ID: 915292558

View in Genome Browser
Species Human (GRCh38)
Location 1:154896463-154896485
Sequence AGGCAGGGGTGACCGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915292548_915292558 20 Left 915292548 1:154896420-154896442 CCTACGCATTATCTCATGGGAGC No data
Right 915292558 1:154896463-154896485 AGGCAGGGGTGACCGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915292558 Original CRISPR AGGCAGGGGTGACCGGCCCC AGG Intergenic
No off target data available for this crispr