ID: 915293971

View in Genome Browser
Species Human (GRCh38)
Location 1:154907100-154907122
Sequence GCTGAGGTGACAAGAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915293971_915293974 1 Left 915293971 1:154907100-154907122 CCAGCAGTTCTTGTCACCTCAGC No data
Right 915293974 1:154907124-154907146 CTGGACACCCCACAAACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915293971 Original CRISPR GCTGAGGTGACAAGAACTGC TGG (reversed) Intergenic