGAGGCTGTGG + Intronic
1035149912 7:156861257-156861279 TGTTGAAGCTGCCAAGGCTTGGG + Intronic
1035209516 7:157317477-157317499 CGCTTAAGCTGGGGAGGTTGAGG + Intergenic
1035453104 7:158991858-158991880 TGCAGCAGCTGCCGGGGCTGAGG + Intergenic
1036438559 8:8759066-8759088 TGCTTGAGCTGGGGAGGCGGAGG - Intergenic
1036708376 8:11061381-11061403 ACCTGAACCTGGGGAGGCTGAGG + Intronic
1037519056 8:19662079-19662101 TGCTGAAGATGCGGGGGGGGGGG - Intronic
1037519065 8:19662088-19662110 AGCTGAAGCTGCTGAAGATGCGG - Intronic
1038006260 8:23433019-23433041 TGCTGTACCTGCTGCGGCTGCGG - Exonic
1038272518 8:26087090-26087112 TGTTGAAGCTGCCTAGCCTGTGG - Intergenic
1038409536 8:27347431-27347453 TGTTGAAGCTGCCCAGTCTGTGG - Intronic
1038441299 8:27572543-27572565 TGTTGAAGCTGCCCAGCCTGTGG - Intergenic
1038575515 8:28701165-28701187 TGCGGAAGCGGCGGTGGCTCGGG + Intronic
1038587812 8:28806144-28806166 TGCTTGAACTGCGGAGGCAGAGG + Intronic
1039487979 8:37926794-37926816 TGCTTAAGCCCAGGAGGCTGAGG + Intergenic
1040022378 8:42752404-42752426 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1040096250 8:43445993-43446015 CCCAGATGCTGCGGAGGCTGAGG - Intergenic
1041759823 8:61353125-61353147 TGCTGAGGGTGGGGAGGTTGAGG - Intronic
1042154220 8:65824590-65824612 TGCTGAAGGTTGGGTGGCTGTGG - Intronic
1042247313 8:66720860-66720882 TGCTTGAGCTGCAGAGGCGGAGG + Intronic
1042287797 8:67133614-67133636 TGCTGAAGATTGGGTGGCTGTGG + Intronic
1042316798 8:67434695-67434717 TGCTGCAGCTGCAGCTGCTGCGG - Intronic
1042741506 8:72052336-72052358 TGCTGAAGCCCGGGAGGCGGAGG + Intronic
1042789465 8:72587643-72587665 TGCTTAAGCTGGGGAGGTTGAGG + Intronic
1042841490 8:73128660-73128682 TGCTTAAGGTTGGGAGGCTGTGG - Intergenic
1043001607 8:74767043-74767065 TGCTTGAGCAGGGGAGGCTGAGG - Intronic
1043448258 8:80340462-80340484 TGGGGAAGCTGTGGAGGCTGAGG - Intergenic
1044922695 8:97182523-97182545 TGCTGAAGCTGTGCTGACTGGGG + Intergenic
1045258619 8:100551427-100551449 TGCTGAAGCTGAGTATGCCGTGG - Intronic
1045323529 8:101100089-101100111 TGCTTGAGCTGGGGAGGTTGAGG - Intergenic
1045391396 8:101718544-101718566 TGATGAAGATGCAGACGCTGAGG - Intronic
1045393031 8:101733947-101733969 TCCTGGGGCTGAGGAGGCTGTGG + Intronic
1047292612 8:123542748-123542770 GGCTTGAGCTGGGGAGGCTGAGG - Intergenic
1047490432 8:125369915-125369937 TGTGGAAGCTGCCGAGGCTCGGG + Intergenic
1047506000 8:125480847-125480869 TGCAGAAGTTTGGGAGGCTGAGG - Intergenic
1048110743 8:131465471-131465493 GGCTGAAGCTCTGGAGGTTGAGG + Intergenic
1048278089 8:133082528-133082550 TGCTGCAGCAGAGCAGGCTGTGG + Intronic
1048697955 8:137049780-137049802 TGCTGGAGCTGCTGGAGCTGGGG - Intergenic
1048885184 8:138903873-138903895 TGCTGGAGCTGCTGAGTTTGGGG + Intronic
1049289660 8:141795108-141795130 TGATGAAGCCTCAGAGGCTGGGG - Intergenic
1049453892 8:142677295-142677317 TGCTGGGGCTGCGGATTCTGTGG + Intronic
1049689792 8:143953461-143953483 TGCTGCAGCGGCGGCGGCGGCGG - Intronic
1049798278 8:144506294-144506316 TGCTGAAGCTGATGAGTGTGCGG + Exonic
1051416179 9:16843433-16843455 GGCTGAGGCAGTGGAGGCTGAGG - Intronic
1051619509 9:19036595-19036617 TGCGGAAGCTGCCAAGGCTTGGG - Intronic
1052701322 9:31941380-31941402 TGTGGAAGCTGCTGAGGCTTGGG - Intergenic
