ID: 915292780

View in Genome Browser
Species Human (GRCh38)
Location 1:154897561-154897583
Sequence AGGGGGTCCCACCACAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915292780_915292794 28 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292794 1:154897612-154897634 ACCCCCTGAGCTGGGCTGCCTGG No data
915292780_915292789 5 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292789 1:154897589-154897611 TGGCTGCCCGGGATTGTAGTGGG No data
915292780_915292796 29 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292796 1:154897613-154897635 CCCCCTGAGCTGGGCTGCCTGGG No data
915292780_915292798 30 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292798 1:154897614-154897636 CCCCTGAGCTGGGCTGCCTGGGG No data
915292780_915292784 -6 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292784 1:154897578-154897600 CCCCCTGAGCTTGGCTGCCCGGG No data
915292780_915292792 19 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292792 1:154897603-154897625 TGTAGTGGGACCCCCTGAGCTGG No data
915292780_915292793 20 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292793 1:154897604-154897626 GTAGTGGGACCCCCTGAGCTGGG No data
915292780_915292782 -7 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292782 1:154897577-154897599 ACCCCCTGAGCTTGGCTGCCCGG No data
915292780_915292788 4 Left 915292780 1:154897561-154897583 CCAGGATTGTGGTGGGACCCCCT No data
Right 915292788 1:154897588-154897610 TTGGCTGCCCGGGATTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915292780 Original CRISPR AGGGGGTCCCACCACAATCC TGG (reversed) Intergenic
No off target data available for this crispr