ID: 915292627

View in Genome Browser
Species Human (GRCh38)
Location 1:154896906-154896928
Sequence GTCCAGCTGGAGAGCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915292624_915292627 4 Left 915292624 1:154896879-154896901 CCTATGACAGGCTGGCATTCACT No data
Right 915292627 1:154896906-154896928 GTCCAGCTGGAGAGCTGTGTGGG No data
915292623_915292627 11 Left 915292623 1:154896872-154896894 CCGTGTTCCTATGACAGGCTGGC No data
Right 915292627 1:154896906-154896928 GTCCAGCTGGAGAGCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915292627 Original CRISPR GTCCAGCTGGAGAGCTGTGT GGG Intergenic
No off target data available for this crispr