1052936976 9:34101153-34101175 TGCTGAAGCCCAGGAGGTTGAGG - Intronic
1053203282 9:36166745-36166767 CGCGGTAGCTGAGGAGGCTGTGG - Intergenic
1053575209 9:39353115-39353137 TGCTGGAGGTGAGGTGGCTGTGG - Intergenic
1053839713 9:42181049-42181071 TGCTGGAGGTGAGGTGGCTGTGG - Intergenic
1053944651 9:43294338-43294360 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
1054096771 9:60911798-60911820 TGCTGGAGGTGAGGTGGCTGTGG - Intergenic
1054118175 9:61187424-61187446 TGCTGGAGGTGAGGTGGCTGTGG - Intergenic
1054589580 9:66995140-66995162 TGCTGGAGGTGAGGTGGCTGTGG + Intergenic
1054867201 9:70014652-70014674 GGCTAAAGCTGGGGAGGTTGAGG - Intergenic
1055514188 9:77020261-77020283 TGCTGAGGCTGCGACTGCTGGGG - Exonic
1055550159 9:77425835-77425857 TGCTGAAGCTGGTGAGCATGTGG + Intronic
1055747798 9:79469751-79469773 TTCTGAAGGTATGGAGGCTGTGG + Intergenic
1056581463 9:87890098-87890120 TGCAGGGGCTGTGGAGGCTGAGG + Intergenic
1057208114 9:93185122-93185144 TGCAGGGGCTGCGGGGGCTGCGG - Exonic
1057468932 9:95340479-95340501 TGCTGGAGCCCAGGAGGCTGAGG + Intergenic
1057921673 9:99103655-99103677 TGCTGAGGCTGCTGGAGCTGCGG + Intergenic
1058624982 9:106925599-106925621 GGCTGCAGCTGTGGTGGCTGTGG - Exonic
1058696361 9:107562510-107562532 TGCTGGAGCCCAGGAGGCTGAGG - Intergenic
1058982961 9:110187050-110187072 TGCTTGAACTGAGGAGGCTGAGG + Intergenic
1059109335 9:111540046-111540068 TGCTTGAGCTGGGGAGGTTGAGG + Intronic
1059285623 9:113169335-113169357 TTCTTGAGCTGTGGAGGCTGAGG + Exonic
1059312263 9:113396704-113396726 TGCAGAGGCTGGGGAGGCTGCGG + Intronic
1059603257 9:115804429-115804451 TGCTGAAGGTTGGGTGGCTGTGG + Intergenic
1060412202 9:123407187-123407209 AGCTGGAGCCTCGGAGGCTGGGG + Intronic
1060984163 9:127810090-127810112 TGCTGAAGCTGCTGCAGGTGAGG + Exonic
1061161174 9:128895231-128895253 TGTAGAAGCTCGGGAGGCTGAGG + Intronic
1061217031 9:129227480-129227502 GGCTGAACCTGCAGAGGGTGGGG - Intergenic
1061584728 9:131558374-131558396 TGTGGAGGCTGAGGAGGCTGAGG - Intergenic
1061628355 9:131855782-131855804 TGCTGGAGATGTGGAGGCTGGGG + Intergenic
1061991748 9:134163193-134163215 TGCTGAAACAGCCAAGGCTGCGG - Intergenic
1061998291 9:134200158-134200180 TGCTTGAGCTGAGGAGGTTGAGG + Intergenic
1062104565 9:134746498-134746520 TGCTGAATCTGCAGTGGCAGAGG + Intronic
1062174187 9:135151792-135151814 AGCTGGTGCTGAGGAGGCTGAGG - Intergenic
1062242976 9:135549744-135549766 TGTGGAAGCTGCAGAGCCTGGGG + Exonic
1062274107 9:135722593-135722615 TGCTGAGGCTGCCGGGTCTGTGG - Intronic
1062570490 9:137182854-137182876 TGCTGGAGATGGGGAGGCTGAGG + Intronic
1062609261 9:137366656-137366678 GGCTGAGGTGGCGGAGGCTGTGG - Intronic
1203432698 Un_GL000195v1:105244-105266 TGCTGAAACTTGGGAGGCAGAGG + Intergenic
1203433807 Un_GL000195v1:119329-119351 TGCTGAAACTTGGGAGGCGGAGG - Intergenic
1203587786 Un_KI270747v1:22916-22938 TGCTTGAGCTTGGGAGGCTGAGG + Intergenic
1203615546 Un_KI270749v1:59793-59815 TGCTTGAGCTTGGGAGGCTGAGG - Intergenic
1185472204 X:390729-390751 GGCAGAGGCTGCAGAGGCTGTGG - Intergenic
1185590856 X:1276082-1276104 TGCTTCAGCTCCGGAGGCAGAGG - Intronic
1185784994 X:2883158-2883180 TGCTTGAGCTGGGGAGGCAGAGG + Intergenic
1185995063 X:4937200-4937222 TGCTTGAGCTGAGGAGGCAGAGG + Intergenic
1186149625 X:6660509-6660531 TGCTGGAGCTCCGGAGGTCGAGG + Intergenic
1186323997 X:8459044-8459066 TGCAGAAGCTGCCAAGGCTTGGG + Intergenic
1186443557 X:9606562-9606584 TGCTGGAACTCGGGAGGCTGAGG + Intronic
1186491128 X:9973252-9973274 AGCTGAAGATTGGGAGGCTGAGG - Intergenic
1186740435 X:12512006-12512028 TGCTGAAGGTTGGGTGGCTGTGG - Intronic
1187892263 X:23947197-23947219 TGCTTAAGCTCAGGAGGCGGAGG + Intergenic
1188369111 X:29347470-29347492 TGCTTGAGCTGGGGAGGTTGAGG - Intronic
1188857025 X:35209189-35209211 TGTTGAAGCTGCCAAGGCTTGGG + Intergenic
1189077799 X:37936435-37936457 TCCAGAGGCTGAGGAGGCTGAGG + Intronic
1189424602 X:40886786-40886808 TGCTGAAGGTTGGGTGGCTGTGG + Intergenic
1189791285 X:44607786-44607808 TGAGGAGGCTGAGGAGGCTGAGG + Intergenic
1189857743 X:45240280-45240302 TGTTGAAGCTGCTCAGTCTGTGG + Intergenic
1189973424 X:46440062-46440084 TACTGACGCTGCCAAGGCTGTGG - Intergenic
1190057410 X:47189721-47189743 AGCTGAAGCTGCGAAGGAAGAGG + Intergenic
1190064883 X:47233067-47233089 AGCTGCTGCTGCGGCGGCTGTGG + Exonic
1190252655 X:48738822-48738844 TGCTTGAGCTGGGGAGGCGGAGG - Intergenic
1190789257 X:53683962-53683984 TGCAGTAGCCGCGGAGGCGGCGG - Exonic
1190843425 X:54168218-54168240 TGCTTGAGCTCGGGAGGCTGAGG - Intronic
1192180545 X:68913119-68913141 GGCTGCGGCTGCGGCGGCTGCGG - Intergenic
1192180549 X:68913140-68913162 TGCTGCTGCTGCTGCGGCTGCGG - Intergenic
1192336702 X:70227412-70227434 TACTGTAGCTGCTGGGGCTGCGG - Intergenic
1192388747 X:70702245-70702267 TGCTGAAGTTGGGGTGGCTATGG - Intronic
1192557486 X:72101946-72101968 GGCTGAAGCAGTAGAGGCTGGGG - Intergenic
1192657056 X:73003255-73003277 TGCGGCGGCGGCGGAGGCTGCGG + Intergenic
1192665064 X:73079746-73079768 TGCGGCGGCGGCGGAGGCTGCGG - Intergenic
1193446894 X:81616572-81616594 TGATGAAGCTGGGGACACTGAGG + Intergenic
1194358785 X:92920619-92920641 TGCTGAAGCTGCAGGGGGTGGGG + Intergenic
1195286118 X:103385854-103385876 TGCTTGAGCTGGGGAGACTGAGG - Intergenic
1195394657 X:104397907-104397929 TTCTGAAGATGAGGAGACTGAGG + Intergenic
1195736748 X:108019566-108019588 TGCTGCAGCTGCAGACACTGTGG - Intergenic
1195792511 X:108603637-108603659 TGCTGAAGGTTGGGTGGCTGTGG + Intronic
1196711813 X:118770688-118770710 TGCTGAAGATGCGGAGCCTGTGG - Intronic
1197055485 X:122113765-122113787 TGCTGCAGCTGCAGCTGCTGTGG + Intergenic
1197147938 X:123189517-123189539 AGCTGACACTGCAGAGGCTGGGG - Intronic
1197150563 X:123216183-123216205 TGCTGAGGTAGGGGAGGCTGGGG - Intronic
1197569503 X:128131692-128131714 TGTTGAAGCTGCCAAGGCTTGGG - Intergenic
1198519709 X:137440552-137440574 TGCTCACACTGGGGAGGCTGAGG + Intergenic
1198679319 X:139164604-139164626 TGCTTAAGCCCAGGAGGCTGAGG + Intronic
1200093043 X:153644587-153644609 TGCTGGCGCTGCGGGCGCTGTGG + Intronic
1200227783 X:154428668-154428690 CGCTGAGGCAGTGGAGGCTGAGG + Exonic
1200666951 Y:6036313-6036335 TGCTGAAGCTGCAGGGGGTGGGG + Intergenic
1200794993 Y:7332858-7332880 TGCTGAAGCCCAGGACGCTGAGG - Intergenic
1200809862 Y:7473038-7473060 TCCTGAAACTCAGGAGGCTGAGG - Intergenic
1201790135 Y:17830721-17830743 TGCAGATGCTGCAGAGGATGTGG + Intergenic
1201811419 Y:18075268-18075290 TGCAGATGCTGCAGAGGATGTGG - Intergenic